Search Results

Search found 8800 results on 352 pages for 'import'.

Page 333/352 | < Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >

  • Python File Search Line And Return Specific Number of Lines after Match

    - by Simos Anderson
    I have a text file that has lines representing some data sets. The file itself is fairly long but it contains certain sections of the following format: Series_Name INFO Number of teams : n1 | Team | # | wins | | TeamName1 | x | y | . . . | TeamNamen1 | numn | numn | Some Irrelevant lines Series_Name2 INFO Number of teams : n1 | Team | # | wins | | TeamName1 | num1 | num2 | . where each section has a header that begins with the Series_Name. Each Series_Name is different. The line with the header also includes the number of teams in that series, n1. Following the header line is a set of lines that represents a table of data. For each series there are n1+1 rows in the table, where each row shows an individual team name and associated stats. I have been trying to implement a function that will allow the user to search for a Team name and then print out the line in the table associated with that team. However, certain team names show up under multiple series. To resolve this, I am currently trying to write my code so that the user can search for the header line with series name first and then print out just the following n1+1 lines that represent the data associated with the series. Here's what I have come up with so far: import re print fname = raw_input("Enter filename: ") seriesname = raw_input("Enter series: ") def findcounter(fname, seriesname): logfile = open(fname, "r") pat = 'INFO Number of teams :' for line in logfile: if seriesname in line: if pat in line: s=line pattern = re.compile(r"""(?P<name>.*?) #starting name \s*INFO #whitespace and success \s*Number\s*of\s*teams #whitespace and strings \s*\:\s*(?P<n1>.*)""",re.VERBOSE) match = pattern.match(s) name = match.group("name") n1 = int(match.group("n1")) print name + " has " + str(n1) + " teams" lcount = 0 for line in logfile: if line.startswith(name): if pat in line: while lcount <= n1: s.append(line) lcount += 1 return result The first part of my code works; it matches the header line that the person searches for, parses the line, and then prints out how many teams are in that series. Since the header line basically tells me how many lines are in the table, I thought that I could use that information to construct a loop that would continue printing each line until a set counter reached n1. But I've tried running it, and I realize that the way I've set it up so far isn't correct. So here's my question: How do you return a number of lines after a matched line when given the number of desired lines that follow the match? I'm new to programming, and I apologize if this question seems silly. I have been working on this quite diligently with no luck and would appreciate any help.

    Read the article

  • How to get started with testing(jMock)

    - by London
    Hello, I'm trying to learn how to write tests. I'm also learning Java, I was told I should learn/use/practice jMock, I've found some articles online that help to certain extend like : http://www.theserverside.com/news/1365050/Using-JMock-in-Test-Driven-Development http://jeantessier.com/SoftwareEngineering/Mocking.html#jMock And most articles I found was about test driven development, write tests first then write code to make the test pass. I'm not looking for that at the moment, I'm trying to write tests for already existing code with jMock. The official documentation is vague to say the least and just too hard for me. Does anybody have better way to learn this. Good books/links/tutorials would help me a lot. thank you EDIT - more concrete question : http://jeantessier.com/SoftwareEngineering/Mocking.html#jMock - from this article Tried this to mock this simple class : import java.util.Map; public class Cache { private Map<Integer, String> underlyingStorage; public Cache(Map<Integer, String> underlyingStorage) { this.underlyingStorage = underlyingStorage; } public String get(int key) { return underlyingStorage.get(key); } public void add(int key, String value) { underlyingStorage.put(key, value); } public void remove(int key) { underlyingStorage.remove(key); } public int size() { return underlyingStorage.size(); } public void clear() { underlyingStorage.clear(); } } Here is how I tried to create a test/mock : public class CacheTest extends TestCase { private Mockery context; private Map mockMap; private Cache cache; @Override @Before public void setUp() { context = new Mockery() { { setImposteriser(ClassImposteriser.INSTANCE); } }; mockMap = context.mock(Map.class); cache = new Cache(mockMap); } public void testCache() { context.checking(new Expectations() {{ atLeast(1).of(mockMap).size(); will(returnValue(int.class)); }}); } } It passes the test and basically does nothing, what I wanted is to create a map and check its size, and you know work some variations try to get a grip on this. Understand better trough examples, what else could I test here or any other exercises would help me a lot. tnx

    Read the article

  • Load a 6 MB binary file in a SQL Server 2005 VARBINARY(MAX) column using ADO/VC++?

    - by Feroz Khan
    How to load a binary file(.bin) of size 6 MB in a varbinary(MAX) column of SQL Server 2005 database using ADO in a VC++ application. This is the code I am using to load the file which I used to load a .bmp file: BOOL CSaveView::PutECGInDB(CString strFilePath, FieldPtr pFileData) { //Open File CFile fileImage; CFileStatus fileStatus; fileImage.Open(strFilePath,CFile::modeRead); fileImage.GetStatus(fileStatus); //Alocating memory for data ULONG nBytes = (ULONG)fileStatus.m_size; HGLOBAL hGlobal = GlobalAlloc(GPTR,nBytes); LPVOID lpData = GlobalLock(hGlobal); //Putting data into file fileImage.Read(lpData,nBytes); HRESULT hr; _variant_t varChunk; long lngOffset = 0; UCHAR chData; SAFEARRAY FAR *psa = NULL; SAFEARRAYBOUND rgsabound[1]; try { //Create a safe array to store the BYTES rgsabound[0].lLbound = 0; rgsabound[0].cElements = nBytes; psa = SafeArrayCreate(VT_UI1,1,rgsabound); while(lngOffset<(long)nBytes) { chData = ((UCHAR*)lpData)[lngOffset]; hr = SafeArrayPutElement(psa,&lngOffset,&chData); if(hr != S_OK) { return false; } lngOffset++; } lngOffset = 0; //Assign the safe array to a varient varChunk.vt = VT_ARRAY|VT_UI1; varChunk.parray = psa; hr = pFileData->AppendChunk(varChunk); if(hr != S_OK) { return false; } } catch(_com_error &e) { //get info from _com_error _bstr_t bstrSource(e.Source()); _bstr_t bstrDescription(e.Description()); _bstr_t bstrErrorMessage(e.ErrorMessage()); _bstr_t bstrErrorCode(e.Error()); TRACE("Exception thrown for classes generated by #import"); TRACE("\tCode= %08lx\n",(LPCSTR)bstrErrorCode); TRACE("\tCode Meaning = %s\n",(LPCSTR)bstrErrorMessage); TRACE("\tSource = %s\n",(LPCSTR)bstrSource); TRACE("\tDescription = %s\n",(LPCSTR)bstrDescription); } catch(...) { TRACE("***Unhandle Exception***"); } //Free Memory GlobalUnlock(lpData); return true; } But when I read the same file using Getchunk function it gives me all 0s but the size of the file I get is same as the one uploaded. Your help will be highly appreciated.

    Read the article

  • Best practices regarding equals: to overload or not to overload?

    - by polygenelubricants
    Consider the following snippet: import java.util.*; public class EqualsOverload { public static void main(String[] args) { class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } } List<Thing> myThings = Arrays.asList(new Thing(42)); System.out.println(myThings.contains(new Thing(42))); // prints "false" } } Note that contains returns false!!! We seems to have lost our things!! The bug, of course, is the fact that we've accidentally overloaded, instead of overridden, Object.equals(Object). If we had written class Thing as follows instead, then contains returns true as expected. class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.x == ((Thing) o).x); } } Effective Java 2nd Edition, Item 36: Consistently use the Override annotation, uses essentially the same argument to recommend that @Override should be used consistently. This advice is good, of course, for if we had tried to declare @Override equals(Thing other) in the first snippet, our friendly little compiler would immediately point out our silly little mistake, since it's an overload, not an override. What the book doesn't specifically cover, however, is whether overloading equals is a good idea to begin with. Essentially, there are 3 situations: Overload only, no override -- ALMOST CERTAINLY WRONG! This is essentially the first snippet above Override only (no overload) -- one way to fix This is essentially the second snippet above Overload and override combo -- another way to fix The 3rd situation is illustrated by the following snippet: class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.equals((Thing) o)); } } Here, even though we now have 2 equals method, there is still one equality logic, and it's located in the overload. The @Override simply delegates to the overload. So the questions are: What are the pros and cons of "override only" vs "overload & override combo"? Is there a justification for overloading equals, or is this almost certainly a bad practice?

    Read the article

  • overwrite existing entity via bulkloader.Loader

    - by Ray Yun
    I was going to CSV based export/import for large data with app engine. My idea was just simple. First column of CSV would be key of entity. If it's not empty, that row means existing entity and should overwrite old one. Else, that row is new entity and should create new one. I could export key of entity by adding key property. class FrontExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'Front', [ ('__key__', str, None), ('name', str, None), ]) But when I was trying to upload CSV, it had failed because bulkloader.Loader.generate_key() was just for "key_name" not "key" itself. That means all exported entities in CSV should have unique 'key_name' if I want to modify-and-reupload them. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('_UNUSED', lambda x: None), ('name', lambda x: x.decode('utf-8')), ]) def generate_key(self,i,values): # first column is key keystr = values[0] if len(keystr)==0: return None return keystr I also tried to load key directly without using generate_key(), but both failed. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('Key', db.Key), # not working. just create new one. ('__key__', db.Key), # same... So, how can I overwrite existing entity which has no 'key_name'? It would be horrible if I should give unique name to all entities..... From the first answer, I could handle this problem. :) def create_entity(self, values, key_name=None, parent=None): # if key_name is None: # print 'key_name is None' # else: # print 'key_name=<',key_name,'> : length=',len(key_name) Validate(values, (list, tuple)) assert len(values) == len(self._Loader__properties), ( 'Expected %d columns, found %d.' % (len(self._Loader__properties), len(values))) model_class = GetImplementationClass(self.kind) properties = { 'key_name': key_name, 'parent': parent, } for (name, converter), val in zip(self._Loader__properties, values): if converter is bool and val.lower() in ('0', 'false', 'no'): val = False properties[name] = converter(val) if key_name is None: entity = model_class(**properties) #print 'create new one' else: entity = model_class.get(key_name) for key, value in properties.items(): setattr(entity, key, value) #print 'overwrite old one' entities = self.handle_entity(entity) if entities: if not isinstance(entities, (list, tuple)): entities = [entities] for entity in entities: if not isinstance(entity, db.Model): raise TypeError('Expected a db.Model, received %s (a %s).' % (entity, entity.__class__)) return entities def generate_key(self,i,values): # first column is key if values[0] is None or values[0] in ('',' ','-','.'): return None return values[0]

    Read the article

  • Write PEM encoded certificate in file - java

    - by user1349407
    Good day. I recently create X.509 certificate by using bouncy castle API. I need to save the certificate result rather than display the result. I tried to use FileOutputStream, but it does not work. regards the result is like follows -----BEGIN CERTIFICATE----- MIICeTCCAeKgAwIBAgIGATs8OWsXMA0GCSqGSIb3DQEBCwUAMBsxGTAXBgNVBAMT... -----END CERTIFICATE----- The code is belows import java.io.FileOutputStream; //example of a basic CA public class PKCS10CertCreateExample { public static X509Certificate[] buildChain() throws Exception { //create the certification request KeyPair pair = chapter7.Utils.generateRSAKeyPair(); PKCS10CertificationRequest request = PKCS10ExtensionExample.generateRequest(pair); //create a root certificate KeyPair rootPair=chapter7.Utils.generateRSAKeyPair(); X509Certificate rootCert = X509V1CreateExample.generateV1Certificate (rootPair); //validate the certification request if(!request.verify("BC")) { System.out.println("request failed to verify!"); System.exit(1); } //create the certificate using the information in the request X509V3CertificateGenerator certGen = new X509V3CertificateGenerator(); certGen.setSerialNumber(BigInteger.valueOf(System.currentTimeMillis())); certGen.setIssuerDN(rootCert.getSubjectX500Principal()); certGen.setNotBefore(new Date(System.currentTimeMillis())); certGen.setNotAfter(new Date(System.currentTimeMillis()+50000)); certGen.setSubjectDN(request.getCertificationRequestInfo().getSubject()); certGen.setPublicKey(request.getPublicKey("BC")); certGen.setSignatureAlgorithm("SHA256WithRSAEncryption"); certGen.addExtension(X509Extensions.AuthorityKeyIdentifier, false, new AuthorityKeyIdentifierStructure(rootCert)); certGen.addExtension(X509Extensions.SubjectKeyIdentifier, false, new SubjectKeyIdentifierStructure(request.getPublicKey("BC"))); certGen.addExtension(X509Extensions.BasicConstraints, true, new BasicConstraints(false)); //certGen.addExtension(X509Extensions.KeyUsage, true, new BasicConstraints(false)); certGen.addExtension(X509Extensions.KeyUsage, true, new KeyUsage(KeyUsage.digitalSignature | KeyUsage.keyEncipherment)); certGen.addExtension(X509Extensions.ExtendedKeyUsage, true, new ExtendedKeyUsage(KeyPurposeId.id_kp_serverAuth)); //extract the extension request attribute ASN1Set attributes = request.getCertificationRequestInfo().getAttributes(); for(int i=0;i!=attributes.size();i++) { Attribute attr = Attribute.getInstance(attributes.getObjectAt(i)); //process extension request if(attr.getAttrType().equals(PKCSObjectIdentifiers.pkcs_9_at_extensionRequest)) { X509Extensions extensions = X509Extensions.getInstance(attr.getAttrValues().getObjectAt(0)); Enumeration<?> e = extensions.oids(); while(e.hasMoreElements()) { DERObjectIdentifier oid = (DERObjectIdentifier)e.nextElement(); X509Extension ext = extensions.getExtension(oid); certGen.addExtension(oid, ext.isCritical(), ext.getValue().getOctets()); } } } X509Certificate issuedCert = certGen.generateX509Certificate(rootPair.getPrivate()); return new X509Certificate[]{issuedCert, rootCert}; } public static void main(String[] args) throws Exception { X509Certificate[] chain = buildChain(); PEMWriter pemWrt = new PEMWriter(new OutputStreamWriter(System.out)); pemWrt.writeObject(chain[0]); //pemWrt.writeObject(chain[1]); pemWrt.close(); //write it out //FileOutputStream fOut = new FileOutputStream("pkcs10req.req"); //fOut.write(chain[0].toString()); //fOut.write() //System.out.println(chain[0].toString()); //fOut.close(); } }

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • Can this be imporved? Scrubing of dangerous html tags.

    - by chobo2
    Hi I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • Can this be improved? Scrubing of dangerous html tags.

    - by chobo2
    I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • How to access a field's value in an object using reflection

    - by kentcdodds
    My Question: How to overcome an IllegalAccessException to access the value of a an object's field using reflection. Expansion: I'm trying to learn about reflection to make some of my projects more generic. I'm running into an IllegalAccessException when trying to call field.getValue(object) to get the value of that field in that object. I can get the name and type just fine. If I change the declaration from private to public then this works fine. But in an effort to follow the "rules" of encapsulation I don't want to do this. Any help would be greatly appreciated! Thanks! My Code: package main; import java.lang.reflect.Field; public class Tester { public static void main(String args[]) throws Exception { new Tester().reflectionTest(); } public void reflectionTest() throws Exception { Person person = new Person("John Doe", "555-123-4567", "Rover"); Field[] fields = person.getClass().getDeclaredFields(); for (Field field : fields) { System.out.println("Field Name: " + field.getName()); System.out.println("Field Type: " + field.getType()); System.out.println("Field Value: " + field.get(person)); //The line above throws: Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" } } public class Person { private final String name; private final String phoneNumber; private final String dogsName; public Person(String name, String phoneNumber, String dogsName) { this.name = name; this.phoneNumber = phoneNumber; this.dogsName = dogsName; } } } The Output: run: Field Name: name Field Type: class java.lang.String Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" at sun.reflect.Reflection.ensureMemberAccess(Reflection.java:95) at java.lang.reflect.AccessibleObject.slowCheckMemberAccess(AccessibleObject.java:261) at java.lang.reflect.AccessibleObject.checkAccess(AccessibleObject.java:253) at java.lang.reflect.Field.doSecurityCheck(Field.java:983) at java.lang.reflect.Field.getFieldAccessor(Field.java:927) at java.lang.reflect.Field.get(Field.java:372) at main.Tester.reflectionTest(Tester.java:17) at main.Tester.main(Tester.java:8) Java Result: 1 BUILD SUCCESSFUL (total time: 0 seconds)

    Read the article

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • Getting instance crashes on IntelliJ IDEA with scala plugin.

    - by egervari
    I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

    Read the article

  • UIScrollView does not scroll

    - by Preston Cheung
    I got a problem about UIScrollView. I am making a custom view which inherits UIView. The view has a UIScrollView on which there are lots of buttons which should scroll left and right. The UIScrollView and buttons can show normally. But I cannot scroll the buttons. Could someone give me some suggestions? Thanks a lot! MZMPhotoCalenderSwitcher.h #import <UIKit/UIKit.h> @interface MZMPhotoCalenderSwitcher : UIView <UIScrollViewDelegate> @property (strong, nonatomic) UIScrollView *topSwitcher; @end MZMPhotoCalenderSwitcher.m - (void)viewDidLoad { [super viewDidLoad]; // Do any additional setup after loading the view. self.topSwitcher = [[UIScrollView alloc] initWithFrame:CGRectMake(0, LABEL_HEIGHT + VIEW_Y, self.view.bounds.size.width, TOP_SWITCHER_HEIGHT)]; self.topSwitcher.backgroundColor = [UIColor greenColor]; self.topSwitcher.pagingEnabled = YES; self.topSwitcher.showsHorizontalScrollIndicator = NO; self.topSwitcher.showsVerticalScrollIndicator = NO; [self add:3 ButtonsOnView:self.topSwitcher withButtonWidth:44.8f andHeight:20.0f]; } - (void)add:(int)num ButtonsOnView:(UIScrollView *)view withButtonWidth:(CGFloat)width andHeight:(CGFloat)height { CGFloat totalTopSwitcherWidth = num * width; [view setContentSize:CGSizeMake(totalTopSwitcherWidth, view.bounds.size.height)]; CGFloat xOffset = 0.0f; for (int i=1; i<=num; i++) { UIButton *button = [UIButton buttonWithType:UIButtonTypeRoundedRect]; [button setFrame:CGRectMake(xOffset, 0, width, height)]; xOffset += width; [button setTitle:[NSString stringWithFormat:@"%d", i] forState:UIControlStateNormal]; button.titleLabel.font = [UIFont systemFontOfSize:10]; [button setTitleColor:[UIColor blueColor] forState:UIControlStateNormal]; [button setTitleColor:[UIColor blackColor] forState:UIControlStateSelected]; [button setTag:i]; [button addTarget:self action:@selector(buttonEvent) forControlEvents:UIControlEventTouchUpInside]; if (i % 2 == 0) [button setBackgroundColor:[UIColor yellowColor]]; else [button setBackgroundColor:[UIColor redColor]]; [view addSubview:button]; } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Python and displaying HTML

    - by Tyler Seymour
    I've gotten pretty comfortable with Python and now I'm looking to make a rudimentary web application. I was somewhat scared of Django and the other Python frameworks so I went caveman on it and decided to generate the HTML myself using another Python script. Maybe this is how you do it anyways - but I'm just figuring this stuff out. I'm really looking for a tip-off on, well, what to do next. My Python script PRINTS the HTML (is this even correct? I need it to be on a webpage!), but now what? Thanks for your continued support during my learning process. One day I will post answers! -Tyler Here's my code: from SearchPhone import SearchPhone phones = ["Iphone 3", "Iphone 4", "Iphone 5","Galaxy s3", "Galaxy s2", "LG Lucid", "LG Esteem", "HTC One S", "Droid 4", "Droid RAZR MAXX", "HTC EVO", "Galaxy Nexus", "LG Optimus 2", "LG Ignite", "Galaxy Note", "HTC Amaze", "HTC Rezound", "HTC Vivid", "HTC Rhyme", "Motorola Photon", "Motorola Milestone", "myTouch slide", "HTC Status", "Droid 3", "HTC Evo 3d", "HTC Wildfire", "LG Optimus 3d", "HTC ThunderBolt", "Incredible 2", "Kyocera Echo", "Galaxy S 4g", "HTC Inspire", "LG Optimus 2x", "Samsung Gem", "HTC Evo Shift", "Nexus S", "LG Axis", "Droid 2", "G2", "Droid x", "Droid Incredible" ] print """<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>table of phones</title> </head> <body> </body> </html> """ #table print '<table width="100%" border="1">' for x in phones: y = SearchPhone(x) print "\t<tr>" print "\t\t<td>" + str(y[0]) + "</td>" print "\t\t<td>" + str(y[1]) + "</td>" print "\t\t<td>" + str(y[2]) + "</td>" print "\t\t<td>" + str(y[3]) + "</td>" print "\t\t<td>" + str(y[4]) + "</td>" print "\t</tr>" print "</table>

    Read the article

  • Will this ever result in a stack overflow error?

    - by David
    Will incrementing the instance variables of an object ever lead to a stack overflow error? For example: This method (java) will cause a stack overflow error: class StackOverflow { public static void StackOverflow (int x) { System.out.println (x) ; StackOverflow(x+1) ; } public static void main (String[]arg) { StackOverflow (0) ; } but will this?: (..... is a gap that i've put in to shorten the code. its long enough as it is.) import java.util.*; class Dice { String name ; int x ; int[] sum ; .... public Dice (String name) { this.name = name ; this.x = 0 ; this.sum = new int[7] ; } .... public static void main (String[] arg) { Dice a1 = new Dice ("a1") ; for (int i = 0; i<6000000; i++) { a1.roll () ; printDice(a1) ; } } .... public void roll () { this.x = randNum(1, this.sum.length) ; this.sum[x] ++ ; } public static int randNum (int a, int b) { Random random = new Random() ; int c = (b-a) ; int randomNumber = ((random.nextInt(c)) + a) ; return randomNumber ; } public static void printDice (Dice Dice) { System.out.println (Dice.name) ; System.out.println ("value: "+Dice.x) ; printValues (Dice) ; } public static void printValues (Dice Dice) { for (int i = 0; i<Dice.sum.length; i++) System.out.println ("#of "+i+"'s: "+Dice.sum[i]) ; } } The above doesn't currently cause a stack overflow error but could i get it too if i changed this line in main: for (int i = 0; i<6000000; i++) so that instead of 6 million something sufficiently high were there?

    Read the article

  • Reading three words and sorting them in lexicographic order

    - by Derrick
    I am trying to create a program that asks the User to type three words and sort them in lexicographic order. EXAMPLE; Enter three words separated by spaces: Pear Orange Apple Apple Orange Pear The program is working fine (if I attempt the above example) except for one type of combination example that I will show below. EXAMPLE; Enter three words separated by spaces: Orange Apple Pear Apple Pear Pear The program is skipping the first word (Orange) if it is supposed to appear in the middle of the three words. I believe that this line of code is affecting the program because it says that "this assigned value is never used" but I'm not sure how to fix it since I'm still an entry Java learner. middle = firstWord; Because of that line being unused, it's why Pear appeared twice. import java.util.*; public static void main(String[] args) { Scanner wordInput = new Scanner(System.in); String firstWord; String secondWord; String thirdWord; System.out.println("Enter three words separated by spaces: "); firstWord = wordInput.next(); secondWord = wordInput.next(); thirdWord = wordInput.next(); String top = firstWord; String bottom = firstWord; if( top.compareTo(secondWord) > 0) { top = secondWord; } if( top.compareTo(thirdWord) > 0) { top = thirdWord; } if( bottom.compareTo(secondWord) < 0) { bottom = secondWord; } if( bottom.compareTo(thirdWord) < 0) { bottom = thirdWord; } String middle; if( !firstWord.equals(bottom) && !firstWord.equals(top) ) { middle = firstWord; } if( !secondWord.equals(bottom) && !secondWord.equals(top) ) { middle = secondWord; } else { middle = thirdWord; } System.out.println( top ); System.out.println( middle ); System.out.println( bottom ); } } Does anyone what I am missing or doing wrong? :( Please and thank you for any help!

    Read the article

  • Assign value to HTML textbox from JSP

    - by prakash_d22
    Hello I am creating a web page to add some information about given product.I need to enter id,name,description and image as information.I need the id to be auto generated.I am using jsp and database as access.I am fetching the count(*)+1 value from database and assigning to my html text box but its showing as null.can i get some help? Code: <body> <%@page import="java.sql.*"%> <%! String no; %> <% try{ Class.forName("sun.jdbc.odbc.JdbcOdbcDriver"); Connection con = DriverManager.getConnection("jdbc:odbc:pd"); ResultSet rs = null; Statement st = con.createStatement(); String sql = ("select count(*)+1 from products"); st.executeUpdate(sql); while (rs.next()) { no=rs.getString("count(*)+1"); } rs.close(); st.close(); con.close(); } catch(Exception e){} %> <Form name='Form1' action="productcode.jsp" method="post"> <table width="1024" border="0"> <tr> <td width="10">&nbsp;</td> <td width="126">Add Product: </td> <td width="277">&nbsp;</td> <td width="583">&nbsp;</td> </tr> <tr> <td>&nbsp;</td> <td>Product Id:</td> <td><label> <input type="text" name="id" value="<%= no%>"/> </label></td> <td>&nbsp;</td> .... and so on

    Read the article

  • Programatically created UITableViewCell subclass only working on highlight

    - by squarefrog
    I've created a subclass of UITableViewCell but I'm struggling to get it to work properly. If I use UITableViewStyleDefault then the class only works when highlighted. If I use UITableViewStyleValue1 then it mostly works but I'm unable to change label fonts much. I tried researching but it seems everyone is doing this via a .xib file, but not programatically. Implementation file #import "ASCustomCellWithCount.h" @implementation ASCustomCellWithCount @synthesize primaryLabel,secondaryLabel,contentCountImage,contentCount; - (id)initWithStyle:(UITableViewCellStyle)style reuseIdentifier:(NSString *)reuseIdentifier { self = [super initWithStyle:style reuseIdentifier:reuseIdentifier]; if (self) { // Initialization code contentCountImage = [[UIImageView alloc] initWithImage:[UIImage imageNamed: @"tableCount.png"] ]; primaryLabel = [[UILabel alloc] init]; primaryLabel.textAlignment = UITextAlignmentLeft; primaryLabel.textColor = [UIColor blackColor]; primaryLabel.font = [UIFont systemFontOfSize: 20]; primaryLabel.backgroundColor = [UIColor clearColor]; secondaryLabel = [[UILabel alloc] init]; secondaryLabel.textAlignment = UITextAlignmentLeft; secondaryLabel.textColor = [UIColor blackColor]; secondaryLabel.font = [UIFont systemFontOfSize: 8]; secondaryLabel.backgroundColor = [UIColor clearColor]; contentCount = [[UILabel alloc] init]; contentCount.textAlignment = UITextAlignmentCenter; contentCount.font = [UIFont boldSystemFontOfSize: 15]; contentCount.textColor = [UIColor whiteColor]; contentCount.shadowColor = [UIColor blackColor]; contentCount.shadowOffset = CGSizeMake(1, 1); contentCount.backgroundColor = [UIColor clearColor]; [self.contentView addSubview: contentCountImage]; [self.contentView addSubview: primaryLabel]; [self.contentView addSubview: secondaryLabel]; [self.contentView addSubview: contentCount]; } return self; } - (void)layoutSubviews { [super layoutSubviews]; CGRect contentRect = self.contentView.bounds; // CGFloat boundsX = contentRect.origin.x; primaryLabel.frame = CGRectMake(0 ,0, 200, 25); secondaryLabel.frame = CGRectMake(0, 30, 100, 15); contentCount.frame = CGRectMake(contentRect.size.width - 48, contentRect.size.height / 2 - 13, 36, 24); contentCountImage.frame = CGRectMake(contentRect.size.width - 48, contentRect.size.height / 2 - 12, 36, 24); } - (void)setSelected:(BOOL)selected animated:(BOOL)animated { [super setSelected:selected animated:animated]; // Configure the view for the selected state } - (void)dealloc { [primaryLabel release]; [secondaryLabel release]; [contentCountImage release]; [contentCount release]; } @end And then to create the cell I use - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; ASCustomCellWithCount *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[ASCustomCellWithCount alloc] initWithStyle: UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } cell.textLabel.text = [NSString stringWithFormat:@"%@", [tempArray objectAtIndex: indexPath.row]]; cell.contentCount.text = @"49"; return cell; }

    Read the article

  • JSP to Bean to Java class Validation

    - by littlevahn
    I have a rather simple form in JSP that looks like this: <form action="response.jsp" method="POST"> <label>First Name:</label><input type="text" name="firstName" /><br> <label>Last Name:</label><input type="text" name="lastName" /><br> <label>Email:</label><input type="text" name="email" /><br> <label>Re-enter Email:</label><input type="text" name="emailRe" /><br> <label>Address:</label><input type="text" name="address" /><br> <label>Address 2:</label><input type="text" name="address2" /><br> <label>City:</label><input type="text" name="city" /><br> <label>Country:</label> <select name="country"> <option value="0">--Country--</option> <option value="1">United States</option> <option value="2">Canada</option> <option value="3">Mexico</option> </select><br> <label>Phone:</label><input type="text" name="phone" /><br> <label>Alt Phone:</label><input type="text" name="phoneAlt" /><br> <input type="submit" value="submit" /> </form> But when I try and access the value of the select box in my Java class I get null. Ive tried reading it in as a String and an Array of strings neither though seems to be grabbing the right value. The response.jsp looks like this: <%@ page language="java" %> <%@ page import="java.util.*" %> <%@page contentType="text/html" pageEncoding="UTF-8"%> <%! %> <jsp:useBean id="formHandler" class="validation.RegHandler" scope="request"> <jsp:setProperty name="formHandler" property="*" /> </jsp:useBean> <% if (formHandler.validate()) { %> <jsp:forward page="success.jsp"/> <% } else { %> <jsp:forward page="retryReg.jsp"/> <% } %> I already have Java script validation in place but I wanted to make sure I covered validation and checking for non-JS users. The RegHandler just uses the name field to refer to the value in the form. Any Idea how I could access the select box's value?

    Read the article

  • What am I encrypting wrong here?

    - by Katie Krueger
    So I have a wordplay project to do and I have to encrypt some characters. I am at the point where I am stuck, and when I run it and type 1 for encrypt it doesn't shift that many letters. It just prints the work over again. I am wondering what I could do to fix it where if I say "hello" it will print 1 character over and say "ifmmp" Thank you! import java.util.Scanner; public class WordPlayTester{ public static void main(String [] args){ String word, reverse=""; String original; int key= 0; String Menu= "1-Encrypt \n2-Decrypt \n3-Is Palindrome \n0-Quit \n-Select an option-"; Scanner in = new Scanner(System.in); System.out.println("-Type any word-"); word = in.nextLine(); System.out.println(Menu); int choice=in.nextInt(); if(choice==1) { System.out.println("Insert a Key number"); int select= in.nextInt(); for (int i=0; i < word.length(); i++) { char c = word.charAt(i); if (c >= 'A' && c <= 'Z') { c = (char)(c - 64); int n = c+1; n = n % 26; if (n < 0) { n = n + 26; } c = (char)(n + 65); } System.out.println(c); } } else if(choice==3) { int length = word.length(); for ( int i = length - 1 ; i >= 0 ; i-- ) reverse = reverse + word.charAt(i); if (word.equals(reverse)) System.out.println("Your word is a palindrome."); else System.out.println("Your word is not a palindrome."); } else if(choice==0) { System.exit(0); } else { System.out.println(Menu); } } }

    Read the article

  • I want to get the value from one class (SearchTableViewController.m) to another class (HistoryTableV

    - by ahmet732
    #import <UIKit/UIKit.h> @class SearchDetailViewController; @interface SearchTableViewController : UITableViewController <UISearchBarDelegate, UITableViewDelegate, UITableViewDataSource>{ IBOutlet UITableView *myTableView; NSMutableArray *tableData;//will be storing data that will be displayed in table. //Search array den buna aktarma yapcaz ilerde görceksin. NSMutableArray *searchedData;//will be storing data matching with the search string UISearchBar *sBar;//search bar NSMutableArray *searchArray; // It holds the medicines that are shown in tableview SearchDetailViewController * searchDetailViewController; NSMutableArray *deneme; } @property(nonatomic,retain)UISearchBar *sBar; @property(nonatomic,retain)IBOutlet UITableView *myTableView; @property(nonatomic,retain)NSMutableArray *tableData; @property(nonatomic,retain)NSMutableArray *searchedData; @property (nonatomic, retain) NSMutableArray *searchArray; @property (nonatomic, retain) SearchDetailViewController *searchDetailViewController; @property (nonatomic, copy) NSMutableArray *deneme; @end SearchTableViewController.m - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. // AnotherViewController *anotherViewController = [[AnotherViewController alloc] initWithNibName:@"AnotherView" bundle:nil]; // [self.navigationController pushViewController:anotherViewController]; // [anotherViewController release]; **deneme= [[NSMutableArray alloc]init]; deneme=[tableData objectAtIndex:indexPath.row];** ****NSLog(@"my row = %@", deneme);**// I holded one of the selected cells here** HistoryTableViewController.m - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. // AnotherViewController *anotherViewController = [[AnotherViewController alloc] initWithNibName:@"AnotherView" bundle:nil]; // [self.navigationController pushViewController:anotherViewController]; // [anotherViewController release]; **SearchTableViewController *obj= [[SearchTableViewController alloc]init];** **NSLog(@"my 2nd row= %@", [obj deneme]); //it prints nil** } My project is TabBar. There are two buttons on it- Search and History. I want to display selected items in a table in History tab. But i can not bring the selected item from SearchTableViewController.m to the class (HistoryTableViewController.m) The problem is : I can hold one of the selected items in an array (named deneme)from table in SearchTableViewController.m but i can not take it to HistoryTableViewController.m. It prints nil in console screen.... If I can make it visible in History class, I display those selected items on table. Please help me !!!

    Read the article

  • Help with listView in Android

    - by jul
    Hi, I'm just starting with Android and can't find how to display a list in my activity. I get some restaurant data from a web service and I'd like to show the results in a list. The activity, the restaurant class and the layout main.xml are shown below. How can I display, for instance, the list of the restaurant names in the ListView 'list' of my layout? thank you Jul public class Atable extends ListActivity { RestaurantList restaurantList; public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); //Here I set restaurantList //Now how can I display, for example, the list of the names of the restaurants } main.xml <LinearLayout android:orientation="horizontal" android:layout_width="fill_parent" android:layout_height="wrap_content"> <TextView android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/search" /> <EditText android:id="@+id/search" android:layout_width="wrap_content" android:layout_height="wrap_content" android:layout_weight="1"/> </LinearLayout> <LinearLayout android:orientation="vertical" android:layout_width="wrap_content" android:layout_height="wrap_content"> <ListView android:id="@+id/android:list" android:layout_width="wrap_content" android:layout_height="wrap_content"/> <TextView android:id="@+id/android:empty" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/noresults"/> </LinearLayout> </LinearLayout> Restaurant list class package org.digitalfarm.atable; import java.util.List; public class RestaurantList { private List<Restaurant> restaurants; public List<Restaurant> getRestaurants() { return restaurants; } public void setRestaurants(List<Restaurant> restaurants) { this.restaurants = restaurants; } } Restaurant class package org.digitalfarm.atable; public class Restaurant { private String name; private float latitude; private float longitude; public String getName() { return name; } public void setName(String name) { this.name = name; } public float getLatitude() { return latitude; } public void setLatitude(float latitude) { this.latitude = latitude; } public float getLongitude() { return longitude; } public void setLongitude(float longitude) { this.longitude = longitude; } }

    Read the article

  • App losing db connection

    - by DaveKub
    I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

    Read the article

  • jar dependencies in android- no class definition found exception

    - by Dave.B
    I'm trying to use the gdata java client library on android and have managed a decent hack to get it working. However because the jar for gdata had some package discrepancies with android I had to import the source into my project. This source is dependent on the JavaMail API and the JavaBeans Activation Framework as specified here. My issue is that the JavaMail jar throws a class definition not found when seeking a class which is in the Activation Framework jar. A stack trace is listed below. I am working in Eclipse and have both jars in a lib folder and added to my build path. I'm not very experienced dealing with jars in a situation like this so any help or insight would be appreciated. 03-29 09:55:26.204: ERROR/AndroidRuntime(331): Uncaught handler: thread AsyncTask #3 exiting due to uncaught exception 03-29 09:55:26.215: ERROR/AndroidRuntime(331): java.lang.RuntimeException: An error occured while executing doInBackground() 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at android.os.AsyncTask$3.done(AsyncTask.java:200) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask$Sync.innerSetException(FutureTask.java:273) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask.setException(FutureTask.java:124) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:307) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask.run(FutureTask.java:137) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1068) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:561) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.lang.Thread.run(Thread.java:1096) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): Caused by: java.lang.NoClassDefFoundError: javax.activation.DataHandler 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at javax.mail.internet.MimeBodyPart.setContent(MimeBodyPart.java:684) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at com.google.gdata.data.media.MediaBodyPart.<init>(MediaBodyPart.java:95) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at com.google.gdata.data.media.MediaMultipart.<init>(MediaMultipart.java:126) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at com.google.gdata.client.media.MediaService.insert(MediaService.java:382) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at android.os.AsyncTask$2.call(AsyncTask.java:185) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:305)

    Read the article

< Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >