Search Results

Search found 89530 results on 3582 pages for 'file read'.

Page 330/3582 | < Previous Page | 326 327 328 329 330 331 332 333 334 335 336 337  | Next Page >

  • Visual Studio scratch disk behavior

    - by bobobobo
    I don't know if this feature exists, but I'd like a way to control Visual Studio 2010's scratch disk behavior (other than completely turning off intellisense). Right now it creates a massive .sdf file in the project folder (50MB+), and then it goes and creates an IPCH folder with 60MB+ of precompiled headers. All that's well and good while VS is running, but after it exits, I really would like the disk back. Is there a way to configure vs 2010 to Use the same location (%AppData%\VSScratch) for scratch disk files (so its easier to blow it away?) Automatically delete .sdf /ipch on exit? I know they don't delete them because its faster to startup.. but if you delete them yourself, startup time isn't that much increased..

    Read the article

  • HTML5 drag upload in new window

    - by user463604
    I have setup an HTML5 drag and drop upload into my site. The problem that I have is when a user is uploading a large file, they must wait for the upload to finish before navigating and using the rest of the site. So, what I'd like to do is allow the user to drag files to the main site and then have it automatically open a new window and start the upload there so they can still use the rest of the site while the upload is happening. Anyone have and advice on how to accomplish this or if it can even be done?

    Read the article

  • Makefile won't copy .o to obj/ and target to bin/ folders

    - by about blank
    I'm trying to write a Makefile which will copy its target and objects to bin/ and obj/ directories, respectively. Yet, when I try to run it I get the following error: nasm -f elf64 -g -F stabs main.asm -l spacelander.lst ld -o spacelander obj/main.o ld: cannot find obj/main.o: No such file or directory make: *** [spacelander] Error 1 Why is this happening? Update I noticed when I posted the error that it was due to white spacing errors. After taking care of those, I still get the new error I replaced with the old one I mentioned prior. What is this?? Update 2 Posted -d flag output below Makefile source. Source ASM := nasm ARGS := -f FMT := elf64 OPT := -g -F stabs SRC := main.asm OBJDIR := obj TARGETDIR := bin OBJ := $(addprefix $(OBJDIR)/,$(patsubst %.asm, %.o, $(wildcard *.asm))) TARGET := spacelander .PHONY: all clean all: $(OBJDIR) $(TARGET) $(OBJDIR): mkdir $(OBJDIR) $(OBJDIR)/%.o: $(SRC) $(ASM) $(ARGS) $(FMT) $(OPT) $(SRC) -l $(TARGET).lst $(TARGET): $(OBJ) ld -o $(TARGET) $(OBJ) clean: @rm -f $(TARGET) $(wildcard *.o) @rm -rf $(OBJDIR) make -d Output - NOTE: output is too many characters for body, thus is pastebinned http://pastebin.com/3bctGJxs

    Read the article

  • Rename Files in Python

    - by Jeff
    Hi all, Im trying to rename some files in a directory using python. I've looked around the forums here, and because i'm a noob, I cant adapt what I need from what is out there. Say I have a file called CHEESE_CHEESE_TYPE.*** and want to remove "Cheese_" so my resulting filename would be "CHEESE_TYPE" Im trying to use the os.path.split but it's not working properly. I have also considered using string manipulations, but have not been successful with that either. Any help would be greatly appreciated. Thanks.

    Read the article

  • goto was unexpected at this time

    - by SammytheNerd
    @echo off color 0a title Horror Game echo. echo. echo. echo. echo Welcome to the game echo If you get scared echo Feel free to leave echo. echo. echo You are in a dark room. echo It is cold. echo All you hear is a scratching sound echo near your feet. echo What do you do? echo. echo. echo 1.) Feel around you echo 2.) Listen for anything else set/p input = Command? if %input% == "1" goto Feel if %input% == "2" goto Listen echo. echo. :Feel echo You feel around and hear a growl. echo As you realize the scratching was echo on your leg. echo. echo You remember nothing else. pause end I am trying to make a text based game for cmd and whenever i try to enter a response is instantly closes and i can barely read out "goto was unexpected at this time"

    Read the article

  • Need help with yum,python and php in CentOS. (I made a complete mess!)

    - by pek
    a while back I wanted to install some plugins for Trac but it required python 2.5 I tried installing it (I don't remember how) and the only thing I managed was to have two versions of python (2.4 and 2.5). Trac still uses the old version but the console uses 2.5 (python -V = Python 2.5.2). Anyway, the problem is not python, the problem is yum (which uses python). I am trying to upgrade my PHP version from 5.1.x to 5.2.x. I tried following this tutorial but when I reach the step with yum I get this error: >[root@XXX]# yum update Loading "installonlyn" plugin Setting up Update Process Setting up repositories Reading repository metadata in from local files Traceback (most recent call last): File "/usr/bin/yum", line 29, in ? yummain.main(sys.argv[1:]) File "/usr/share/yum-cli/yummain.py", line 94, in main result, resultmsgs = base.doCommands() File "/usr/share/yum-cli/cli.py", line 381, in doCommands return self.yum_cli_commands[self.basecmd].doCommand(self, self.basecmd, self.extcmds) File "/usr/share/yum-cli/yumcommands.py", line 150, in doCommand return base.updatePkgs(extcmds) File "/usr/share/yum-cli/cli.py", line 672, in updatePkgs self.doRepoSetup() File "/usr/share/yum-cli/cli.py", line 109, in doRepoSetup self.doSackSetup(thisrepo=thisrepo) File "/usr/lib/python2.4/site-packages/yum/__init__.py", line 338, in doSackSetup self.repos.populateSack(which=repos) File "/usr/lib/python2.4/site-packages/yum/repos.py", line 200, in populateSack sack.populate(repo, with, callback, cacheonly) File "/usr/lib/python2.4/site-packages/yum/yumRepo.py", line 91, in populate dobj = repo.cacheHandler.getPrimary(xml, csum) File "/usr/lib/python2.4/site-packages/yum/sqlitecache.py", line 100, in getPrimary return self._getbase(location, checksum, 'primary') File "/usr/lib/python2.4/site-packages/yum/sqlitecache.py", line 86, in _getbase (db, dbchecksum) = self.getDatabase(location, metadatatype) File "/usr/lib/python2.4/site-packages/yum/sqlitecache.py", line 82, in getDatabase db = self.makeSqliteCacheFile(filename,cachetype) File "/usr/lib/python2.4/site-packages/yum/sqlitecache.py", line 245, in makeSqliteCacheFile self.createTablesPrimary(db) File "/usr/lib/python2.4/site-packages/yum/sqlitecache.py", line 165, in createTablesPrimary cur.execute(q) File "/usr/lib/python2.4/site-packages/sqlite/main.py", line 244, in execute self.rs = self.con.db.execute(SQL) _sqlite.DatabaseError: near "release": syntax error Any help? Thank you. Update OK, so I've managed to update yum hoping it would solve my problems but now I get a slightly different version of the same error: [root@XXX]# yum -y update Loaded plugins: fastestmirror Loading mirror speeds from cached hostfile * addons: mirror.skiplink.com * base: www.gtlib.gatech.edu * epel: mirrors.tummy.com * extras: yum.singlehop.com * updates: centos-distro.cavecreek.net (process:30840): GLib-CRITICAL **: g_timer_stop: assertion `timer != NULL' failed (process:30840): GLib-CRITICAL **: g_timer_destroy: assertion `timer != NULL' failed Traceback (most recent call last): File "/usr/bin/yum", line 29, in ? yummain.user_main(sys.argv[1:], exit_code=True) File "/usr/share/yum-cli/yummain.py", line 309, in user_main errcode = main(args) File "/usr/share/yum-cli/yummain.py", line 178, in main result, resultmsgs = base.doCommands() File "/usr/share/yum-cli/cli.py", line 345, in doCommands self._getTs(needTsRemove) File "/usr/lib/python2.4/site-packages/yum/depsolve.py", line 101, in _getTs self._getTsInfo(remove_only) File "/usr/lib/python2.4/site-packages/yum/depsolve.py", line 112, in _getTsInfo pkgSack = self.pkgSack File "/usr/lib/python2.4/site-packages/yum/__init__.py", line 661, in <lambda> pkgSack = property(fget=lambda self: self._getSacks(), File "/usr/lib/python2.4/site-packages/yum/__init__.py", line 501, in _getSacks self.repos.populateSack(which=repos) File "/usr/lib/python2.4/site-packages/yum/repos.py", line 260, in populateSack sack.populate(repo, mdtype, callback, cacheonly) File "/usr/lib/python2.4/site-packages/yum/yumRepo.py", line 190, in populate dobj = repo_cache_function(xml, csum) File "/usr/lib/python2.4/site-packages/sqlitecachec.py", line 42, in getPrimary self.repoid)) TypeError: Can not create packages table: near "release": syntax error I'm guessing that this "release" thing has something to do with a repository, but I didn't find anything... I went to the sqlitecachec.py at line 42 which writes (line numbers added for convenience): 39: return self.open_database(_sqlitecache.update_primary(location, 40: checksum, 41: self.callback, 42: self.repoid)) Update 2 I think I found the problem. This post suggests that the problem is sqlite and not yum. The version of sqlite I have installed is 3.6.10 but I have no idea which version does python 2.4 uses. ld.so.config contains the following: include ld.so.conf.d/*.conf /usr/local/lib In folder /usr/local/lib I find a symbolic link named libsqlite3.so that points to libsqlite3.so.0.8.6 WHAT IS HAPPENING??????? :S

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • Python regex to parse text file, get the items in list and count the list

    - by Nemo
    I have a text file which contains some data. I m particularly interested in finding the count of the number of items in v_dims v_dims pattern in my text file looks like this : v_dims={ "Sales", "Product Family", "Sales Organization", "Region", "Sales Area", "Sales office", "Sales Division", "Sales Person", "Sales Channel", "Sales Order Type", "Sales Number", "Sales Person", "Sales Quantity", "Sales Amount" } So I m thinking of getting all the elements in v_dims and dumping them out in a Python list. Then compute the len(mylist) to get the count of the items. The challenge is in getting all the elements of v_dims from my text file and putting them in an empty list. I m particularly interested in items in v_dims in my text file. The text file has data in the form of v_dims pattern i showed in my original post. Some data has nested patterns of v_dims. Thanks. Here's what I have tried and failed. Any help is appreciated. TIA. import re fname = "C:\Users\XXXX\Test.mrk" with open(fname, "r") as fo: content_as_string = fo.read() match = re.findall(r'v_dims={\"(.+?)\"}',content_as_string) Though I have a big text file, Here's a snippet of what's the structure of my text file version "1"; // Computer generated object language file object 'MRKR' "Main" { Data_Type=2, HeaderBlock={ Version_String="6.3 (25)" }, Printer_Info={ Orientation=0, Page_Width=8.50000000, Page_Height=11.00000000, Page_Header="", Page_Footer="", Margin_type=0, Top_Margin=0.50000000, Left_Margin=0.50000000, Bottom_Margin=0.50000000, Right_Margin=0.50000000 }, Marker_Options={ Close_All="TRUE", Hide_Console="FALSE", Console_Left="FALSE", Console_Width=217, Main_Style="Maximized", MDI_Rect={ 0, 0, 892, 1063 } }, Dives={ { Dive="A", Windows={ { View_Index=0, Window_Info={ Window_Rect={ 0, -288, 400, 1008 }, Window_Style="Maximized Front", Window_Name="Theater [Previous Qtr Diveplan-Dive A]" }, Dependent_bool="FALSE", Colset={ Dive_Type="Normal", Dimension_Name="Theater", Action_List={ Actions={ { Action_Type="Select", select_type=5 }, { Action_Type="Select", select_type=0, Key_Names={ "Theater" }, Key_Indexes={ { "AMERICAS" } } }, { Action_Type="Focus", Focus_Rows="True" }, { Action_Type="Dimensions", v_dims={ "Theater", "Product Family", "Division", "Region", "Install at Country Name", "Connect Home Type", "Connect In Type", "SymmConnect Enabled", "Connect Home Refusal Reason", "Sales Order Channel Type", "Maintained By Group", "PS Flag", "Avalanche Flag", "Product Item Family" }, Xtab_Bool="False", Xtab_Flip="False" }, { Action_Type="Select", select_type=5 }, { Action_Type="Select", select_type=0, Key_Names={ "Theater", "Product Family", "Division", "Region", "Install at Country Name", "Connect Home Type", "Connect In Type", "SymmConnect Enabled", "Connect Home Refusal Reason", "Sales Order Channel Type", "Maintained By Group", "PS Flag", "Avalanche Flag" }, Key_Indexes={ { "AMERICAS", "ATMOS", "Latin America CS Division", "37000 CS Region", "Mexico", "", "", "", "", "DIRECT", "EMC", "N", "0" } } } } }, Num_Palette_cols=0, Num_Palette_rows=0 }, Format={ Window_Type="Tabular", Tabular={ Num_row_labels=8 } } } } } }, Widget_Set={ Widget_Layout="Vertical", Go_Button=1, Picklist_Width=0, Sort_Subset_Dimensions="TRUE", Order={ } }, Views={ { Data_Type=1, dbname="Previous Qtr Diveplan", diveline_dbname="Current Qtr Diveplan", logical_name="Current Qtr Diveplan", cols={ { name="Total TSS installs", column_type="Calc[Total TSS installs]", output_type="Number", format_string="." }, { name="TSS Valid Connectivity Records", column_type="Calc[TSS Valid Connectivity Records]", output_type="Number", format_string="." }, { name="% TSS Connectivity Record", column_type="Calc[% TSS Connectivity Record]", output_type="Number" }, { name="TSS Not Applicable", column_type="Calc[TSS Not Applicable]", output_type="Number", format_string="." }, { name="TSS Customer Refusals", column_type="Calc[TSS Customer Refusals]", output_type="Number", format_string="." }, { name="% TSS Refusals", column_type="Calc[% TSS Refusals]", output_type="Number" }, { name="TSS Eligible for Physical Connectivity", column_type="Calc[TSS Eligible for Physical Connectivity]", output_type="Number", format_string="." }, { name="TSS Boxes with Physical Connectivty", column_type="Calc[TSS Boxes with Physical Connectivty]", output_type="Number", format_string="." }, { name="% TSS Physical Connectivity", column_type="Calc[% TSS Physical Connectivity]", output_type="Number" } }, dim_cols={ { name="Model", column_type="Dimension[Model]", output_type="None" }, { name="Model", column_type="Dimension[Model]", output_type="None" }, { name="Connect In Type", column_type="Dimension[Connect In Type]", output_type="None" }, { name="Connect Home Type", column_type="Dimension[Connect Home Type]", output_type="None" }, { name="SymmConnect Enabled", column_type="Dimension[SymmConnect Enabled]", output_type="None" }, { name="Theater", column_type="Dimension[Theater]", output_type="None" }, { name="Division", column_type="Dimension[Division]", output_type="None" }, { name="Region", column_type="Dimension[Region]", output_type="None" }, { name="Sales Order Number", column_type="Dimension[Sales Order Number]", output_type="None" }, { name="Product Item Family", column_type="Dimension[Product Item Family]", output_type="None" }, { name="Item Serial Number", column_type="Dimension[Item Serial Number]", output_type="None" }, { name="Sales Order Deal Number", column_type="Dimension[Sales Order Deal Number]", output_type="None" }, { name="Item Install Date", column_type="Dimension[Item Install Date]", output_type="None" }, { name="SYR Last Dial Home Date", column_type="Dimension[SYR Last Dial Home Date]", output_type="None" }, { name="Maintained By Group", column_type="Dimension[Maintained By Group]", output_type="None" }, { name="PS Flag", column_type="Dimension[PS Flag]", output_type="None" }, { name="Connect Home Refusal Reason", column_type="Dimension[Connect Home Refusal Reason]", output_type="None", col_width=177 }, { name="Cust Name", column_type="Dimension[Cust Name]", output_type="None" }, { name="Sales Order Channel Type", column_type="Dimension[Sales Order Channel Type]", output_type="None" }, { name="Sales Order Type", column_type="Dimension[Sales Order Type]", output_type="None" }, { name="Part Model Key", column_type="Dimension[Part Model Key]", output_type="None" }, { name="Ship Date", column_type="Dimension[Ship Date]", output_type="None" }, { name="Model Number", column_type="Dimension[Model Number]", output_type="None" }, { name="Item Description", column_type="Dimension[Item Description]", output_type="None" }, { name="Customer Classification", column_type="Dimension[Customer Classification]", output_type="None" }, { name="CS Customer Name", column_type="Dimension[CS Customer Name]", output_type="None" }, { name="Install At Customer Number", column_type="Dimension[Install At Customer Number]", output_type="None" }, { name="Install at Country Name", column_type="Dimension[Install at Country Name]", output_type="None" }, { name="TLA Serial Number", column_type="Dimension[TLA Serial Number]", output_type="None" }, { name="Product Version", column_type="Dimension[Product Version]", output_type="None" }, { name="Avalanche Flag", column_type="Dimension[Avalanche Flag]", output_type="None" }, { name="Product Family", column_type="Dimension[Product Family]", output_type="None" }, { name="Project Number", column_type="Dimension[Project Number]", output_type="None" }, { name="PROJECT_STATUS", column_type="Dimension[PROJECT_STATUS]", output_type="None" } }, Available_Columns={ "Total TSS installs", "TSS Valid Connectivity Records", "% TSS Connectivity Record", "TSS Not Applicable", "TSS Customer Refusals", "% TSS Refusals", "TSS Eligible for Physical Connectivity", "TSS Boxes with Physical Connectivty", "% TSS Physical Connectivity", "Total Installs", "All Boxes with Valid Connectivty Record", "% All Connectivity Record", "Overall Refusals", "Overall Refusals %", "All Eligible for Physical Connectivty", "Boxes with Physical Connectivity", "% All with Physical Conectivity" }, Remaining_columns={ { name="Total Installs", column_type="Calc[Total Installs]", output_type="Number", format_string="." }, { name="All Boxes with Valid Connectivty Record", column_type="Calc[All Boxes with Valid Connectivty Record]", output_type="Number", format_string="." }, { name="% All Connectivity Record", column_type="Calc[% All Connectivity Record]", output_type="Number" }, { name="Overall Refusals", column_type="Calc[Overall Refusals]", output_type="Number", format_string="." }, { name="Overall Refusals %", column_type="Calc[Overall Refusals %]", output_type="Number" }, { name="All Eligible for Physical Connectivty", column_type="Calc[All Eligible for Physical Connectivty]", output_type="Number" }, { name="Boxes with Physical Connectivity", column_type="Calc[Boxes with Physical Connectivity]", output_type="Number" }, { name="% All with Physical Conectivity", column_type="Calc[% All with Physical Conectivity]", output_type="Number" } }, calcs={ { name="Total TSS installs", definition="Total[Total TSS installs]", ts_flag="Not TS Calc" }, { name="TSS Valid Connectivity Records", definition="Total[PS Boxes w/ valid connectivity record (1=yes)]", ts_flag="Not TS Calc" }, { name="% TSS Connectivity Record", definition="Total[PS Boxes w/ valid connectivity record (1=yes)] /Total[Total TSS installs]", ts_flag="Not TS Calc" }, { name="TSS Not Applicable", definition="Total[Bozes w/ valid connectivity record (1=yes)]-Total[Boxes Eligible (1=yes)]-Total[TSS Refusals]", ts_flag="Not TS Calc" }, { name="TSS Customer Refusals", definition="Total[TSS Refusals]", ts_flag="Not TS Calc" }, { name="% TSS Refusals", definition="Total[TSS Refusals]/Total[PS Boxes w/ valid connectivity record (1=yes)]", ts_flag="Not TS Calc" }, { name="TSS Eligible for Physical Connectivity", definition="Total[TSS Eligible]-Total[Exception]", ts_flag="Not TS Calc" }, { name="TSS Boxes with Physical Connectivty", definition="Total[PS Physical Connectivity] - Total[PS Physical Connectivity, SymmConnect Enabled=\"Capable not enabled\"]", ts_flag="Not TS Calc" }, { name="% TSS Physical Connectivity", definition="Total[Boxes w/ phys conn]/Total[Boxes Eligible (1=yes)]", ts_flag="Not TS Calc" }, { name="Total Installs", definition="Total[Total Installs]", ts_flag="Not TS Calc" }, { name="All Boxes with Valid Connectivty Record", definition="Total[Bozes w/ valid connectivity record (1=yes)]", ts_flag="Not TS Calc" }, { name="% All Connectivity Record", definition="Total[Bozes w/ valid connectivity record (1=yes)]/Total[Total Installs]", ts_flag="Not TS Calc" }, { name="Overall Refusals", definition="Total[Overall Refusals]", ts_flag="Not TS Calc" }, { name="Overall Refusals %", definition="Total[Overall Refusals]/Total[Bozes w/ valid connectivity record (1=yes)]", ts_flag="Not TS Calc" }, { name="All Eligible for Physical Connectivty", definition="Total[Boxes Eligible (1=yes)]-Total[Exception]", ts_flag="Not TS Calc" }, { name="Boxes with Physical Connectivity", definition="Total[Boxes w/ phys conn]-Total[Boxes w/ phys conn,SymmConnect Enabled=\"Capable not enabled\"]", ts_flag="Not TS Calc" }, { name="% All with Physical Conectivity", definition="Total[Boxes w/ phys conn]/Total[Boxes Eligible (1=yes)]", ts_flag="Not TS Calc" } }, merge_type="consolidate", merge_dbs={ { dbname="connectivityallproducts.mdl", diveline_dbname="/DI_PSREPORTING/connectivityallproducts.mdl" } }, skip_constant_columns="FALSE", categories={ { name="Geography", dimensions={ "Theater", "Division", "Region", "Install at Country Name" } }, { name="Mappings and Flags", dimensions={ "Connect Home Type", "Connect In Type", "SymmConnect Enabled", "Connect Home Refusal Reason", "Sales Order Channel Type", "Maintained By Group", "Customer Installable", "PS Flag", "Top Level Flag", "Avalanche Flag" } }, { name="Product Information", dimensions={ "Product Family", "Product Item Family", "Product Version", "Item Description" } }, { name="Sales Order Info", dimensions={ "Sales Order Deal Number", "Sales Order Number", "Sales Order Type" } }, { name="Dates", dimensions={ "Item Install Date", "Ship Date", "SYR Last Dial Home Date" } }, { name="Details", dimensions={ "Item Serial Number", "TLA Serial Number", "Part Model Key", "Model Number" } }, { name="Customer Infor", dimensions={ "CS Customer Name", "Install At Customer Number", "Customer Classification", "Cust Name" } }, { name="Other Dimensions", dimensions={ "Model" } } }, Maintain_Category_Order="FALSE", popup_info="false" } } };

    Read the article

  • Filter items from a feed using words in a text file, with Yahoo Pipes

    - by pufferfish
    I have a pipe that filters an RSS feed and removes any item that contains "stopwords" that I've chosen. Currently I've manually created a filter for each stopword in the pipe editor, but the more logical way is to read these from a file. I've figured out how to read the stopwords out of the text file, but how do I apply the filter operator to the feed, once for every stopword? The documentation states explicitly that operators can't be applied within the loop construct, but hopefully I'm missing something here.

    Read the article

  • Yahoo Pipes: filter items in a feed based on words in a text file

    - by pufferfish
    I have a pipe that filters an RSS feed and removes any item that contains "stopwords" that I've chosen. Currently I've manually created a filter for each stopword in the pipe editor, but the more logical way is to read these from a file. I've figured out how to read the stopwords out of the text file, but how do I apply the filter operator to the feed, once for every stopword? The documentation states explicitly that operators can't be applied within the loop construct, but hopefully I'm missing something here.

    Read the article

  • reading from File in assembly

    - by Natasha
    i am trying to read a username and a password from a file in x86 assembly for the perpose of authentication obviously the file consists of two lines , the user name and the password how can i read the two lines seperately and compare them? My attempt: proc read_file mov ah,3dh lea dx,file_name int 21h mov bx, ax xor si,si repeat: mov ah, 3fh lea dx, buffer mov cx, 100 int 21h mov si, ax mov buffer[si], '$' mov ah, 09h int 21h ;print on screen cmp si, 100 je repeat jmp stop;jump to end stop: RET read_file ENDP

    Read the article

  • import csv file and save to sql database table using VB2008

    - by Cookster
    Hi all, Well I have read ALOT of posts and I can't quite find the perfect answer to my question, (or I have and havn't realised it!:-)) I have a large csv file that I want to read into my program and sve it to a SQL database table. I'm useing VB2008 and my dabase is SQL2008. Any help would be appreciated. Cheers Cookster

    Read the article

  • Reading a child process's /proc/pid/mem file from the parent

    - by Amittai Aviram
    In the program below, I am trying to cause the following to happen: Process A assigns a value to a stack variable a. Process A (parent) creates process B (child) with PID child_pid. Process B calls function func1, passing a pointer to a. Process B changes the value of variable a through the pointer. Process B opens its /proc/self/mem file, seeks to the page containing a, and prints the new value of a. Process A (at the same time) opens /proc/child_pid/mem, seeks to the right page, and prints the new value of a. The problem is that, in step 6, the parent only sees the old value of a in /proc/child_pid/mem, while the child can indeed see the new value in its /proc/self/mem. Why is this the case? Is there any way that I can get the parent to to see the child's changes to its address space through the /proc filesystem? #include <fcntl.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> #include <sys/types.h> #include <sys/stat.h> #include <sys/wait.h> #include <unistd.h> #define PAGE_SIZE 0x1000 #define LOG_PAGE_SIZE 0xc #define PAGE_ROUND_DOWN(v) ((v) & (~(PAGE_SIZE - 1))) #define PAGE_ROUND_UP(v) (((v) + PAGE_SIZE - 1) & (~(PAGE_SIZE - 1))) #define OFFSET_IN_PAGE(v) ((v) & (PAGE_SIZE - 1)) # if defined ARCH && ARCH == 32 #define BP "ebp" #define SP "esp" #else #define BP "rbp" #define SP "rsp" #endif typedef struct arg_t { int a; } arg_t; void func1(void * data) { arg_t * arg_ptr = (arg_t *)data; printf("func1: old value: %d\n", arg_ptr->a); arg_ptr->a = 53; printf("func1: address: %p\n", &arg_ptr->a); printf("func1: new value: %d\n", arg_ptr->a); } void expore_proc_mem(void (*fn)(void *), void * data) { off_t frame_pointer, stack_start; char buffer[PAGE_SIZE]; const char * path = "/proc/self/mem"; int child_pid, status; int parent_to_child[2]; int child_to_parent[2]; arg_t * arg_ptr; off_t child_offset; asm volatile ("mov %%"BP", %0" : "=m" (frame_pointer)); stack_start = PAGE_ROUND_DOWN(frame_pointer); printf("Stack_start: %lx\n", (unsigned long)stack_start); arg_ptr = (arg_t *)data; child_offset = OFFSET_IN_PAGE((off_t)&arg_ptr->a); printf("Address of arg_ptr->a: %p\n", &arg_ptr->a); pipe(parent_to_child); pipe(child_to_parent); bool msg; int child_mem_fd; char child_path[0x20]; child_pid = fork(); if (child_pid == -1) { perror("fork"); exit(EXIT_FAILURE); } if (!child_pid) { close(child_to_parent[0]); close(parent_to_child[1]); printf("CHILD (pid %d, parent pid %d).\n", getpid(), getppid()); fn(data); msg = true; write(child_to_parent[1], &msg, 1); child_mem_fd = open("/proc/self/mem", O_RDONLY); if (child_mem_fd == -1) { perror("open (child)"); exit(EXIT_FAILURE); } printf("CHILD: child_mem_fd: %d\n", child_mem_fd); if (lseek(child_mem_fd, stack_start, SEEK_SET) == (off_t)-1) { perror("lseek"); exit(EXIT_FAILURE); } if (read(child_mem_fd, buffer, sizeof(buffer)) != sizeof(buffer)) { perror("read"); exit(EXIT_FAILURE); } printf("CHILD: new value %d\n", *(int *)(buffer + child_offset)); read(parent_to_child[0], &msg, 1); exit(EXIT_SUCCESS); } else { printf("PARENT (pid %d, child pid %d)\n", getpid(), child_pid); printf("PARENT: child_offset: %lx\n", child_offset); read(child_to_parent[0], &msg, 1); printf("PARENT: message from child: %d\n", msg); snprintf(child_path, 0x20, "/proc/%d/mem", child_pid); printf("PARENT: child_path: %s\n", child_path); child_mem_fd = open(path, O_RDONLY); if (child_mem_fd == -1) { perror("open (child)"); exit(EXIT_FAILURE); } printf("PARENT: child_mem_fd: %d\n", child_mem_fd); if (lseek(child_mem_fd, stack_start, SEEK_SET) == (off_t)-1) { perror("lseek"); exit(EXIT_FAILURE); } if (read(child_mem_fd, buffer, sizeof(buffer)) != sizeof(buffer)) { perror("read"); exit(EXIT_FAILURE); } printf("PARENT: new value %d\n", *(int *)(buffer + child_offset)); close(child_mem_fd); printf("ENDING CHILD PROCESS.\n"); write(parent_to_child[1], &msg, 1); if (waitpid(child_pid, &status, 0) == -1) { perror("waitpid"); exit(EXIT_FAILURE); } } } int main(void) { arg_t arg; arg.a = 42; printf("In main: address of arg.a: %p\n", &arg.a); explore_proc_mem(&func1, &arg.a); return EXIT_SUCCESS; } This program produces the output below. Notice that the value of a (boldfaced) differs between parent's and child's reading of the /proc/child_pid/mem file. In main: address of arg.a: 0x7ffffe1964f0 Stack_start: 7ffffe196000 Address of arg_ptr-a: 0x7ffffe1964f0 PARENT (pid 20376, child pid 20377) PARENT: child_offset: 4f0 CHILD (pid 20377, parent pid 20376). func1: old value: 42 func1: address: 0x7ffffe1964f0 func1: new value: 53 PARENT: message from child: 1 CHILD: child_mem_fd: 4 PARENT: child_path: /proc/20377/mem CHILD: new value 53 PARENT: child_mem_fd: 7 PARENT: new value 42 ENDING CHILD PROCESS.

    Read the article

  • SSL confirmation dialog popup auto closes in IE8 when re-accessing a JNLP file

    - by haylem
    I'm having this very annoying problem to troubleshoot and have been going at it for way too many days now, so have a go at it. The Environment We have 2 app-servers, which can be located on either the same machine or 2 different machines, and use the same signing certificate, and host 2 different web-apps. Though let's say, for the sake of our study case here, that they are on the same physical machine. So, we have: https://company.com/webapp1/ https://company.com/webapp2/ webapp1 is GWT-based rich-client which contains on one of its screens a menu with an item that is used to invoke a Java WebStart Client located on webapp2. It does so by performing a simple window.open call via this GWT call: Window.open("https://company.com/webapp2/app.jnlp", "_blank", null); Expected Behavior User merrilly goes to webapp1 User navigates to menu entry to start the WebStart app and clicks on it browser fires off a separate window/dialog which, depending on the browser and its security settings, will: request confirmation to navigate to this secure site, directly download the file, and possibly auto-execute a javaws process if there's a file association, otherwise the user can simply click on the file and start the app (or go about doing whatever it takes here). If you close the app, close the dialog, and re-click the menu entry, the same thing should happen again. Actual Behavior On Anything but God-forsaken IE 8 (Though I admit there's also all the god-forsaken pre-IE8 stuff, but the Requirements Lords being merciful we have already recently managed to make them drop these suckers. That was close. Let's hold hands and say a prayer of gratitude.) Stuff just works. JNLP gets downloaded, app executes just fine, you can close the app and re-do all the steps and it will restart happily. People rejoice. Puppies are safe and play on green hills in the sunshine. Developers can go grab a coffee and move on to more meaningful and rewarding tasks, like checking out on SO questions. Chrome doesn't want to execute the JNLP, but who cares? Customers won't get RSI from clicking a file every other week. On God-forsaken IE8 On the first visit, the dialog opens and requests confirmation for the user to continue to webapp2, though it could be unsafe (here be dragons, I tell you). The JNLP downloads and auto-opens, the app start. Your breathing is steady and slow. You close the app, close that SSL confirmation dialog, and re-click the menu entry. The dialog opens and auto-closes. Nothing starts, the file wasn't downloaded to any known location and Fiddler just reports the connection was closed. If you close IE and reach that menu item to click it again, it is now back to working correctly. Until you try again during the same session, of course. Your heart-rate goes up, you get some more coffee to make matters worse, and start looking for plain tickets online and a cheap but heavy golf-club on an online auction site to go clubbing baby polar seals to avenge your bloodthirst, as the gates to the IE team in Redmond are probably more secured than an ice block, as one would assume they get death threats often. Plus, the IE9 and IE10 teams are already hard at work fxing the crap left by their predecessors, so maybe you don't want to be too hard on them, and you don't have money to waste on a PI to track down the former devs responsible for this mess. Added Details I have come across many problems with IE8 not downloading files over SSL when it uses a no-cache header. This was indeed one of our problems, which seems to be worked out now. It downloads files fine, webapp2 uses the following headers to serve the JNLP file: response.setHeader("Cache-Control", "private, must-revalidate"); // IE8 happy response.setHeader("Pragma", "private"); // IE8 happy response.setHeader("Expires", "0"); // IE8 happy response.setHeader("Access-Control-Allow-Origin", "*"); // allow to request via cross-origin AJAX response.setContentType("application/x-java-jnlp-file"); // please exec me As you might have inferred, we get some confirmation dialog because there's something odd with the SSL certificate. Unfortunately I have no control over that. Assuming that's only temporary and for development purposes as we usually don't get our hands on the production certs. So the SSL cert is expired and doesn't specify the server. And the confirmation dialog. Wouldn't be that bad if it weren't for IE, as other browsers don't care, just ask for confirmation, and execute as expected and consistantly. Please, pretty please, help me, or I might consider sacrificial killings as an option. And I think I just found a decently prized stainless steel golf-club, so I'm right on the edge of gore. Side Notes Might actually be related to IE8 window.open SSL Certificate issue. Though it doesn't explain why the dialog would auto-close (that really is beyong me...), it could help to not have the confirmation dialog and not need the dialog at all. For instance, I was thinking that just having a simple URL in that menu instead of have it entirely managed by GWT code to invoke a Window.open would solve the problem. But I don't have control on that menu, and also I'm very curious how this could be fixed otherwise and why the hell it happens in the first place...

    Read the article

  • Reading numeric Date value from CSV file to data.frame in "R"

    - by Dick Eshelman
    D <- read.csv("sample1.csv", header = FALSE, sep = ",") D V1 V2 V3 V4 1 20100316 109825 352120 239065 2 20100317 108625 352020 239000 3 20100318 109125 352324 241065 D[,1] [1] 20100316 20100317 20100318 In the above example how do I get the data in D[,1] to be read, and stored as date values: 2010-03-16, 2010-03-17, 2010-03-18 ? I have lots of data files in this format. TIA,

    Read the article

  • Create Downloadable CSV File from PHP Script

    - by Aphex22
    How would I create a formatted version of the following PHP script as a downloadable CSV file from the code below (1.0) At the moment the fputcsv function is currently dumping the unparsed PHP/HTML code into a CSV file. This is incorrect. The downloaded CSV file should contain the columns and rows generated from the code at (1.0) as shown in the image link below. I've tried using the following code at the top of the PHP file: // output headers so that the file is downloaded rather than displayed header('Content-Type: text/csv; charset=utf-8'); header('Content-Disposition: attachment; filename=amazon.csv'); // create a file pointer connected to the output stream $output = fopen('php://output', 'w'); $mysql_hostname = ""; $mysql_user = ""; $mysql_password = ""; $mysql_database = ""; $bd = mysql_connect($mysql_hostname, $mysql_user, $mysql_password) or die("Could not connect database"); mysql_select_db($mysql_database, $bd) or die("Could not select database"); $sql = "select * from product WHERE on_amazon = 'on' AND active = 'on'"; $result = mysql_query($sql) or die ( mysql_error() ); // loop over the rows, outputting them while ($sql_result = mysql_fetch_assoc($sql)) fputcsv($output, $sql_result); 1.0 The start of the code outputs the column headings for the CSV file: // set headers echo " item_sku, external_product_id, external_product_id_type, item_name, brand_name, manufacturer, product_description, feed_product_type, update_delete, part_number, model, standard_price, list_price, currency, quantity, product_tax_code, product_site_launch_date, merchant_release_date, restock_date ... <br>"; And then follows PHP script for the column values // load all stock while ($line = mysql_fetch_assoc($result) ) { ?> <?php $size_suffix = array ("",'_chain','_con_b','_con_c'); $arrayLength = count ($size_suffix); for($y=0;$y<$arrayLength;$y++) { //Possible size array to loop through when checking quantity $con_size = array (36,365,37,375,38,385,39,395,40,405,41,415,42,425,43,435,44,445,45,455,46,465,47,475,48,485); $arrlength=count($con_size); for($x=0;$x<$arrlength;$x++) { // check if size is available if($line['quantity_c_size_'.$con_size[$x].$size_suffix[$y]] > 0 ) { ?> <!-- item sku --> <?=$line['product_id']?>, <!-- external product id --> <?=$line['code_size_'.$con_size[$x].'']?>, <? // external product id type $barcode = $line['code_size_'.$con_size[$x]]; $trim_barcode = trim($barcode); $count = strlen($trim_barcode); if ($count == 12) { echo "UPC"; } if ($count == 13) { echo "EAN"; } elseif ($count < 12) { echo " "; } ?>, <!-- item name --> <?=$line['title']?>, <? // brand_name $brand = $line['jys_brand']; echo ucfirst($brand); ?>, <? // manufacturer $brand = $line['jys_brand']; echo ucfirst($brand); ?>, <!-- product description --> <?=preg_replace('/[^\da-z]/i', ' ', $line['amazon_desc']) ?>, <!-- feed product type --> Shoes, , , , <!-- standard price --> <?=$line['price']?>, , <!-- currency --> GBP, <!-- quantity --> <?=$line['quantity_size_'.$con_size[$x].$size_suffix[$y]]?>, , <!-- product site launch date --> <?=$line['added_y']?>-<?=$line['added_m']?>-<?=$line['added_d']?>, <!-- merchat release date --> <?=$line['added_y']?>-<?=$line['added_m']?>-<?=$line['added_d']?>, , , , , <!-- item package quantity --> 1, , , , , <!-- fulfillment latency --> 2, <!-- max aggregate ship quantity --> 1, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , <!-- main image url, url1, url2, url3 --> http://www.getashoe.co.uk/full/<?=$line['product_id']?>_1.jpg, http://www.getashoe.co.uk/full/<?=$line['product_id']?>_2.jpg, http://www.getashoe.co.uk/full/<?=$line['product_id']?>_3.jpg, http://www.getashoe.co.uk/full/<?=$line['product_id']?>_4.jpg, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , <!-- heel height --> <?=$line['heel']?>, , , , , , , , , , , <!-- colour name --> <?=$line['colour']?>, <!-- colour map --> <? $colour = preg_replace('/[()]/i', ' ', $line['colour']); if (preg_match( '/[\/].*/i', $colour)) { echo 'Multicolour'; } if (preg_match( '/off.*/i', $colour)) { echo 'Off-White'; } elseif( preg_match( '/white.*/i', $colour)) { echo 'White'; } elseif( preg_match( '/moro.*/i', $colour)) { echo 'Brown'; } elseif( preg_match( '/morado.*/i', $colour)) { echo 'Purple'; } elseif( preg_match( '/cream.*/i', $colour)) { echo 'Off-White'; } elseif( preg_match( '/pewter.*/i', $colour)) { echo 'Silver'; } elseif( preg_match( '/yellow.*/i', $colour)) { echo 'Yellow'; } elseif( preg_match( '/camel.*/i', $colour)) { echo 'Beige'; } elseif( preg_match( '/navy.*/i', $colour)) { echo 'Blue'; } elseif( preg_match( '/tan.*/i', $colour)) { echo 'Brown'; } elseif( preg_match( '/rainbow.*/i', $colour)) { echo 'Multicolour'; } elseif( preg_match( '/orange.*/i', $colour)) { echo 'Orange'; } elseif( preg_match( '/leopard.*/i', $colour)) { echo 'Multicolour'; } elseif( preg_match( '/red.*/i', $colour)) { echo 'Red'; } elseif( preg_match( '/pink.*/i', $colour)) { echo 'Pink'; } elseif( preg_match( '/purple.*/i', $colour)) { echo 'Purple'; } elseif( preg_match( '/blue.*/i', $colour)) { echo 'Blue'; } elseif( preg_match( '/green.*/i', $colour)) { echo 'Green'; } elseif( preg_match( '/brown.*/i', $colour)) { echo 'Brown'; } elseif( preg_match( '/grey.*/i', $colour)) { echo 'Grey'; } elseif( preg_match( '/black.*/i', $colour)) { echo 'Black'; } elseif( preg_match( '/gold.*/i', $colour)) { echo 'Gold'; } elseif( preg_match( '/silver.*/i', $colour)) { echo 'Silver'; } elseif( preg_match( '/multi.*/i', $colour)) { echo 'Multicolour'; } elseif( preg_match( '/beige.*/i', $colour)) { echo 'Beige'; } elseif( preg_match( '/nude.*/i', $colour)) { echo 'Beige'; } ?>, <!-- size name --> <? echo $con_size[$x];?>, <!-- size map --> <? if ($con_size[$x] == 36) { echo "3 UK"; } elseif ($con_size[$x] == 37 ) { echo "4 UK"; } elseif ($con_size[$x] == 38) { echo "5 UK"; } elseif ($con_size[$x] == 39 ) { echo "6 UK"; } elseif ($con_size[$x] == 40 ) { echo "7 UK"; } elseif ($con_size[$x] == 41) { echo "8 UK"; } elseif ($con_size[$x] == 42) { echo "9 UK"; } elseif ($con_size[$x] == 43) { echo "10 UK"; } elseif ($con_size[$x] == 44 ) { echo "11 UK"; } elseif ($con_size[$x] == 45 ) { echo "12 UK"; } elseif ($con_size[$x] == 46 ) { echo "13 UK"; } elseif ($con_size[$x] == 47 ) { echo "14 UK"; } elseif ($con_size[$x] == 48 ) { echo "15 UK"; } elseif ($con_size[$x] == 365) { echo "3.5 UK"; } elseif ($con_size[$x] == 375 ) { echo "4.5 UK"; } elseif ($con_size[$x] == 385) { echo "5.5 UK"; } elseif ($con_size[$x] == 395 ) { echo "6.5 UK"; } elseif ($con_size[$x] == 405 ) { echo "7.5 UK"; } elseif ($con_size[$x] == 415) { echo "8.5 UK"; } elseif ($con_size[$x] == 425) { echo "9.5 UK"; } elseif ($con_size[$x] == 435) { echo "10.5 UK"; } elseif ($con_size[$x] == 445 ) { echo "11.5 UK"; } elseif ($con_size[$x] == 455 ) { echo "12.5 UK"; } elseif ($con_size[$x] == 465 ) { echo "13.5 UK"; } elseif ($con_size[$x] == 475 ) { echo "14.5 UK"; } elseif ($con_size[$x] == 485 ) { echo "15.5 UK"; } ?>, <br> <? // finish checking if size is available } } } ?> I've included an image of how the CSV file should appear. https://i.imgur.com/ZU3IFer.png Any help would be great.

    Read the article

  • Reading Excel Named Ranges by OLEDB hangs when the source file is open

    - by Sathish
    I am trying to read the Excel Named range using OLEDB using the below code "Select * from [MyNamedRange1]" everything works fine only when the source excel sheet is not opened if it is open then i am not able to read the range names using OLEDB it simply hangs Where as i am able to execute the query "Select * from [Sheet1$]" even if the workbook is open or closed... Any work arounds for reading the range by OLEDB only i dont want to go for interop... I have too many ranges defined in the excel file

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how can i get the file permission of a directory with java

    - by user571652
    i try to check the permission granted to a directory in linux, i mean i have a directory with permission 755 berty@berty-laptop:~$ ls -l / |grep directory drwxr-xr-x 3 root root 4096 2011-01-10 12:33 directory how can i read that permission with java? I've tried using FilePermission but though i have a directory with all the permissions (777) the FilePermission class always returns an exception java.security.AccessControlException: Access denied (java.io.FilePermission /home/directory read) at java.security.AccessController.checkPermission(AccessController.java:103) at com.snippets.Check4DirectoryPermission.checker(Check4DirectoryPermission.java:50) at com.snippets.Check4DirectoryPermission.main(Check4DirectoryPermission.java:70) is there another way to do this?

    Read the article

  • reading a text file in java

    - by aks
    I want to read a text file containing a space sepearted vlaues.Values are integers. How can i read it and put it in a array list?? eg of contents of texx file 1 62 4 55 5 6 77 now i want a arraylist as [1, 62,4,55,5,6,77]. How do i do it in java?

    Read the article

< Previous Page | 326 327 328 329 330 331 332 333 334 335 336 337  | Next Page >