Search Results

Search found 45013 results on 1801 pages for 'example'.

Page 336/1801 | < Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• How can I display a language according to the user's browser's language inside this code?

  - by janoChen

  How can I display a language according to the user's browser's language inside this mini-framework for my multilingual website? Basically, it has to display the default language of the user if there's no cookies. Example of index.php: (rendered output) <h2><?php echo l('tagline_h2'); ?></h2> common.php: (controller of which language to output) <?php session_start(); header('Cache-control: private'); // IE 6 FIX if(isSet($_GET['lang'])) { $lang = $_GET['lang']; // register the session and set the cookie $_SESSION['lang'] = $lang; setcookie("lang", $lang, time() + (3600 * 24 * 30)); } else if(isSet($_SESSION['lang'])) { $lang = $_SESSION['lang']; } else if(isSet($_COOKIE['lang'])) { $lang = $_COOKIE['lang']; } else { $lang = 'en'; } //use appropiate lang.xx.php file according to the value of the $lang switch ($lang) { case 'en': $lang_file = 'lang.en.php'; break; case 'es': $lang_file = 'lang.es.php'; break; case 'tw': $lang_file = 'lang.tw.php'; break; case 'cn': $lang_file = 'lang.cn.php'; break; default: $lang_file = 'lang.en.php'; } //translation helper function function l($translation) { global $lang; return $lang[$translation]; } include_once 'languages/'.$lang_file; ?> Example of /languages/lang.en.php: (where multilingual content is being stored) <?php $lang = array( 'tagline_h2' => '...',

  Read the article

• Issues with Rails, Amazon S3, and protected URLs

  - by Shpigford

  So I followed this little tutorial about protecting downloads of files that are uploaded to Amazon S3 with Paperclip. When I've developed locally, it's worked fine, but since pushing the exact same code to a production server...I now get this error from Amazon when I try to access the files: <Error> <Code>InvalidArgument</Code> <Message>Either the Signature query string parameter or the Authorization header should be specified, not both</Message> <ArgumentValue>Basic dGVjaHVrdWxlbGU6ZWxlbHVrdWhjZXQ=</ArgumentValue> <ArgumentName>Authorization</ArgumentName> <RequestId>F6E455857C54F95A</RequestId> <HostId>X4QA2pw9wpHtJtJ2T8qxCyINjq4PLHQVF4VrlYjpX7Ayh694BgQprh5p8H7NRCAt</HostId> </Error> Example URL: http://s3.amazonaws.com/media.example.com/assets/videos/1/original.mov?AWSAccessKeyId=MY_ACCESS_KEY&Expires=1271972624&Signature=7wWH2WYHPO0o9szwPJbimUMqAig%3D That URL is generated using AWS::S3::S3Object.url_for using the aws-s3 gem. So...not even sure where to start. The fact that it works fine when the app is running locally but not when in production really doesn't make sense. The production server is running Ubuntu 8.04.4 LTS (Hardy).

  Read the article

• Calculating odds distribution with 6-sided dice

  - by Stephen

  I'm trying to calculate the odds distribution of a changing number of 6-sided die rolls. For example, 3d6 ranges from 3 to 18 as follows: 3:1, 4:3, 5:6, 6:10, 7:15, 8:21, 9:25, 10:27, 11:27, 12:25, 13:21, 14:15, 15:10, 16:6, 17:3, 18:1 I wrote this php program to calculate it: function distributionCalc($numberDice,$sides=6) { for ( $i=0; $i<pow($sides,$numberDice); $i++) { $sum=0; for ($j=0; $j<$numberDice; $j++) { $sum+=(1+(floor($i/pow($sides,$j))) % $sides); } $distribution[$sum]++; } return $distribution; } The inner $j for-loop uses the magic of the floor and modulus functions to create a base-6 counting sequence with the number of digits being the number of dice, so 3d6 would count as: 111,112,113,114,115,116,121,122,123,124,125,126,131,etc. The function takes the sum of each, so it would read as: 3,4,5,6,7,8,4,5,6,7,8,9,5,etc. It plows through all 3^6 possible results and adds 1 to the corresponding slot in the $distribution array between 3 and 18. Pretty straightforward. However, it only works until about 8d6, afterward i get server time-outs because it's now doing billions of calculations. But I don't think it's necessary because die probability follows a sweet bell-curve distribution. I'm wondering if there's a way to skip the number crunching and go straight to the curve itself. Is there a way to do this, so, for example, with 80d6 (80-480)? Can the distribution be projected without doing 6^80 calculations? I'm not a professional coder and probability is still new to me, so thanks for all the help! Stephen

  Read the article

• How to "escape" the JavaScript class keyword to specify a CSS class value.

  - by Robert Claypool

  C# allows a reserved word to be used as a property name via the ampersand. e.g. // In ASP.NET MVC, we use @class to define // the css class attribute for some HtmlHelper methods. var htmlObject = new { readonly = "readonly", @class = "ui-state-highlight" } I want to do the same in JavaScript. e.g. function makeGrid(grid, pager) { grid.jqGrid({ caption: 'Configurations', colNames: ['Id', 'Name'], colModel: [ { name: 'Id', index: 'Id' }, { name: 'Name', index: 'Name', editable: true, editoptions: { readonly: 'readonly', class: 'FormElement readonly' } }, ], pager: pager, url: 'www.example.com/app/configurations") %>', editurl: 'www.example.com/app/configurations/edit") %>' }).navGrid(pager, { edit: true, add: false, del: false, search: false }, {}, {}, {}); } Note class: 'FormElement readonly' is supposed to set the css class value on jqGrid's edit dialog, but IE errors out on the reserved word. Is there an escape character in JavaScript too? #class? @class? &class? Otherwise, how might I tell jqGrid to set the css class on the popup editor? Thank you.

  Read the article

• Detecting Asymptotes in a Graph

  - by nasufara

  I am creating a graphing calculator in Java as a project for my programming class. There are two main components to this calculator: the graph itself, which draws the line(s), and the equation evaluator, which takes in an equation as a String and... well, evaluates it. To create the line, I create a Path2D.Double instance, and loop through the points on the line. To do this, I calculate as many points as the graph is wide (e.g. if the graph itself is 500px wide, I calculate 500 points), and then scale it to the window of the graph. Now, this works perfectly for most any line. However, it does not when dealing with asymptotes. If, when calculating points, the graph encounters a domain error (such as 1/0), the graph closes the shape in the Path2D.Double instance and starts a new line, so that the line looks mathematically correct. Example: However, because of the way it scales, sometimes it is rendered correctly, sometimes it isn't. When it isn't, the actual asymptotic line is shown, because within those 500 points, it skipped over x = 2.0 in the equation 1 / (x-2), and only did x = 1.98 and x = 2.04, which are perfectly valid in that equation. Example: In that case, I increased the window on the left and right one unit each. My question is: Is there a way to deal with asymptotes using this method of scaling so that the resulting line looks mathematically correct? I myself have thought of implementing a binary search-esque method, where, if it finds that it calculates one point, and then the next point is wildly far away from the last point, it searches in between those points for a domain error. I had trouble figuring out how to make it work in practice, however. Thank you for any help you may give!

  Read the article

• Java: volatile guarantees and out-of-order execution

  - by WizardOfOdds

  Note that this question is solely about the volatile keyword and the volatile guarantees: it is not about the synchronized keyword (so please don't answer "you must use synchronize" for I don't have any issue to solve: I simply want to understand the volatile guarantees (or lack of guarantees) regarding out-of-order execution). Say we have an object containing two volatile String references that are initialized to null by the constructor and that we have only one way to modify the two String: by calling setBoth(...) and that we can only set their references afterwards to non-null reference (only the constructor is allowed to set them to null). For example (it's just an example, there's no question yet): public class SO { private volatile String a; private volatile String b; public SO() { a = null; b = null; } public void setBoth( @NotNull final String one, @NotNull final String two ) { a = one; b = two; } public String getA() { return a; } public String getB() { return b; } } In setBoth(...), the line assigning the non-null parameter "a" appears before the line assigning the non-null parameter "b". Then if I do this (once again, there's no question, the question is coming next): if ( so.getB() != null ) { System.out.println( so.getA().length ); } Am I correct in my understanding that due to out-of-order execution I can get a NullPointerException? In other words: there's no guarantee that because I read a non-null "b" I'll read a non-null "a"? Because due to out-of-order (multi)processor and the way volatile works "b" could be assigned before "a"? volatile guarantees that reads subsequent to a write shall always see the last written value, but here there's an out-of-order "issue" right? (once again, the "issue" is made on purpose to try to understand the semantics of the volatile keyword and the Java Memory Model, not to solve a problem).

  Read the article

• Can the Diamond Problem be really solved?

  - by Mecki

  A typical problem in OO programming is the diamond problem. I have parent class A with two sub-classes B and C. A has an abstract method, B and C implement it. Now I have a sub-class D, that inherits of B and C. The diamond problem is now, what implementation shall D use, the one of B or the one of C? People claim Java knows no diamond problem. I can only have multiple inheritance with interfaces and since they have no implementation, I have no diamond problem. Is this really true? I don't think so. See below: [removed vehicle example] Is a diamond problem always the cause of bad class design and something neither programmer nor compiler needs to solve, because it shouldn't exist in the first place? Update: Maybe my example was poorly chosen. See this image Of course you can make Person virtual in C++ and thus you will only have one instance of person in memory, but the real problem persists IMHO. How would you implement getDepartment() for GradTeachingFellow? Consider, he might be student in one department and teach in another one. So you can either return one department or the other one; there is no perfect solution to the problem and the fact that no implementation might be inherited (e.g. Student and Teacher could both be interfaces) doesn't seem to solve the problem to me.

  Read the article

• Sharepoint: Integrity of lookup fields after a list import

  - by driAn

  Hi there I got a question about the behavior of lookup fields when importing data. I wonder how the lookup fields behave when the list they point to is being replaced/imported. To explain the issue, I will provide a quick example below: As example, assume we have these two sharepoint lists: Product Types ------------- + Type Name + Code Nr + etc Products -------- + Product Name + Product Type (Lookup field to list "Product Types") + etc In my scenario, the Products List contains production data on the production Sharepoint platform. It is filled with data by the business users. However the Product Types list contains rather static data and is maintained by the developer. Now after a development cycle, the developer wants to deploy his new webparts and his new data (product types list). The developer performs the following procedure: On the dev machine: Export "product type" list using stsadm On the production machine: Delete all items in the "product type" list On the production machine: Import the "product type" list using stsadm This means we basically replace the "product type" list on the production server while keeping the "product" list as it is. Now the question: Is this safe? Will the lookup references break under certain circumstances? Any downside of this import/export procedure? What happens if someone accesses a "product" during the import? Will the (now invalid) reference clear its own content (become a null value). What happens if the schema of the "product type" list changes (new column)? Will this cause any troubles? Thanks for all feedback and suggestions!

  Read the article

• jquery GET and POST confusion

  - by JPro

  Hi, I am not quiet sure how jquery works. I want to know few things about the GET and POST in terms of jQuery. I use the following code in my app : <script> function example_ajax_request() { $('#example-placeholder').html('<p>Loading results ... <img src="ajax-loader.gif" /></p>'); $('#example-placeholder').load("ind.php?show=" + $('#box option:selected').val()); } </script> I am not using either GET or POST in this method. I am using a button to call the example_ajax_request to process the request and get the results. Sometimes I see code like this: $.ajax({ url: 'loader.php', data: 'somedata', method: 'GET', success: function(data){ $('#er').text(data); } }); My doubt is, is it required or not that we use a method to post the data? (either GET or POST) while send and getting the data in PHP webapps? The code that I use first works fine even though I do not use any POST or GET methods. Any inputs? Thanks.

  Read the article

• Visual Studio 2005 to VS 2008

  - by Adi

  hi all, I am a newbie in working on VS IDE and have not much experience in how the different libraries and files are linked in it. I have to build a OpenCV project which was made in VS2005 by one of my colleagues into VS2008. The project is for blob detection. Following is what he has to say in readme : Steps to use the library (using MSVC++ sp 5): 1 - open the project of the library and build it 2 - in the project where the library should be used, add: 2.1 In "Project/Settings/C++/Preprocessor/Additional Include directories" add the directory where the blob library is stored 2.2 In "Project/Settings/Link/Input/Additional library path" add the directory where the blob library is stored and in "Object/Library modules" add the cvblobslib.lib file 3- Include the file "BlobResult.h" where you want to use blob variables. 4- To see an example on using the blob library, see the file example.txt inside the zip file. NOTE: Verify that in the project where the cvblobslib.lib is used, the MFC Runtime Libraries are not mixed: Check in "Project-Settings-C/C++-Code Generation-Use run-time library" of your project and set it to Debug Multithreaded DLL (debug version ) or to Multithreaded DLL ( release version ). 2 Check in "Project-Settings-General" how it uses the MFC. It should be "Use MFC in a shared DLL". NOTE: The library can be compiled and used in .NET using this steps, but the menu options may differ a little NOTE2: In the .NET version, the character sets must be equal in the .lib and in the project. [OpenCV yahoo group: Msg 35500] Can anyone explain me , how to go about in doing this in VS2008. I would also appreciate if someone can explain me how the different libraries are linked , what is Debug, What is Release and all in a Visual Studio project folder we have.\ Thanks in advance Aditya

  Read the article

• Can't contravariance be solved with interfaces?

  - by Sir Psycho

  Hi, I'm at the point where I'm starting to grasp contravariance, although I'm trying to work out what the advantage is when an interface can be used instead. Obviously I'm missing something. Here is the c#4 example class Dog : Animal { public Dog(string name) : base(name) { } } class Animal { string _name; public Animal(string name) { _name = name; } public void Walk() { Console.WriteLine(_name + " is walking"); } } Action<Animal> MakeItMove = (ani) => { ani.Walk(); }; Action<Dog> MakeItWalk = MakeItMove; MakeItWalk(new Dog("Sandy")); Same example which works in earlier versions on c# class Dog : Animal { public Dog(string name) : base(name) { } } class Animal : IAnimal { string _name; public Animal(string name) { _name = name; } public void Walk() { Console.WriteLine(_name + " is walking"); } } interface IAnimal { void Walk(); } Action<IAnimal> MakeItMove = (ani) => { ani.Walk(); }; Action<IAnimal> MakeItWalk = MakeItMove; MakeItWalk(new Dog("Sandy")); These may not be the best examples, but I still can't seem to 'get it'. Is the in keywork defined on the action delegate simply a short hand syntax way like lamda is to delegates?

  Read the article

• Best approach for a multi-tab ASP.NET AJAX control?

  - by NovaJoe

  Looking for some implementation advice: I have a page that has a 3-tab ajaxToolkit:TabContainer. The purpose of the page is to expose a calculator that has two basic inputs: geo-location and date. The three tabs are labeled "City and State", "Postal Code", and "GPS Coordinates". The layout of each tab container is the same for each tab, with the exception of the location section; the location section changes because each type of location has different inputs. For example, to specify city/state, there will be three fields: city, country, and state (country and state will use cascading drop-down lists). But Postal code requires only one field (which will validate via regular expression for allowed countries). See the example design mockup: So, what I WOULD LIKE to do (in order to minimize duplicate code), is to have a common control that contains the layout and structure of the calculator without specifying anything about the location section. Then, I'd like to be able to pull in each of the unique location controls based on what tab is selected. The tab structure exists at the page level, not in a control. Any advice? I was looking at templated controls (see MSDN article here), but I'm not convinced that it's the right solution. If I HAVE to create three separate controls with similar layouts and common elements, then that's what I have to do. But REALLY, I'd prefer a more elegant, inheritance-based solution. Any advice would be greatly appreciated. Thanks.

  Read the article

• Relational database data explorer / visualization?

  - by Ian Boyd

  Is there a tool that can let one browse relational data as a graph of connected nodes? For example, i'm faced with trying to cleanse some anomolous data. i can start with two offending rows. In this particular example, the TransactionID should, by business rules, be unique to the table, but i find a transaction that violates that rule: SELECT * FROM LCTTrans WHERE TransactionID = 1075048 LCTID TransactionID ========= ============= 4358 1075048 4359 1075048 2 row(s) affected But really what i want to begin to hunt down all the related data, to try to see which is right. So this hypothetical software would start by showing me these two rows: Next, i want to see that transaction that is linked into this table: Now that transaction points to an MAL, so show me that: Now lets add those two LCTs, that the transaction is "on". A transaction can be on only one LCT, yet this one is pointing to two: Okay computer, both of those LCTs point to an MAL and the transaction that created them, show me those: Those last two transactions, they also point at an MAL, and they themselves point to an LCT, show me those: Okay, now are there any entries in LCTTrans that point to LCTs 4358 or 4359?... And so on, and so on. Now i did all this manually, running single selects, copying and pasting uniqueidentifier keys and converting them into friendly id numbers so i could easily see the relationships. Is there software that can do this?

  Read the article

• Hg: How to do a rebase like git's rebase

  - by jpswain09

  Hey guys, In Git I can do this: 1. Start working on new feature: $ git co -b newfeature-123 # (a local feature development branch) do a few commits (M, N, O) master A---B---C \ newfeature-123 M---N---O 2. Pull new changes from upstream master: $ git pull (master updated with ff-commits) master A---B---C---D---E---F \ newfeature-123 M---N---O 3. Rebase off master so that my new feature can be developed against the latest upstream changes: (from newfeature-123) $ git rebase master master A---B---C---D---E---F \ newfeature-123 M---N---O I want to know how to do the same thing in Mercurial, and I've scoured the web for an answer, but the best I could find was this: http://www.selenic.com/pipermail/mercurial/2007-June/013393.html That link provides 2 examples: 1. I'll admit that this: (replacing the revisions from the example with those from my own example) hg up -C F hg branch -f newfeature-123 hg transplant -a -b newfeature-123 is not too bad, except that it leaves behind the pre-rebase M-N-O as an unmerged head and creates 3 new commits M',N',O' that represent them branching off the updated mainline. Basically the problem is that I end up with this: master A---B---C---D---E---F \ \ newfeature-123 \ M'---N'---O' \ newfeature-123 M---N---O this is not good because it leaves behind local, unwanted commits that should be dropped. The other option from the same link is hg qimport -r M:O hg qpop -a hg up F hg branch newfeature-123 hg qpush -a hg qdel -r qbase:qtip and this does result in the desired graph: master A---B---C---D---E---F \ newfeature-123 M---N---O but these commands (all 6 of them!) seem so much more complicated than $ git rebase master I want to know if this is the only equivalent in Hg or if there is some other way available that is simple like Git. Thanks!! Jamie

  Read the article

• Permission denied (maybe missing INTERNET permission) when calling web service

  - by Maxim

  I'm trying to use .net SOAP web service with ksoap2 lib. Example from http://www.vimeo.com/9633556 shows how to do it correct. Below the code from that example. everything shoud work ok, but when I try to do a call inself (httpTransport.call) I get "Permission denied (maybe missing INTERNET permission)" exception. Moreover, I don't see in the Application info window among permissions the internet permission alert. Tried this on emulator and Google phone. Will be very appreciated if somebody could help with it. Thanks. public void CelsiusToFahrenheit() { String SOAP_ACTION = "http://tempuri.org/CelsiusToFahrenheit"; String METHOD_NAME = "CelsiusToFahrenheit"; String NAMESPACE = "http://tempuri.org/"; String URL = "http://www.w3schools.com/webservices/tempconvert.asmx"; SoapObject Request = new SoapObject(NAMESPACE, METHOD_NAME); Request.addProperty("Celsius", "32"); SoapSerializationEnvelope soapEnvelope = new SoapSerializationEnvelope(SoapEnvelope.VER11); soapEnvelope.dotNet = true; soapEnvelope.setOutputSoapObject(Request); AndroidHttpTransport httpTransport = new AndroidHttpTransport(URL); try { httpTransport.call(SOAP_ACTION, soapEnvelope); SoapPrimitive resultString = (SoapPrimitive)soapEnvelope.getResponse(); res = resultString.toString(); } catch (Exception e) { e.printStackTrace(); } } AndroidManifest.xml <?xml version="1.0" encoding="utf-8"?> <manifest> <application> <intent-filter> <action android:name="android.intent.action.MAIN" /> <category android:name="android.intent.category.LAUNCHER" /> </intent-filter> </activity> </application> <user-permission android:name="android.permission.INTERNET"></user-permission> <uses-sdk android:minSdkVersion="4" />

  Read the article

• imagegrabwindow + https = black screen

  - by earls

  I'm doing something stupid and trying to capture thumbnails, snapshots, images of a html webpages. I'm doing something along the lines of: http://stackoverflow.com/questions/443837/how-might-i-obtain-a-snapshot-or-thumbnail-of-a-web-page-using-php DCOM + IE + PHP (imagegrabwindow; example from manual) Everything works PERFECT until I try to capture a HTTPS website... https://mail.google.com for example. imagegrabwindow produces a png, but it only shows the browser. the contents of the browser are black. If I log out of Google, I can capture the browser window and the contents thereof - the second I log in, the contents (not the browser frame) are black screen. Yes, I've increased the timeout (before closing the browser window). IE has clearly loaded the page, it just refuses to render for imagegrabwindow. I've been fighting this long enough I know it's either a permissions problem or a service needs to interact with the desktop. Does anyone have any clue what permissions need to be set or which service needs access? I assumed cryptographic services, but that's run as a network service and trying to change it to interact makes it shout and carry on. This is the last piece of the puzzle, I'd really like to get it working. Thank you!

  Read the article

• Perl XML SAX parser emulating XML::Simple record for record

  - by DVK

  Short Q summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog - due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. What I'm looking for is an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been.

  Read the article

• XML streaming with XProc.

  - by Pierre

  Hi all, I'm playing with xproc, the XML pipeline language and http://xmlcalabash.com/. I'd like to find an example for streaming large xml documents. for example, given the following huge xml document: <Books> <Book> <title>Book-1</title> </Book> <Book> <title>Book-2</title> </Book> <Book> <title>Book-3</title> </Book> <!-- many many.... --> <Book> <title>Book-N</title> </Book> </Books> How should I proceed to loop (streaming) over x-N documents like <Books> <Book> <title>Book-x</title> </Book> </Books> and treat each document with a xslt ? is it possible with xproc ?

  Read the article

• rich:tabPanel and problems when filed has required="true"

  - by JQueryNeeded

  Hello, Let's consider following, simplified example: we have 2 tabs withing , each tab has and at the moment we want to switch from one tab to another, and the inputText is empty (we dont want to submit value from it anyway, we want to go to another tab) we get "Validation Error: Value is required." the example code: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:ui="http://java.sun.com/jsf/facelets" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:a4j="http://richfaces.org/a4j" xmlns:rich="http://richfaces.org/rich" > <a4j:form id="mainForm" reRender="mainForm" ajaxSubmit="true" > <rich:tabPanel switchType="ajax"> <rich:tab label="TabA" > <a4j:region> <h:outputText value="Tab A content" /> <h:inputText value="" required="true" /> </a4j:region> </rich:tab> <rich:tab label="TabB"> <a4j:region> <h:outputText value="Tab B content" /> <h:inputText value="" required="true" /> </a4j:region> </rich:tab> </rich:tabPanel> <rich:messages /> </a4j:form> </html>

  Read the article

• Why is Swing Parser's handleText not handling nested tags?

  - by Jim P

  I need to transform some HTML text that has nested tags to decorate 'matches' with a css attribute to highlight it (like firefox search). I can't just do a simple replace (think if user searched for "img" for example), so I'm trying to just do the replace within the body text (not on tag attributes). I have a pretty straightforward HTML parser that I think should do this: final Pattern pat = Pattern.compile(srch, Pattern.CASE_INSENSITIVE); Matcher m = pat.matcher(output); if (m.find()) { final StringBuffer ret = new StringBuffer(output.length()+100); lastPos=0; try { new ParserDelegator().parse(new StringReader(output.toString()), new HTMLEditorKit.ParserCallback () { public void handleText(char[] data, int pos) { ret.append(output.subSequence(lastPos, pos)); Matcher m = pat.matcher(new String(data)); ret.append(m.replaceAll("<span class=\"search\">$0</span>")); lastPos=pos+data.length; } }, false); ret.append(output.subSequence(lastPos, output.length())); return ret; } catch (Exception e) { return output; } } return output; My problem is, when I debug this, the handleText is getting called with text that includes tags! It's like it's only going one level deep. Anyone know why? Is there some simple thing I need to do to HTMLParser (haven't used it much) to enable 'proper' behavior of nested tags? PS - I figured it out myself - see answer below. Short answer is, it works fine if you pass it HTML, not pre-escaped HTML. Doh! Hope this helps someone else. <span>example with <a href="#">nested</a> <p>more nesting</p> </span> <!-- all this gets thrown together -->

  Read the article

• intelligent path truncation/ellipsis for display

  - by peterchen

  I am looking for an existign path truncation algorithm (similar to what the Win32 static control does with SS_PATHELLIPSIS) for a set of paths that should focus on the distinct elements. For example, if my paths are like this: Unit with X/Test 3V/ Unit with X/Test 4V/ Unit with X/Test 5V/ Unit without X/Test 3V/ Unit without X/Test 6V/ Unit without X/2nd Test 6V/ When not enough display space is available, they should be truncated to something like this: ...with X/...3V/ ...with X/...4V/ ...with X/...5V/ ...without X/...3V/ ...without X/...6V/ ...without X/2nd ...6V/ (Assuming that an ellipsis generally is shorter than three letters). This is just an example of a rather simple, ideal case (e.g. they'd all end up at different lengths now, and I wouldn't know how to create a good suggestion when a path "Thingie/Long Test/" is added to the pool). There is no given structure of the path elements, they are assigned by the user, but often items will have similar segments. It should work for proportional fonts, so the algorithm should take a measure function (and not call it to heavily) or generate a suggestion list. Data-wise, a typical use case would contain 2..4 path segments anf 20 elements per segment. I am looking for previous attempts into that direction, and if that's solvable wiht sensible amount of code or dependencies.

  Read the article

• Dashcode code translation

  - by Alex Mcp

  Hi, a quick, probably easy question whose answer is probably "best practice" I'm following a tutorial for a custom-template mobile Safari webapp, and to change views around this code is used: function btnSave_ClickHandler(event) { var views = document.getElementById('stackLayout'); var front = document.getElementById('mainScreen'); if (views && views.object && front) { views.object.setCurrentView(front, true); } } My question is just about the if conditional statement. What is this triplet saying, and why do each of those things need to be verified before the view can be changed? Does views.object just test to see if the views variable responds to the object method? Why is this important? EDIT - This is/was the main point of this question, and it regards not Javascript as a language and how if loops work, but rather WHY these 3 things specifically need to be checked: Under what scenarios might views and front not exist? I don't typically write my code so redundantly. If the name of my MySQL table isn't changing, I'll just say UPDATE 'mytable' WHERE... instead of the much more verbose (and in my view, redundant) $mytable = "TheSQLTableName"; if ($mytable == an actual table && $mytable exists && entries can be updated){ UPDATE $mytable; } Whereas if the table's name (or in the JS example, the view's names) ARE NOT "hard coded" but are instead a user input or otherwise mutable, I might right my code as the DashCode example has it. So tell me, can these values "go wrong" anyhow? Thanks!

  Read the article

• Selectively suppress XML comments?

  - by Mike Post

  We deliver a number of assemblies to external customers, but not all of the public APIs are officially supported. For example, due to less than optimal design choices sometimes a type must be publicly exposed from an assembly for the rest of our code to work, but we don't want customers to use that type. One part of communicating the lack of support is not provide any intellisense in the form of XML comments. Is there a way to selectively suppress XML comments? I'm looking for something other than ignoring warning 1591 since it's a long term maintenance issue. Example: I have an assembly with public classes A and B. A is officially supported and should have XML documentation. B is not intended for external use and should not be documented. I could turn on XML documentation and then suppress warning 1591. But when I later add the officially supported class C, I want the compiler to tell me that I've screwed up and failed to add the XML documentation. This wouldn't occur if I had suppressed 1591 at the project level. I suppose I could #pragma across entire classes, but it seems like there should be a better way to do this.

  Read the article

• How do you jump to a particular row in a DataGridView by typing (a la Windows Explorer details view)

  - by russcollier

  I have a .NET Winforms app in C# with a DataGridView that's read-only and populated with some number of rows. I'd like to have functionality similar to Windows Explorer's (and many other applications) details view for example. I'd like the DataGridView to behave such that when it has focus if you start typing, the current row selection will jump to the row where the (string) value of cell 0 (i.e. the first column in the row) starts with the characters you typed in. For example, if I have a DataGridView with 1 column and the following rows: Bob Jane Jason John Leroy Sam If the DataGridView has focus and I hit the 'b' key on my keyboard, the selected row is now "Bob". If I quickly type in the keys 'ja', the selected row is Jane. If I quickly type in the letters 'jas', the selected row is Jane. If I hit the 'z' key, nothing is selected (since nothing starts with Z). Likewise if Jane is currently selected and I keep typing the letter 'j', the selection will cycle through to Jason, then John, then back to Jane, each time I hit the 'j' key. I've been doing some Googling (and "stackoverflowing" :-)) for awhile and cannot find any examples of this type of functionality. I have a rough idea in my head to do this via some sort of short lived timer thread, collecting the keystrokes on KeyPress events for the DataGridView, and selecting rows based on those collected keystrokes matching a Cells[0].Value.StartsWith() type of condition. But it seems like there has to be an easier way that I'm just not seeing. Any ideas would be much appreciated. Thanks!

  Read the article

< Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >