Search Results

Search found 29191 results on 1168 pages for 'api key'.

Page 338/1168 | < Previous Page | 334 335 336 337 338 339 340 341 342 343 344 345  | Next Page >

  • Python to C# with openSSL requirement

    - by fonix232
    Hey there again! Today I ran into a problem when I was making a new theme creator for chrome. As you may know, Chrome uses a "new" file format, called CRX, to manage it's plugins and themes. It is a basic zip file, but a bit modified: "Cr24" + derkey + signature + zipFile And here comes the problem. There are only two CRX creators, written in Ruby or Python. I don't know neither language too much (had some basic experience in Python though, but mostly with PyS60), so I would like to ask you to help me convert this python app to a C# class. Also, here is the source of crxmake.py: #!/usr/bin/python # Cribbed from http://github.com/Constellation/crxmake/blob/master/lib/crxmake.rb # and http://src.chromium.org/viewvc/chrome/trunk/src/chrome/tools/extensions/chromium_extension.py?revision=14872&content-type=text/plain&pathrev=14872 # from: http://grack.com/blog/2009/11/09/packing-chrome-extensions-in-python/ import sys from array import * from subprocess import * import os import tempfile def main(argv): arg0,dir,key,output = argv # zip up the directory input = dir + ".zip" if not os.path.exists(input): os.system("cd %(dir)s; zip -r ../%(input)s . -x '.svn/*'" % locals()) else: print "'%s' already exists using it" % input # Sign the zip file with the private key in PEM format signature = Popen(["openssl", "sha1", "-sign", key, input], stdout=PIPE).stdout.read(); # Convert the PEM key to DER (and extract the public form) for inclusion in the CRX header derkey = Popen(["openssl", "rsa", "-pubout", "-inform", "PEM", "-outform", "DER", "-in", key], stdout=PIPE).stdout.read(); out=open(output, "wb"); out.write("Cr24") # Extension file magic number header = array("l"); header.append(2); # Version 2 header.append(len(derkey)); header.append(len(signature)); header.tofile(out); out.write(derkey) out.write(signature) out.write(open(input).read()) os.unlink(input) print "Done." if __name__ == '__main__': main(sys.argv) Please could you help me?

    Read the article

  • Hot to get custom http-header in asp.net?

    - by Sirius Lampochkin
    I have an asp.net appliction on the one server. There I've added code on server-side in Page_Load: Response.AddHeader("key", "password-key-from-hotel"); On the client side I have a form: $lt;form ... action="www.link-to-another-domaint" >   <input type="hidden" id="asd" value="fgh" > .... </form> <script type="text/javascript">   document.forms[0].submit(); </script> Then on the other domain - there is also my other application - I'm trying to get the hedaer "key" by this code: Request.Headers["key"].ToString(); But there is no such header. Is there is a desicion? Where is my mistake?

    Read the article

  • mysql composite unique on FK's

    - by m2o
    I want to implement the following constraints in mysql: create table TypeMapping( ... constraint unique(server_id,type_id), constraint foreign key(server_id) references Server(id), constraint foreign key(type_id) references Type(id) ); This throws a 'ERROR 1062 (23000): Duplicate entry '3-4' for key 'server_id'' when I issue an insert/update that would break the constraint. Is this type of constraint even possible? If so how? Thank you.

    Read the article

  • Dynamically removing records when certain columns = 0; data cleansing

    - by cdburgess
    I have a simple card table: CREATE TABLE `users_individual_cards` ( `id` int(11) NOT NULL AUTO_INCREMENT, `user_id` char(36) NOT NULL, `individual_card_id` int(11) NOT NULL, `own` int(10) unsigned NOT NULL, `want` int(10) unsigned NOT NULL, `trade` int(10) unsigned NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `user_id` (`user_id`,`individual_card_id`), KEY `user_id_2` (`user_id`), KEY `individual_card_id` (`individual_card_id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1; I have ajax to add and remove the records based on OWN, WANT, and TRADE. However, if the user removes all of the OWN, WANT, and TRADE cards, they go to zero but it will leave the record in the database. I would prefer to have the record removed. Is checking after each "update" to see if all the columns = 0 the only way to do this? Or can I set a conditional trigger with something like: //psuedo sql AFTER update IF (OWN = 0, WANT = 0, TRADE = 0) DELETE What is the best way to do this? Can you help with the syntax?

    Read the article

  • SQL How to join multiplue columns with same name to one column

    - by Choi Shun Chi
    There is a super class account {User, TYPE} and subclasses saving{User, ID, balance,TYPE,interest,curency_TYPE} time{User,ID,balance,TYPE,interest,curency_TYPE,start_date,due_date,period} fore{User,ID,balance,interest,curency_TYPE} User and TYPE is the primary key of account and foreign key of three subclasses ID is primary key of three subclasses how to make a list of showing all IDs in one column?Also the same as balance and TYPE meet the problem I considered a.ID as saving, b.ID as time but it showing them separately

    Read the article

  • UNIQUE CONSTRAINT on a column from foreign table in MSSQL2008

    - by bodziec
    Hi, I have two tables: create table [dbo].[Main] ( [ID] [int] identity(1,1) primary key not null, [Sign] [char](1) not null ) create table [dbo].[Names] ( [ID_Main][int] primary key not null, [Name][nvarchar](128) not null, constraint [FK_Main_Users] foreign key ([ID_Main]) references [dbo].[Main]([ID]), constraint [CK_Name] unique ([Name], [Sign]) ) The problem is with the second constraint CK_Name Is there a way to make a constraint target column from a foreign table?

    Read the article

  • How to store an inventory using hashtables?

    - by Harm De Weirdt
    Hello everyone. For an assignment in collego we have to make a script in Perl that allows us to manage an inventory for an e-store. (The example given was Amazon) Users can make orders in a fully text-based environment and the inventory must be updated when an order is completed. Every item in the inventory has 3 to 4 attributes: a product code, a title, a price and for some an amount (MP3's for example do not have this attribute) Since this is my first encounter with Perl, i don't really know how to start. My main problem is how i should "implement" the inventory in the program. One of the functions of the program is searching trough the titles. Another is to make an order, where the user should give a product code. My first idea was a hashtable with the productcode as key. But if i wanted to search in the titles that could be a problem because of this: the hashkey would be something like DVD-123, the information belonging to that key could be "The Green Mask 12" (without the ") where the 12 indicates how many of this DVD are currently in stock. So i'd have to find a way to ignore the 12 in the end. Another solution was to use the title as Hashkey, but that would prove cumbersome too I think. Is there a way to make a hashtable with 2 key's, and when I give only one it returns an array with the other values? (Including the other key and the other information) That way I could use another key depending on what info I need from my inventory. We have to read the default inventory from a txt file looking like this: MP3-72|Lady Gaga - Kiss and Run (Fear of Commitment Monster)|0.99 CD-400|Kings of Leon - Only By The Night|14.50|2 MP3-401|Kings of Leon - Closer|0.85 DVD-144|Live Free or Die Hard|14.99|2 SOFT-864|Windows Vista|49.95 Any help would be appreciated very much :) PS: I am sorry for my bad grammar, English isn't my native language.

    Read the article

  • Converting the value from string to integer in a nested dictionary

    - by tom smith
    I want to change the numbers in my dictionary to int values for use later in my program. So far I have import time import math x = 400 y = 300 def read_next_object(file): obj = {} for line in file: if not line.strip(): continue line = line.strip() key, val = line.split(": ") if key in obj and key == "Object": yield obj obj = {} obj[key] = val yield obj planets = {} with open( "smallsolar.txt", 'r') as f: for obj in read_next_object(f): planets[obj["Object"]] = obj print(planets) scale=250/int(max([planets[x]["Orbital Radius"] for x in planets if "Orbital Radius" in planets[x]])) print(scale) and the output is {'Sun': {'Object': 'Sun', 'Satellites': 'Mercury,Venus,Earth,Mars,Jupiter,Saturn,Uranus,Neptune,Ceres,Pluto,Haumea,Makemake,Eris', 'Orbital Radius': '0', 'RootObject': 'Sun', 'Radius': '20890260'}, 'Moon': {'Object': 'Moon', 'Orbital Radius': '18128500', 'Period': '27.321582', 'Radius': '1737000.10'}, 'Earth': {'Object': 'Earth', 'Satellites': 'Moon', 'Orbital Radius': '77098290', 'Period': '365.256363004', 'Radius': '6371000.0'}} 3.2426140709476178e-06 I want to be able to convert the numbers in the dict to ints for further use. Any help in greatly appreciated.

    Read the article

  • Mysql select - improve performance

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated.

    Read the article

  • NSFetchedResultsController sections localized sorted

    - by Gerd
    How could I use the NSFetchedResultsController with translated sort key and sectionKeyPath? Problem: I have ID in the property "type" in the database like typeA, typeB, typeC,... and not the value directly because it should be localized. In English typeA=Bird, typeB=Cat, typeC=Dog in German it would be Vogel, Katze, Hund. With a NSFetchedResultController with sort key and sectionKeyPath on "type" I receive the order and sections - typeA - typeB - typeC Next I translate for display and everything is fine in English: - Bird - Cat - Dog Now I switch to German and receive a wrong sort order - Vogel - Katze - Hund because it still sorts by typeA, typeB, typeC So I'm looking for a way to localize the sort for the NSFetchedResultsController. I tried the transient property approach, but this doesn't work for the sort key because the sort key need to be in the entity. I have no other idea. But I can't believe that's not possible to use NSFetchedResultsController on a derived attribute required for localization? There are related discussions like http://stackoverflow.com/questions/1384345/using-custom-sections-with-nsfetchedresultscontroller but the difference is that the custom section names and the sort key have probably the same order. Not in my case and this is the main difference. At the end I would need a sort order for the necessary NSSortDescriptor on a derived attribute, I guess. This sort order has also to serve for the sectionKeyPath. Thanks for any hint.

    Read the article

  • Database Modelling - Conceptually different entities but with near identical fields

    - by Andrew Shepherd
    Suppose you have two sets of conceptual entities: MarketPriceDataSet which has multiple ForwardPriceEntries PoolPriceForecastDataSet which has multiple PoolPriceForecastEntry Both different child objects have near identical fields: ForwardPriceEntry has MarketPriceDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForwardPrice PoolPriceForecastEntry has PoolPriceForecastDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForecastPoolPrice If I modelled them as separate tables, the only difference would be the foreign key, and the name of the price field. There has been a debate as to whether the two near identical tables should be merged into one. Options I've thought of to model this is: Just keep them as two independent, separate tables Have both sets in the one table with an additional "type" field, and a parent_id equalling a foreign key to either parent table. This would sacrifice referential integrity checks. Have both sets in the one table with an additional "type" field, and create a complicated sequence of joining tables to maintain referential integrity. What do you think I should do, and why?

    Read the article

  • Whats wrong with this function? .each related

    - by Ritz
    When I uncomment the alert the data is there... like: { 'Huishoudelijke hulp': 'Huishoudelijke hulp', 'Verpleging thuis': 'Verpleging thuis', 'Verzorging thuis': 'Verzorging thuis', '24 uurs zorg': '24 uurs zorg', 'Ondersteunende begeleiding': 'Ondersteunende begeleiding', } But instead of populating the key and the value it takes the whole var and start to create a key and value pair for each character. You can see this in action here: http://www.zorgzuster-zeeland.nl/site/static/calendar_test.php create a task in the calendar and then try to edit the task by clicking on it. It should populate the dropdown field properly. When i create a static var with the same values the dropdown works. static variable var zvmlist = { 'Huishoudelijke hulp': 'Huishoudelijke hulp', 'Verpleging thuis': 'Verpleging thuis', 'Verzorging thuis': 'Verzorging thuis', '24 uurs zorg': '24 uurs zorg', 'Ondersteunende begeleiding': 'Ondersteunende begeleiding', }; This is my function, anybody has a clue? $.get('get_zorgvormen.php', function(zvmlist) { //alert("Data Loaded: " + zvmlist); $.each(zvmlist, function(key, value) { var selected=''; if(key==eventdata.title){var selected='selected' } $('<option value="'+key+'" '+selected+'>'+value+'</option>').appendTo($('#calendar_edit_entry_form_title')); }); });

    Read the article

  • Rewrite SQL Fulltext Function to return Table only

    - by Alex
    I have a MS SQL Fulltext Function like this: (...) RETURNS TABLE AS RETURN SELECT * FROM fishes INNER JOIN CONTAINSTABLE(fishes, *, @keywords, @limit) AS KEY_TBL ON fishes.id = KEY_TBL.[KEY] When I use this function in LINQ, it generates a special return type which includes all fields of my "fishes" table, plus Key and Rank. How could I rewrite above query, or change something in LINQ, to omit Key and Rank and just return my "fishes" results (and to have the fulltext search result objects be of type Fish, which is what I really care about, so I don't have to cast)?

    Read the article

  • How do I join three tables with SQLalchemy and keeping all of the columns in one of the tables?

    - by jimka
    So, I have three tables: The class defenitions: engine = create_engine('sqlite://test.db', echo=False) SQLSession = sessionmaker(bind=engine) Base = declarative_base() class Channel(Base): __tablename__ = 'channel' id = Column(Integer, primary_key = True) title = Column(String) description = Column(String) link = Column(String) pubDate = Column(DateTime) class User(Base): __tablename__ = 'user' id = Column(Integer, primary_key = True) username = Column(String) password = Column(String) sessionId = Column(String) class Subscription(Base): __tablename__ = 'subscription' userId = Column(Integer, ForeignKey('user.id'), primary_key=True) channelId = Column(Integer, ForeignKey('channel.id'), primary_key=True) And the SQL commands that are executed to create them: CREATE TABLE subscription ( "userId" INTEGER NOT NULL, "channelId" INTEGER NOT NULL, PRIMARY KEY ("userId", "channelId"), FOREIGN KEY("userId") REFERENCES user (id), FOREIGN KEY("channelId") REFERENCES channel (id) ); CREATE TABLE user ( id INTEGER NOT NULL, username VARCHAR, password VARCHAR, "sessionId" VARCHAR, PRIMARY KEY (id) ); CREATE TABLE channel ( id INTEGER NOT NULL, title VARCHAR, description VARCHAR, link VARCHAR, "pubDate" TIMESTAMP, PRIMARY KEY (id) ); NOTE: I know user.username should be unique, need to fix that, and I'm not sure why SQLalchemy creates some row names with the double-quotes. And I'm trying to come up with a way to retrieve all of the channels, as well as an indication on what channels one particular user (identified by user.sessionId together with user.id) has a subscription on. For example, say we have four channels: channel1, channel2, channel3, channel4; a user: user1; who has a subscription on channel1 and channel4. The query for user1 would return something like: channel.id | channel.title | subscribed --------------------------------------- 1 channel1 True 2 channel2 False 3 channel3 False 4 channel4 True This is a best-case result, but since I have absolutely no clue as how to accomplish the subscribed column, I've been instead trying to get the particular users id in the rows where the user has a subscription and where a subscription is missing, just leave it blank. The database engine that I'm using together with SQLalchemy atm. is sqlite3 I've been scratching my head over this for two days now, I've no problem joining together all three by way of the subscription table but then all of the channels where the user does not have a subscription gets omitted. I hope I've managed to describe my problem sufficiently, thanks in advance.

    Read the article

  • mozilla browser hot keys? [closed]

    - by Roger22
    Hello, Where can i find the key combinations for some actions, in Mozilla Firefox? For example, Ctrl+L moves the cursor to the address bar. I wanna move the cursor in the Google search box, from the right-top position). Which key is associated with this? And some other key combinations? Thanks!

    Read the article

  • How to access fields in JSON object by index

    - by Stefan
    I know this isn't the best way to do it, but I have no other choice :( I have to access the items in JSONObject by their index. The standard way to access objects is to just wirte this[objectName] or this.objectName. I also found a method to get all the fields inside a json object: (for (var key in p) { if (p.hasOwnProperty(key)) { alert(key + " -> " + p[key]); } } (Soruce : Loop through Json object). However there is no way of accessing the JSONfields directly by a index. The only way I see right now, is to create an array, with the function above, get the fieldname by index and then get the value by fieldname. As far as I see it, the p (in our case the JSON file must be an iteratable array to, or else the foreach loop wouldn't work. How can I access this array directly? Or is it some kind of unsorted list? Regards, Stefan

    Read the article

  • Trying to work with a multi-value array in LotusScript and sort of stuck

    - by rrumaner
    I have to find a way to store a series of variables - MonthYear (the key) and a counter. The purpose of this is to track the number of documents processed by Month & Year. I was thinking of a list but I am not sure how to save the data so that it is readable and able to be shown in a table at a later date. I thought about using a multi-dimensional array - someArray(1,0 to 1) and ReDim'ing it each time I start a new MonthYear and then save it back to a field on the document but am not sure how that is going to play out. Does anyone have an idea of how I can accomplish this? The first dimension will be the MonthYear (key) and the second will be a counter that is updated every time a new document is processed. The key will be based on a field on the document being processed. How can I make sure I am updating the right key/counter combination? How can I retrieve the existing counter from the field on the document, update the counter and then replace the value? I thought about just adding a new element (ReDim) every time a document is processed and than somehow adding up all the counters for each key and storing that in an array, but that just seems real messy. There has to be a good way to do this. Any and all ideas will be greatly appreciated

    Read the article

  • What software analogies have helped you?

    - by Galwegian
    I have often enjoyed the use of analogies in understanding a software scenario or problem. For example, to understand the concept of public key encryption, the 'locked mailbox' analogy or similar is often used as an aid: An analogy for public-key encryption is that of a locked mailbox with a mail slot. The mail slot is exposed and accessible to the public; its location (the street address) is in essence the public key. Anyone knowing the street address can go to the door and drop a written message through the slot; however, only the person who possesses the key can open the mailbox and read the message. My question is: What analogies have you used or heard of in your career that have given you that "Eureka" moment with a complex concept? EDIT: If you have a good one, don't just state the name, please share with the group!

    Read the article

  • Disable Internet Explorer 8 Developer Tools

    - by Steve Brouillard
    Is there a way to either disable Internet Explorer 8 Developer Tools, or at least change the shortcut key mapping? I'm working on an ASP.NET AJAX app that has used the F12 key for a function for years (it's actually a hold over from the original DOS app). Customers have used this key for the sam function for nearly 15 years and we'd really like to avoid having to move that function. Cheers

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • DataGridView Cell Validating only when 'Enter' is pressed

    - by Eldad
    Hi, I want to validate and commit the value entered in the DataGridViewCell ONLY when the user presses the 'Enter' key. If the users presses any other key or mouse button (Arrow keys, Pressing a different cell using the mouse...), I want the behavior to be similar to the 'ESC' key: Move the focus to the new cell and revert the edited cell value to its previous value.

    Read the article

  • Advice Please: SQL Server Identity vs Unique Identifier keys when using Entity Framework

    - by c.batt
    I'm in the process of designing a fairly complex system. One of our primary concerns is supporting SQL Server peer-to-peer replication. The idea is to support several geographically separated nodes. A secondary concern has been using a modern ORM in the middle tier. Our first choice has always been Entity Framework, mainly because the developers like to work with it. (They love the LiNQ support.) So here's the problem: With peer-to-peer replication in mind, I settled on using uniqueidentifier with a default value of newsequentialid() for the primary key of every table. This seemed to provide a good balance between avoiding key collisions and reducing index fragmentation. However, it turns out that the current version of Entity Framework has a very strange limitation: if an entity's key column is a uniqueidentifier (GUID) then it cannot be configured to use the default value (newsequentialid()) provided by the database. The application layer must generate the GUID and populate the key value. So here's the debate: abandon Entity Framework and use another ORM: use NHibernate and give up LiNQ support use linq2sql and give up future support (not to mention get bound to SQL Server on DB) abandon GUIDs and go with another PK strategy devise a method to generate sequential GUIDs (COMBs?) at the application layer I'm leaning towards option 1 with linq2sql (my developers really like linq2[stuff]) and 3. That's mainly because I'm somewhat ignorant of alternate key strategies that support the replication scheme we're aiming for while also keeping things sane from a developer's perspective. Any insight or opinion would be greatly appreciated.

    Read the article

  • WinForms: How to prevent textbox from opening alt menu?

    - by Digiku
    I have this textbox I use to capture keyboard shortcuts for a preferences config. I use a low-level keyboard hook to capture keys and also prevent them from taking action, e.g. the Windows key, but the Alt key still comes through and makes my textbox lose focus. How can I block the Alt key, so the focus is kept unaltered at my textbox?

    Read the article

  • FluentNHibernate mapping of composite foreign keys

    - by Faron
    I have an existing database schema and wish to replace the custom data access code with Fluent.NHibernate. The database schema cannot be changed since it already exists in a shipping product. And it is preferable if the domain objects did not change or only changed minimally. I am having trouble mapping one unusual schema construct illustrated with the following table structure: CREATE TABLE [Container] ( [ContainerId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Container] PRIMARY KEY ( [ContainerId] ASC ) ) CREATE TABLE [Item] ( [ItemId] [uniqueidentifier] NOT NULL, [ContainerId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Item] PRIMARY KEY ( [ContainerId] ASC, [ItemId] ASC ) ) CREATE TABLE [Property] ( [ContainerId] [uniqueidentifier] NOT NULL, [PropertyId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Property] PRIMARY KEY ( [ContainerId] ASC, [PropertyId] ASC ) ) CREATE TABLE [Item_Property] ( [ContainerId] [uniqueidentifier] NOT NULL, [ItemId] [uniqueidentifier] NOT NULL, [PropertyId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Item_Property] PRIMARY KEY ( [ContainerId] ASC, [ItemId] ASC, [PropertyId] ASC ) ) CREATE TABLE [Container_Property] ( [ContainerId] [uniqueidentifier] NOT NULL, [PropertyId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_Container_Property] PRIMARY KEY ( [ContainerId] ASC, [PropertyId] ASC ) ) The existing domain model has the following class structure: The Property class contains other members representing the property's name and value. The ContainerProperty and ItemProperty classes have no additional members. They exist only to identify the owner of the Property. The Container and Item classes have methods that return collections of ContainerProperty and ItemProperty respectively. Additionally, the Container class has a method that returns a collection of all of the Property objects in the object graph. My best guess is that this was either a convenience method or a legacy method that was never removed. The business logic mainly works with Item (as the aggregate root) and only works with a Container when adding or removing Items. I have tried several techniques for mapping this but none work so I won't include them here unless someone asks for them. How would you map this?

    Read the article

  • C# Tupel group limitation

    - by user609511
    How can i controll the loop of Tupel Repeatation ? Someone has give me a hint about my algorithm. I modified a little bit his algorithm. int LimCol = Convert.ToInt32(LimitColis); result = oListTUP .GroupBy(x => x.Item1) .Select(g => new { Key = g.Key, Sum = g.Sum(x => x.Item2), Poids = g.Sum(x => x.Item3), }) .Select(p => new { Key = p.Key, Items = Enumerable.Repeat(LimCol , p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, 1)), CalculPoids = p.Poids / (Enumerable.Repeat(LimCol, p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, 1))).Count() }) .SelectMany(p => p.Items.Select(i => Tuple.Create(p.Key, i, p.CalculPoids))) .ToList(); foreach (var oItem in result) { Label1.Text += oItem.Item1 + "--" + oItem.Item2 + "--" + oItem.Item3 + "<br>"; } the result with LimCol = 3 as you can see i colored with red is the problem. i expected: 0452632--3--3,75 0452632--3--3,75 0452632--3--3,75 0452632--3--3,75 essai 49--3--79,00 essai 49--2--79,00 Thanks you in advance

    Read the article

< Previous Page | 334 335 336 337 338 339 340 341 342 343 344 345  | Next Page >