Search Results

Search found 27144 results on 1086 pages for 'tail call optimization'.

Page 339/1086 | < Previous Page | 335 336 337 338 339 340 341 342 343 344 345 346  | Next Page >

  • calling a method on the parent page from a user control

    - by Kyle
    I am using a user control that I created (just a .cs file not an .ascx file), that does some magic and depending on a value generated by the control, I need it to do something on the parent page that is 'hosting' the control. It needs to call a method under certain circumstances (method is on the parent control). the control is placed on the parent page like so: <customtag:MyControl ID="something" runat="server" /> I'm dynamically creating buttons etc on the control itself but when a button is clicked, let's say for example that there's a text box on the control and if the value of the textbox is "bob" it needs to call a method on the page that's housing the control...how can I accomplish this?

    Read the article

  • c#, Internal, and Reflection

    - by cyberconte
    Duplicate of: Accessing internal members via System.Reflection? Is there a way to execute "internal" code via reflection? Here is an example program: using System; using System.Reflection; namespace ReflectionInternalTest { class Program { static void Main(string[] args) { Assembly asm = Assembly.GetExecutingAssembly(); // Call normally new TestClass(); // Call with Reflection asm.CreateInstance("ReflectionInternalTest.TestClass", false, BindingFlags.Default | BindingFlags.CreateInstance, null, null, null, null); // Pause Console.ReadLine(); } } class TestClass { internal TestClass() { Console.WriteLine("Test class instantiated"); } } } Creating a testclass normally works perfectly, however when i try to create an instance via reflection, I get a missingMethodException error saying it can't find the Constructor (which is what would happen if you tried calling it from outside the assembly). Is this impossible, or is there some workaround i can do?

    Read the article

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Calling unmanaged c++ code in C# Mixed with STL

    - by Turtle
    Hey, I want to call unmanaged c++ code in C# The function interface is like following(I simplified it to make it easy to understand) Face genMesh(int param1, int param2); Face is a struct defined as: struct Face{ vector<float> nodes; vector<int> indexs; } I googled and read the MSDN docs found ways to call simple c/c++ unmanged code in C#, also know how to hand the struct as return value. And My question is how to handle "vector". I did not find rules about mapping between vector and some types in C# Thanks!

    Read the article

  • Error while exiting cherrypy server

    - by Vijayendra Bapte
    Guys, I am getting following error while exiting cherrypy server. What is this error about? 2009-11-04 09:32:35,015 WARNING Error in atexit._run_exitfuncs: 2009-11-04 09:32:35,015 WARNING 2009-11-04 09:32:35,015 WARNING Traceback (most recent call last): 2009-11-04 09:32:35,015 WARNING File "atexit.pyc", line 24, in _run_exitfuncs 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 1486, in shutdown 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 746, in flush 2009-11-04 09:32:35,015 WARNING IOError: [Errno 9] Bad file descriptor 2009-11-04 09:32:35,015 WARNING Error in sys.exitfunc: 2009-11-04 09:32:35,015 WARNING Traceback (most recent call last): 2009-11-04 09:32:35,015 WARNING File "atexit.pyc", line 24, in _run_exitfuncs 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 1486, in shutdown 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 746, in flush 2009-11-04 09:32:35,015 WARNING IOError 2009-11-04 09:32:35,015 WARNING : 2009-11-04 09:32:35,015 WARNING [Errno 9] Bad file descriptor 2009-11-04 09:32:35,015 WARNING

    Read the article

  • App engine downtime

    - by DutrowLLC
    I've noticed that google app engine seems to have a fair amount of downtime where they place the datastore into read-only mode. Frequently this downtime is in the middle of the day. Is this something that is happening only during early development, or is this something that I can expect to be always be occurring? I've developing an application that helps small businesses handle their operations. One thing that it does is take appointments, another is route phone calls. I'd like some suggestions on how to handle times when the datastore is in read-only such as: What if our client is on the phone with the customer and is taking down an appointment and the datastore is in read-only? It would not be acceptable to ask the client to come back later to save, especially if its in the middle of the day. What if there is an incoming call and the application can not store the record or properly route the call due to database writes being unavailable? How are these types of issues normally handled?

    Read the article

  • Static source code analysis with LLVM

    - by Phong
    I recently discover the LLVM (low level virtual machine) project, and from what I have heard It can be used to performed static analysis on a source code. I would like to know if it is possible to extract the different function call through function pointer (find the caller function and the callee function) in a program. I could find the kind of information in the website so it would be really helpful if you could tell me if such an library already exist in LLVM or can you point me to the good direction on how to build it myself (existing source code, reference, tutorial, example...). EDIT: With my analysis I actually want to extract caller/callee function call. In the case of a function pointer, I would like to return a set of possible callee. both caller and callee must be define in the source code (this does not include third party function in a library).

    Read the article

  • F# pattern matching when mixing DU's and other values

    - by Roger Alsing
    What would be the most effective way to express the following code? match cond.EvalBool() with | true -> match body.Eval() with | :? ControlFlowModifier as e -> match e with | Break(scope) -> e :> obj //Break is a DU element of ControlFlowModifier | _ -> next() //other members of CFM should call next() | _ -> next() //all other values should call next() | false -> null cond.EvalBool returns a boolean result where false should return null and true should either run the entire block again (its wrapped in a func called next) or if the special value of break is found, then the loop should exit and return the break value. Is there any way to compress that block of code to something smaller?

    Read the article

  • Linking to a C library compiled as C++

    - by Jacob
    I'm in linker paradise now. I have a C library which only compiles in Visual C++ (it probably works in gcc) if: I compile it as C++ code Define __cplusplus which results in all the declarations being enclosed in extern "C" { } So, by doing this I have a static library called, say, bsbs.lib Now, I have a C++ project called Tester which would like to call function barbar in declared in bsbs.h. All goes fine, until I try to link to bsbs.lib where I get the all-too-familiar: Tester.obj : error LNK2001: unresolved external symbol _foofoo And it always seems to be foofoo which cannot be resolved regardless of which function I call in Tester (barbar or anything else).

    Read the article

  • VB.Net List.Find. Pass values to predicate

    - by Beta033
    Having a bit of trouble using the List.Find with a custom predicate i have a function that does this private function test () Dim test As Integer = keys.Find(AddressOf FindByOldKeyAndName).NewKey here's the function for the predicate Private Shared Function FindByOldKeyAndName(ByVal k As KeyObj) As Boolean If k.OldKey = currentKey.OldKey And k.KeyName = currentKey.KeyName Then Return True Else Return False End If End Function by doing it this way means i have to have a shared "currentKey" object in the class, and i know there has to be a way to pass in the values i'm interested in of CurrentKey (namely, keyname, and oldkey) ideally i'd like to call it by something like keys.Find(AddressOf FindByOldKeyAndName(Name,OldVal)) however when i do this i get compiler errors. How do i call this method and pass in the values?

    Read the article

  • Using jep.invoke() method

    - by hofsoc
    Hi, I need to call a function from a python script and pass in parameters into it. I have a test python script which I can call and run from java using Jepp - this then adds the person. Eg Test.py import Finding from Finding import * f = Finding() f.addFinding("John", "Doe", 27) Within my Finding class I have addFinding(firstname, lastName, age) However, I wish to be able to do this from within java. Should I be using the jep.invoke() method. Does anyone have a hello world example of such a thing being done or forward me to some good examples? Does anyone have any suggestions please? Thanks in advance

    Read the article

  • Can someone describe some DI terms to me?

    - by SoBeNoFear
    I'm in the process of writing a DI framework for PHP 5, and I've been trying to find the 'official' definitions of some words in relation to dependency injection. Some of these words are 'context' and 'lifecycle'. And also, what would I call the object that gets created/injected? Finally, what is the difference between components and services, and which term (if either) should I call the objects that can be injected? I've read Martin Fowler's article and looked through other DI frameworks (Phemto, Spring, Google Guice, Xyster, etc.), but I want to know what you think. Thanks!

    Read the article

  • CategoryName.find is not a function

    - by zurna
    I need to call a plugin inside a ajax call so it could be used on called&received data. But I got the following error. Error: CategoryName.find is not a function Source File: http://www.refinethetaste.com/FLPM/ Line: 82 I tried it as: $.ajax({ dataType: "xml", url: "/FLPM/content/home/index.cs.asp?Process=ViewVCategories", success: function(xml) { $(xml).find('row').each(function(){ var id = $(this).attr('id'); var CategoryName = $(this).find('CategoryName').text(); $("<div class='tab fleft'><a href='http://www.refinethetaste.com/FLPM/content/home/index.cs.asp?Process=ViewVideos&CATEGORYID="+ id +"'>"+ CategoryName + "</a></div>").appendTo("#VCategories"); CategoryName.find("div.row-title .tab").tabs("div.row-title div.panes > div"); }); } });

    Read the article

  • how to specify which child class this object belong to after retrieving from a hashmap?

    - by chandra wibowo
    hi everyone, i have a parent class called Course, and two child class PostgradCourse and UndergradCourse. i have a hashmap HashMap courses; i store all the postgradCourse and undergradCourse objects in the hashmap. i want to retrieve an undergradCourse object from the hashmap using the key. Course course = courses.get(courseCode); then i want to call a method in the UndergradCourse class, setUnits() method course.setUnits(); but the compiler say cannot find symbol- method setUnit() im pretty sure the problem is the compiler is looking for a method setUnit() in the Course class instead of UndergradCourse class i did this but its not working UndergradCourse course = courses.get(courseCode); results in incompatible type so how can i retrieve undergradCourse object from the hashmap as an undergradCourse object instead of course object? so then i can call a method inside the child class thanks in advance

    Read the article

  • Problem in passing arrays from C# to C++

    - by Rakesh K
    Hi, I have an application in which I need to pass an array from C# to a C++ DLL. What is the best method to do it? I did some search on Internet and figured out that I need to pass the arrays from C# using ref. The code for the same: status = IterateCL(ref input, ref output); The input and output arrays are of length 20. and the corresponding code in C++ DLL is IterateCL(int *&inArray, int *&outArray) This works fine for once. But if I try to call the function from C# in a loop the second time, the input array in C# is showing up as an array of one element. Why is this happening and please help me how I can call this function iteratively from C#. Thanks, Rakesh.

    Read the article

  • How to store and access ajax data in javascript without using global variables ?

    - by mike_t2e
    I may be missing something obvious here, but how could I rewrite this code so that it doesn't need the theVariable to be a global variable ? <script language="javascript"> theVariable = ""; function setValue() /* called on page load */ { /* make ajax call to the server here */ theVariable = "a string of json data waiting to be eval()'d"; } function getValue() { alert(theVariable); } </script> <input type="button" onClick="javascript:getValue()" value="Get the value"> In my actual situation, the setValue function makes an ajax call to the server, receives a json string and the data from that is accessed when you mouseover various parts of the page. I end up using several global variables which works fine, but is messy and I'd like to know if there's a better and more elegant way of doing it ?

    Read the article

  • How to build third party libraries with Android NDK

    - by heiko.witte
    How can I compile third party libraries with the android NDK? I am compiling a wrapper which implements the JNI functions as a shared lib, which depends on another 3rd party lib (HTK). I don't know how to setup the makefile. The following does not work: LOCAL_PATH := $(call my-dir) include $(CLEAR_VARS) include HTKLib/Android.mk LOCAL_PATH := $(call my-dir) include $(CLEAR_VARS) LOCAL_MODULE := gaitfuncs LOCAL_SRC_FILES := gaitfuncs.c %LOCAL_LDLIBS := -L$(SYSROOT)/usr/lib -llog include $(BUILD_SHARED_LIBRARY) The second makefile should then build a static lib which my shared lib links to. How can I include this subdir makefile properly? Is this the correct way of doing it? And as a bonus: Are there wildcards for the LOCAL_SRC_FILES variable to take all files ending in .c for example. Thanks!

    Read the article

  • car and cdr in scheme is driving me crazy ...

    - by kristian Roger
    Hi Im facing a probem with the car and cdr functions for example: first I defined a list caled it x (define x (a (bc) d ( (ef) g ) )) so x now is equal to (a (bc) d ( (ef) g ) now for example I need to get the g from this list using only car and cdr (!! noshortcuts as caddr cddr !!) the correct answer is: (car(cdr(car(cdr(cdr(cdr x)))))) BUT how ? :-( I work according to the rule (the car gives the head of list and cdr gives the tail) and instead of getting the answer above I keep reaching wronge answers can any one help me in understanding this ... give me step or a way to solve it step by step thanx in advance Im really sick of scheme language.

    Read the article

  • Singletons and other design issues

    - by Ahmed Saleh
    I have worked using different languages like C++/Java and currently AS3. Most applications were computer vision, and small 2D computer games. Most companies that I have worked for, they use Singletons in a language like AS3, to retrieve elements or classes in an easy way. Their problem is basically they needs some variables or to call other functions from other classes. In a language like AS3, there is no private constructor, and they write a hacky code to prevent new instances. In Java and C++ I also faced the situation that I need to use other classe's members or to call their functions in different classes. The question is, is there a better or another design, to let other classes interact with each others without using singletons? I feel that composition is the answer, but I need more detailed solutions or design suggestions.

    Read the article

  • car and cdr in Scheme are driving me crazy ...

    - by kristian Roger
    Hi Im facing a problem with the car and cdr functions for example: first I defined a list called it x (define x (a (bc) d ( (ef) g ) )) so x now is equal to (a (bc) d ( (ef) g ) ) now for example I need to get the g from this list using only car and cdr (!! noshortcuts as caddr cddr !!) the correct answer is: (car(cdr(car(cdr(cdr(cdr x)))))) BUT how ? :-( I work according to the rules (the car gives the head of list and cdr gives the tail) and instead of getting the answer above I keep reaching wrong answers. Can any one help me in understanding this ... give me step or a way to solve it step by step Thanks in advance. I'm really sick of Scheme.

    Read the article

  • Limiting the number of threads executing a method at a single time.

    - by Steve_
    We have a situation where we want to limit the number of paralell requests our application can make to its application server. We have potentially 100+ background threads running that will want to at some point make a call to the application server but only want 5 threads to be able to call SendMessage() (or whatever the method will be) at any one time. What is the best way of achieving this? I have considered using some sort of gatekeeper object that blocks threads coming into the method until the number of threads executing in it has dropped below the threshold. Would this be a reasonable solution or am I overlooking the fact that this might be dirty/dangerous? We are developing in C#.NET 3.5. Thanks, Steve

    Read the article

  • Perform Push Segue From a Tab View Controller

    - by user1416492
    I have a Tab Bar Controller App, the tab bar controller is forked into several "tab" view controller, in one of the view controller I want to redirect the user to an other view controller. I create a segue from that tab view controller to the destination view controller and given it an Identifer. And I call "performSegueWithIdentifier" in "viewDidAppear" to redirect the user. It works fine when the segue is "Modal", however since I want to retain the tabs, I want to call the segue through "Push". However, once I change the segue to "Push", it is not working anymore (it does not try to go to the destination view controller). The app did not crash on the simulator but just staying on the origin tab view controller.

    Read the article

  • user notification while waiting

    - by user315445
    I am writing a simple win forms app in C#. There is a method call in my method which loads files but is taking a while to respond. Below is the method call Directory.GetFiles(selectedFolder, "*.xml", SearchOption.AllDirectories); I want to notify this to users. Is there a way to show them that file loading is in progress? I want a simplest way. I suppose Splash screen is too costly for my app.

    Read the article

  • Transliteration API: Is it possible to make all input fields in the page transliteratable?

    - by SolidSnakeGTI
    Hello, I've used "Google AJAX Transliteration API" and it's going well with me. http://code.google.com/apis/ajaxlanguage/documentation/referenceTransliteration.html Currently I've a project that I need all input fields in every page (input & textarea tags) to be transliteratable, while these input fields differs from page to page (dynamic). As I know, I've to call makeTransliteratable(elementIds, opt_options) method in the API call to define which input fields to make transliteratable, and in my case here I can't predefine those fields manually. Is there a way to achieve this? Thanks in advance

    Read the article

< Previous Page | 335 336 337 338 339 340 341 342 343 344 345 346  | Next Page >