Search Results

Search found 78653 results on 3147 pages for 'performance object name s'.

Page 332/3147 | < Previous Page | 328 329 330 331 332 333 334 335 336 337 338 339  | Next Page >

  • How to get to the key name of a referenced entity property from an entity instance without a datastore read in google app engine?

    - by Sumeet Pareek
    Consider I have the following models - class Team(db.Model): # say I have just 5 teams name = db.StringProperty() class Player(db.Model): # say I have thousands of players name = db.StringProperty() team = db.ReferenceProperty(Team, collection_name="player_set") Key name for each Team entity = 'team_' , and for each Player entity = 'player_' By some prior arrangement I have a Team entity's (key_name, name) mapping available to me. For example (team_01, United States Of America), (team_02, Russia) etc I have to show all the players and their teams on a page. One way of doing this would be - players = Player.all().fetch(1000) # This is 1 DB read for player in players: # This will iterate 1000 times self.response.out.write(player.name) # This is obviously not a DB read self.response.out.write(player.team.name) #This is a total of 1x1000 = 1000 DB reads That is a 1001 DB reads for a silly thing. The interesting part is that when I do a db.to_dict() on players, it shows that for every player in that list there is 'name' of the player and there is the 'key_name' of the team available too. So how can I do the below ?? players = Player.all().fetch(1000) # This is 1 DB read for player in players: # This will iterate 1000 times self.response.out.write(player.name) # This is obviously not a DB read self.response.out.write(team_list[player.<SOME WAY OF GETTING TEAM KEY NAME>]) # Here 'team_list' already has (key_name, name) for all 5 teams I have been struggling with this for a long time. Have read every available documentation. I could just hug the person that can help me here :-) Disclaimer: The above problem description is not a real scenario. It is a simplified arrangement that represents my problem exactly. I have run into it in a rater complex and big GAE appication.

    Read the article

  • Generated queries contain schema and catalog name

    - by stacker
    I've the same problem as described here In the generated SQL Informix expects catalog:schema.table but what's actually generated is catalog.schema.table which leads to a syntax error. Setting: hibernate.default_catalog= hibernate.default_schema= had no effect. I even removed schema and catalog from the table annotation, this caused a different issues : the query looked like that ..table same for setting catalog and schema to an empty string. Versions seam 2.1.2 Hibernate Annotations 3.3.1.GA.CP01 Hibernate 3.2.4.sp1.cp08 Hibernate EntityManager 3.3.2.GAhibernate Jboss 4.3 (similar to 4.2.3)

    Read the article

  • How do polymorphic inline caches work with mutable types?

    - by kingkilr
    A polymorphic inline cache works by caching the actual method by the type of the object, in order to avoid the expensive lookup procedures (usually a hashtable lookup). How does one handle the type comparison if the type objects are mutable (i.e. the method might be monkey patched into something different at run time). The one idea I've come up with would be a "class counter" that gets incremented each time a method is adjusted, however this seems like it would be exceptionally expensive in a heavily monkey patched environ since it would kill all the PICs for that class, even if the methods for them weren't altered. I'm sure there must be a good solution to this, as this issue is directly applicable to Javascript and AFAIK all 3 of the big JS VMs have PICs (wow acronym ahoy).

    Read the article

  • Help naming a class that has a single public method called Execute()

    - by devoured elysium
    I have designed the following class that should work kind of like a method (usually the user will just run Execute()): public abstract class ??? { protected bool hasFailed = false; protected bool hasRun = false; public bool HasFailed { get { return hasFailed; } } public bool HasRun { get { return hasRun; } } private void Restart() { hasFailed = false; hasRun = false; } public bool Execute() { ExecuteImplementation(); bool returnValue = hasFailed; Restart(); return returnValue; } protected abstract void ExecuteImplementation(); } My question is: how should I name this class? Runnable? Method(sounds awkward)?

    Read the article

  • t-sql pivot filter based on input column name

    - by stackoverflowuser
    Based on following AreaState table Area State ------------------- A1 Active A1 Active A1 Active A1 Proposed A1 Proposed A2 Active A2 Proposed I want to write a stored proc that returns count of state for each of the areas. Input to the stored proc is any valid State (in this case @state is the input parameter). I was hoping that below would work but it does not. declare @state varchar(10) set @state = 'Active' select Area, QUOTENAME(@state) from ( select Area, State from AreaState ) as src pivot ( count(State) for State in (QUOTENAME(@state)) ) as pvt Pls. suggest.

    Read the article

  • real time stock quotes, StreamReader performance optimization

    - by sean717
    I am working on a program that extracts real time quote for 900+ stocks from a website. I use HttpWebRequest to send HTTP request to the site and store the response to a stream and open a stream using the following code: HttpWebResponse response = (HttpWebResponse)request.GetResponse(); Stream stream = response.GetResponseStream (); StreamReader reader = new StreamReader( stream ) the size of the received HTML is large (5000+ lines), so it takes a long time to parse it and extract the price. For 900 files, It takes about 6 mins for parsing and extracting. Which my boss isn't happy with, he told me he'd want the whole process to be done in TWO mins. I've identified the part of the program that takes most of time to finish is parsing and extracting. I've tried to optimize the code to make it faster, the following is what I have now after some optimization: // skip lines at the top for(int i=0;i<1500;++i) reader.ReadLine(); // read the line that contains the price string theLine = reader.ReadLine(); // ... extract the price from the line now it takes about 4 mins to process all the files, there is still a significant gap to what my boss's expecting. So I am wondering, is there other way that I can further speed up the parsing and extracting and have everything done within 2 mins?

    Read the article

  • Can this loop be sped up in pure Python?

    - by Noctis Skytower
    I was trying out an experiment with Python, trying to find out how many times it could add one to an integer in one minute's time. Assuming two computers are the same except for the speed of the CPUs, this should give an estimate of how fast some CPU operations may take for the computer in question. The code below is an example of a test designed to fulfill the requirements given above. This version is about 20% faster than the first attempt and 150% faster than the third attempt. Can anyone make any suggestions as to how to get the most additions in a minute's time span? Higher numbers are desireable. EDIT: This experiment is being written in Python 3.1 and is 15% faster than the fourth speed-up attempt. def start(seconds): import time, _thread def stop(seconds, signal): time.sleep(seconds) signal.pop() total, signal = 0, [None] _thread.start_new_thread(stop, (seconds, signal)) while signal: total += 1 return total if __name__ == '__main__': print('Testing the CPU speed ...') print('Relative speed:', start(60))

    Read the article

  • Multiple constructors definitions with same name but different signatures (C++)

    - by PuRe_ChAoS12
    With the following code, I keep getting error C2535 when I compile. It's complaining that a member function already defined or declared. Rationnel.h ... class Rationnel { public: Rationnel(int); //Constructor Rationnel(int,int); //Constructor void add(const Rationnel); ... Rationnel.cpp ... //Constructor Rationnel::Rationnel(int n = 1) { numerateur = n; denominateur = 1; } //Constructor Rationnel::Rationnel(int n = 1, int d = 1) { numerateur = n; denominateur = d; } ... Any idea what could be causing the error? Thanks for your time.

    Read the article

  • JavaScript tags, performance and W3C

    - by Thomas
    Today I was looking for website optimization content and I found an article talking about move JavaScript scripts to the bottom of the HTML page. Is this valid with W3C's recommendations? I learned that all JavaScript must be inside of head tag... Thank you.

    Read the article

  • Duplicate an AppEngine Query object to create variations of a filter without affecting the base quer

    - by Steve Mayne
    In my AppEngine project I have a need to use a certain filter as a base then apply various different extra filters to the end, retrieving the different result sets separately. e.g.: base_query = MyModel.all().filter('mainfilter', 123) Then I need to use the results of various sub queries separately: subquery1 = basequery.filter('subfilter1', 'xyz') #Do something with subquery1 results here subquery2 = basequery.filter('subfilter2', 'abc') #Do something with subquery2 results here Unfortunately 'filter()' affects the state of the basequery Query instance, rather than just returning a modified version. Is there any way to duplicate the Query object and use it as a base? Is there perhaps a standard Python way of duping an object that could be used? The extra filters are actually applied by the results of different forms dynamically within a wizard, and they use the 'running total' of the query in their branch to assess whether to ask further questions. Obviously I could pass around a rudimentary stack of filter criteria, but I'd rather use the Query itself if possible, as it adds simplicity and elegance to the solution.

    Read the article

  • how to avoid sub-query to gain performance

    - by chun
    hi i have a reporting query which have 2 long sub-query SELECT r1.code_centre, r1.libelle_centre, r1.id_equipe, r1.equipe, r1.id_file_attente, r1.libelle_file_attente,r1.id_date, r1.tranche, r1.id_granularite_de_periode,r1.granularite, r1.ContactsTraites, r1.ContactsenParcage, r1.ContactsenComm, r1.DureeTraitementContacts, r1.DureeComm, r1.DureeParcage, r2.AgentsConnectes, r2.DureeConnexion, r2.DureeTraitementAgents, r2.DureePostTraitement FROM ( SELECT cc.id_centre_contact, cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_file_attente, f.libelle_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode, g.granularite, sum(Nb_Contacts_Traites) as ContactsTraites, sum(Nb_Contacts_en_Parcage) as ContactsenParcage, sum(Nb_Contacts_en_Communication) as ContactsenComm, sum(Duree_Traitement/1000) as DureeTraitementContacts, sum(Duree_Communication / 1000 + Duree_Conference / 1000 + Duree_Com_Interagent / 1000) as DureeComm, sum(Duree_Parcage/1000) as DureeParcage FROM agr_synthese_activite_media_fa_agent a, centre_contact cc, direction_contact dc, granularite_de_periode g, media m, file_attente f WHERE m.id_media = a.id_media AND cc.id_centre_contact = a.id_centre_contact AND a.id_direction_contact = dc.id_direction_contact AND dc.direction_contact ='INCOMING' AND a.id_file_attente = f.id_file_attente AND m.media = 'PHONE' AND ( ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') or ( g.granularite = 'Heure' and a.id_th_heure = g.id_granularite_de_periode) ) GROUP by cc.id_centre_contact, a.id_equipe, a.id_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode) r1, ( (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact, a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode ) UNION (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.granularite = 'Heure' AND a.id_th_heure = g.id_granularite_de_periode) AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact,a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode) ) r2 WHERE r1.id_centre_contact = r2.id_centre_contact AND r1.id_equipe = r2.id_equipe AND r1.id_date = r2.id_date AND r1.tranche = r2.tranche AND r1.id_granularite_de_periode = r2.id_granularite_de_periode GROUP BY r1.id_centre_contact , r1.id_equipe, r1.id_file_attente, r1.id_date, r1.tranche, r1.id_granularite_de_periode ORDER BY r1.code_centre, r1.libelle_centre, r1.equipe, r1.libelle_file_attente, r1.id_date, r1.id_granularite_de_periode,r1.tranche the EXPLAIN shows | id | select_type | table | type| possible_keys | key | key_len | ref| rows | Extra | '1', 'PRIMARY', '<derived3>', 'ALL', NULL, NULL, NULL, NULL, '2520', 'Using temporary; Using filesort' '1', 'PRIMARY', '<derived2>', 'ALL', NULL, NULL, NULL, NULL, '4378', 'Using where; Using join buffer' '3', 'DERIVED', 'a', 'ALL', 'fk_Activite_Agent_centre_contact', NULL, NULL, NULL, '83433', 'Using temporary; Using filesort' '3', 'DERIVED', 'g', 'ref', 'Index_granularite,Index_Valeur_min', 'Index_Valeur_min', '23', 'func', '1', 'Using where' '3', 'DERIVED', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' '4', 'UNION', 'g', 'ref', 'PRIMARY,Index_granularite', 'Index_granularite', '23', '', '24', 'Using where; Using temporary; Using filesort' '4', 'UNION', 'a', 'ref', 'fk_Activite_Agent_centre_contact,fk_activite_agent_TH_heure', 'fk_activite_agent_TH_heure', '5', 'reporting_acd.g.Id_Granularite_de_periode', '2979', 'Using where' '4', 'UNION', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' NULL, 'UNION RESULT', '<union3,4>', 'ALL', NULL, NULL, NULL, NULL, NULL, '' '2', 'DERIVED', 'g', 'range', 'PRIMARY,Index_granularite,Index_Valeur_min', 'Index_granularite', '23', NULL, '389', 'Using where; Using temporary; Using filesort' '2', 'DERIVED', 'a', 'ALL', 'fk_agr_synthese_activite_media_fa_agent_centre_contact,fk_agr_synthese_activite_media_fa_agent_direction_contact,fk_agr_synthese_activite_media_fa_agent_file_attente,fk_agr_synthese_activite_media_fa_agent_media,fk_agr_synthese_activite_media_fa_agent_th_heure', NULL, NULL, NULL, '20903', 'Using where; Using join buffer' '2', 'DERIVED', 'cc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Centre_Contact', '1', '' '2', 'DERIVED', 'f', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_File_Attente', '1', '' '2', 'DERIVED', 'dc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Direction_Contact', '1', 'Using where' '2', 'DERIVED', 'm', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Media', '1', 'Using where' don't know it very clear, but i think is the problem of seems it take full scaning than i change all the sub-query to views(create view as select sub-query), and the result is the same thanks for any advice

    Read the article

  • Business Object desgin

    - by Dan
    I have a question about how I setup my BO's. I setup the BO's to contain all of my properties of the object as well as the business logic to satisfy the business rules. I decided to make all of the methods static, but I'm not sure if that was the right decision. Someone told me to split my BO's into an Entity Object of just properties and then a BO of just methods that do business rules, and don't make the methods static. Does anyone have some experience with the way i've set this up? Any examples of how it might work better for future growth? Thanks!

    Read the article

  • Getters and Setters: Code smell, Necessary Evil, or Can't Live Without Them [closed]

    - by Avery Payne
    Possible Duplicate: Allen Holub wrote “You should never use get/set functions”, is he correct? Is there a good, no, a very good reason, to go through all the trouble of using getters and setters for object-oriented languages? What's wrong with just using a direct reference to a property or method? Is there some kind of "semantical coverup" that people don't want to talk about in polite company? Was I just too tired and fell asleep when someone walked out and said "Thou Shalt Write Copious Amounts of Code to Obtain Getters and Setters"? Follow-up after a year: It seems to be a common occurrence with Java, less so with Python. I'm beginning to wonder if this is more of a cultural phenomena (related to the limitations of the language) rather than "sage advice". The -1 question score is complete for-the-lulz as far as I am concerned. It's interesting that there are specific questions that are downvoted, not because they are "bad questions", but rather, because they hit someone's raw nerve.

    Read the article

  • jQuery Ajax Methods Not Returning XHR Object

    - by Nate
    UPDATE: I haven't figured out what's going on, but this definitely seems to be a problem with my project. After creating a simple test page, I was able to verify that getJSON does in fact return an XHR object like it's supposed to. Per the stackoverflow question/answer here: Kill ajax requests using javascript using jquery. and a number of other question/answers on this site and others, the jQuery Ajax methods should return the XHR object. However, when I run the following code, request is "undefined". var request = $.getJSON(url, function(data) { console.log(data); }); console.log(request); Did I miss a change in jQuery? I'm using 1.4.4.

    Read the article

  • Mysql regexp performance question

    - by Tim
    Rumour has it that this; SELECT * FROM lineage_string where lineage like '%179%' and lineage regexp '(^|/)179(/|$)' Would be faster than this; SELECT * FROM lineage_string where lineage regexp '(^|/)179(/|$)' Can anyone confirm ? Or know a decent way to test the speed of such queries. Thanks

    Read the article

  • list or container O(1)-ish insertion/deletion performance, with array semantics

    - by Chris Kaminski
    I'm looking for a collection that offers list semantics, but also allows array semantics. Say I have a list with the following items: apple orange carrot pear then my container array would: container[0] == apple container[1] == orangle container[2] == carrot Then say I delete the orange element: container[0] == apple container[1] == carrot I don't particularly care if sort order is maintained, I'd just like the array values to function as accelerators to the list items, and I want to collapse gaps in the array without having to do an explicit resizing.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Can running object be garbage collected?

    - by Kugel
    I have a simple class: public class Runner { public void RunAndForget(RunDelegate method) { ThreadPool.QueueUserWorkItem(new WaitCallback(Run), method); } private void Run(object o) { ((RunDelegate )o).Invoke(); } } And if I use this like so: private void RunSomethingASync() { Runner runner = new Runner(); runner.FireAndForget(new RunDelegate(Something)); } Is there any danger using it like this? My C++ guts tell me that runner object should be destroyed after RunSomethingASync is finished. Am I right? What happens then to the method running on different thread? Or perhaps it is other way around and runner will not be collected? That would be a problem considering I may call RunSomethingASync() many times.

    Read the article

  • how to return the current object?

    - by ajsie
    in code igniter you can type: $query = $this->db->query("YOUR QUERY"); foreach ($query->result() as $row) { echo $row->title; echo $row->name; echo $row->body; } i guess that the query method returns the object it's part of. am i correct? if i am, how do you type the line where it returns the object? so what i wonder is how it looks like inside the query method for the above code to be functional. public function query($sql) { // some db logic here with the $sql and saves the values to the properties (title, name and body) return X } with other words, what should X be?

    Read the article

  • JQuery use variable by name of divID

    - by Russell Parrott
    Just a quick question, that I cannot fathom out, hope you guys and girls can help. I have a div (with ID) that when clicked opens a new div - great works well, what I really want is to "populate" the new div with predefined text based on the clicked div's ID. example: <div class="infobox" id="help_msg1">Click me</div> I may have say 3 (actually more but...) of these div's This opens: <div id="helpbox">text in here</div> In/on my .js page I have doc ready etc then: var help_msg1 ='text that is a help message'; var help_msg2 ='text that is another help message'; var help_msg3 ='text that is yet another help message'; Then $('.infobox').live('click',function() { $('#helpbox').remove(); $('label').css({'font-weight': '400'}); $(this).next('label').css({'font-weight': '900'}); var offset = $(this).next().next().offset(); var offsetby = $(this).next().next().width(); var leftitby = offset.left+offsetby+10; $('body').append('text in here'); $('#helpbox').css( { 'left': leftitby, 'top': offset.top } ); }); Note I remove each #helpbox before appending the new one and the .next().next() identifies the appropriate text input that lot all works. What I need is how do I put var help_msg1 into the append when id="help_msg1" is clicked or var help_msg2 when id="help_msg2" is clicked etc. I have tried

    Read the article

  • GlassFish JDO and global object

    - by bach
    Hi, I'm thinking about the GlassFish platform for my new app. My app env. doesn't have a big volume of data to handle, but a lot of users writing/reading the same data A very volotile portion of the data updates every 200milsec by diff users. Therefore I'd like that type of data to be in memory only and accessible to the whole app My questions: How do I use a global object in memory with GF? a. use a static variable object - for that I guess I need to make sure GF is running on only 1 JVM -- how to I configure GF to run on 1 jvm? b. use HttpContext - same as a. How do I persist to the DB? a. can I use JDO interface? How do I Schedule tasks to be performed in the future (something like the task queue in GAE) thanks, J.S. Bach

    Read the article

< Previous Page | 328 329 330 331 332 333 334 335 336 337 338 339  | Next Page >