Search Results

Search found 9273 results on 371 pages for 'complex strings'.

Page 34/371 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >

  • Which CEP product to start with?

    - by Andreas
    Hi, I want to learn more on how to build CEP based applications. So I looked around and found several products (overview found here: http://rulecore.com/CEPblog/?page_id=47). But as there are quite a few at the moment, I don't know which is the best to start with. And overall I just would consider the one available for free. The rest is a bit to expensive for just private use ;) Esper is for free, but without Esper studio it seems quite tedious to develop a cep app. Streambase offers a free trial, but I couldn't find out how long you can use this (if only for a month, no that helpful for longer research). Oracle CEP suite seems quite complete, but in the cep scene - as far as I can see - it is the least recognized compared to Esper or Streambase. So do you have any hints on what is the best way to start with cep development? Is it worth to spent time on working through the oracle documenation or is it better to start with Esper or Streambase? Cheers, Andreas

    Read the article

  • reading a string with spaces with sscanf

    - by SDLFunTimes
    For a project I'm trying to read an int and a string from a string. The only problem is sscanf appears to break reading an %s when it sees a space. Is there anyway to get around this limitation? Here's an example of what I'm trying to do: #include<stdio.h> #include<stdlib.h> int main(int argc, char** argv) { int age; char* buffer; buffer = malloc(200 * sizeof(char)); sscanf("19 cool kid", "%d %s", &age, buffer); printf("%s is %d years old\n", buffer, age); return 0; } What it prints is: "cool is 19 years old" where I need "cool kid is 19 years old". Does anyone know how to fix this?

    Read the article

  • Create a string with the result of an expression and the expression that originated the value. Is it

    - by Oscar Reyes
    Like String r = SomeThing.toExecString("new Object().toString()"); And when executed the value of r would be: "new Object().toString() = java.lang.Object@c5e3974" Is this even possible at all? Would it need a bunch of reflection? A built in compiler maybe? AFAIK, this is not possible with regular Java. The closest thing I could get is IDE support like in IDEA with the "macro" soutv+tab that prints: Hit taband type the expression The IDE types the rest for you. But that's quite another completely thing.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • help with making a password checker in java

    - by Cheesegraterr
    Hello, I am trying to make a program in Java that checks for three specific inputs. It has to be 1. At least 7 characters. 2. Contain both upper and lower case alphabetic characters. 3. Contain at least 1 digit. So far I have been able to make it check if there is 7 characters, but I am having trouble with the last two. What should I put in my loop as an if statement to check for digits and make it upper and lower case. Any help would be greatly appreciated. Here is what I have so far. import java.awt.*; import java.io.*; import java.util.StringTokenizer; public class passCheck { private static String getStrSys () { String myInput = null; //Store the String that is read in from the command line BufferedReader mySystem; //Buffer to store the input mySystem = new BufferedReader (new InputStreamReader (System.in)); //creates a connection to system input try { myInput = mySystem.readLine (); //reads in data from the console myInput = myInput.trim (); } catch (IOException e) //check { System.out.println ("IOException: " + e); return ""; } return myInput; //return the integer to the main program } //**************************************** //main instructions go here //**************************************** static public void main (String[] args) { String pass; //the words the user inputs String temp = ""; //holds temp info int stringLength; //length of string boolean goodPass = false; System.out.print ("Please enter a password: "); //ask for words pass = getStrSys (); //get words from system temp = pass.toLowerCase (); stringLength = pass.length (); //find length of eveyrthing while (goodPass == false) { if (stringLength < 7) { System.out.println ("Your password must consist of at least 7 characters"); System.out.print ("Please enter a password: "); //ask for words pass = getStrSys (); stringLength = pass.length (); goodPass = false; } else if (something to check for digits) { } }

    Read the article

  • endsWith in javascript

    - by Bobby Kumar
    How can I check if a string ends with a particular character in javascript? example I have a string say var str = "mystring#"; I want to know if that string str is ending with "#". How can I check it? is there a endsWith() method in javascript? one solution I have is take the length of the string and get the last character and check it. Is this the best way or there is any other way?

    Read the article

  • I-Phone: Trying to check an Array for an item based on a string produced

    - by MB
    Hello! I'm writing a program that will concatenate a string based on letters, and then check an array to see if that string exists. If it does, then it will print a line in IB saying so. I've got all the ins-and-outs worked out, save for the fact that the simulator keeps crashing on me! Here's the code: -(IBAction)checkWord:(id)sender { NSMutableArray *wordList = [NSMutableArray arrayWithObjects:@"BIKE", @"BUS", @"BILL", nil]; if([wordList containsObject:theWord]) { NSString *dummyText = [[NSString alloc] initWithFormat:@"%@ is a real word.", theWord]; checkText.text = dummyText; [dummyText release]; } } "theWord" is the string that is being referenced against the Array to see if it matches an item contained within it. In this case "BIKE" is 'theWord'. Thank you for your help in advance! -MB

    Read the article

  • Decoding tcp packets using python

    - by mikip
    Hello I am trying to decode data received over a tcp connection. The packets are small, no more than 100 bytes. However when there is a lot of them I receive some of the the packets joined together. Is there a way to prevent this. I am using python I have tried to separate the packets, my source is below. The packets start with STX byte and end with ETX bytes, the byte following the STX is the packet length, (packet lengths less than 5 are invalid) the checksum is the last bytes before the ETX def decode(data): while True: start = data.find(STX) if start == -1: #no stx in message pkt = '' data = '' break #stx found , next byte is the length pktlen = ord(data[1]) #check message ends in ETX (pktken -1) or checksum invalid if pktlen < 5 or data[pktlen-1] != ETX or checksum_valid(data[start:pktlen]) == False: print "Invalid Pkt" data = data[start+1:] continue else: pkt = data[start:pktlen] data = data[pktlen:] break return data , pkt I use it like this #process reports try: data = sock.recv(256) except: continue else: while data: data, pkt = decode(data) if pkt: process(pkt) Also if there are multiple packets in the data stream, is it best to return the packets as a collection of lists or just return the first packet I am not that familiar with python, only C, is this method OK. Any advice would be most appreciated. Thanks in advance Thanks

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

  • Counting longest occurence of repeated sequence in Python

    - by user248237
    What's the easiest way to count the longest consecutive repeat of a certain character in a string? For example, the longest consecutive repeat of "b" in the following string: my_str = "abcdefgfaabbbffbbbbbbfgbb" would be 6, since other consecutive repeats are shorter (3 and 2, respectively.) How can I do this in Python? thanks.

    Read the article

  • why string is a reference type?

    - by saurabh
    We know that string is a reference type , so we have string s="God is great!"; but on the same note if i declare class say Employee which is a reference type so why below piece of code does not work ? Employee e = "Saurabh"; 2- How do we actually determine if a type is a reference type or value type?

    Read the article

  • Transposing and Untransposing a String in java

    - by Will
    I have been working on two methods that will Transpose and Untranspose a String respectively. The solutions that I have come up with both work to the best of my knowledge. I just want to know if I could have solved these problems in a simpler way. My code seems like it is too long for the task that is being performed. The first method, transpose(), will take a String as a parameter and transpose it. If "bridge" is entered, the output will be "bergid". Likewise, with the unTranspose() method, if the user enters "bergid", the output will be "bridge". public void transpose( String s ) { String t = ""; int end = s.length() - 1; for ( int i = 0; i < s.length() / 2; i++ ) { t += Character.toString( s.charAt( i ) ) + Character.toString( s.charAt( end ) ); end--; } // Lenth of String is odd if ( s.length() % 2 == 1 ) { // add character in middle of String to the end of the new String t+= Character.toString( s.charAt( s.length() / 2 ) ); } System.out.println( t ); } public void unTranspose( String s ) { String t = ""; // Length of String is odd if ( s.length() % 2 == 1 ) { for ( int i = 0; i < s.length(); i+=2 ) { t+= Character.toString( s.charAt( i ) ); } for ( int i = s.length() - 2; i > 0; i -= 2 ) { t += Character.toString( s.charAt( i ) ); } System.out.println( t ); } // Length of String is even else if ( s.length() % 2 == 0 ) { for ( int i = 0; i < s.length() - 1; i+=2 ) { t+= Character.toString( s.charAt( i ) ); } for ( int i = s.length() - 1; i > 0; i -= 2 ) { t+= Character.toString( s.charAt( i ) ); } System.out.println( t ); } } My code looks horrible. I'm still not used to formatting my code correctly. Please bear with me. Thanks for your time

    Read the article

  • split string error in a compiled VB.NET class

    - by Andy Payne
    I'm having some trouble compiling some VB code I wrote to split a string based on a set of predefined delimeters (comma, semicolon, colon, etc). I have successfully written some code that can be loaded inside a custom VB component (I place this code inside a VB.NET component in a plug-in called Grasshopper) and everything works fine. For instance, let's say my incoming string is "123,456". When I feed this string into the VB code I wrote, I get a new list where the first value is "123" and the second value is "456". However, I have been trying to compile this code into it's own class so I can load it inside Grasshopper separately from the standard VB component. When I try to compile this code, it isn't separating the string into a new list with two values. Instead, I get a message that says "System.String []". Do you guys see anything wrong in my compile code? You can find an screenshot image of my problem at the following link: click to see image This is the VB code for the compiled class: Public Class SplitString Inherits GH_Component Public Sub New() MyBase.New("Split String", "Split", "Splits a string based on delimeters", "FireFly", "Serial") End Sub Public Overrides ReadOnly Property ComponentGuid() As System.Guid Get Return New Guid("3205caae-03a8-409d-8778-6b0f8971df52") End Get End Property Protected Overrides ReadOnly Property Internal_Icon_24x24() As System.Drawing.Bitmap Get Return My.Resources.icon_splitstring End Get End Property Protected Overrides Sub RegisterInputParams(ByVal pManager As Grasshopper.Kernel.GH_Component.GH_InputParamManager) pManager.Register_StringParam("String", "S", "Incoming string separated by a delimeter like a comma, semi-colon, colon, or forward slash", False) End Sub Protected Overrides Sub RegisterOutputParams(ByVal pManager As Grasshopper.Kernel.GH_Component.GH_OutputParamManager) pManager.Register_StringParam("Tokenized Output", "O", "Tokenized Output") End Sub Protected Overrides Sub SolveInstance(ByVal DA As Grasshopper.Kernel.IGH_DataAccess) Dim myString As String DA.GetData(0, myString) myString = myString.Replace(",", "|") myString = myString.Replace(":", "|") myString = myString.Replace(";", "|") myString = myString.Replace("/", "|") myString = myString.Replace(")(", "|") myString = myString.Replace("(", String.Empty) myString = myString.Replace(")", String.Empty) Dim parts As String() = myString.Split("|"c) DA.SetData(0, parts) End Sub End Class This is the custom VB code I created inside Grasshopper: Private Sub RunScript(ByVal myString As String, ByRef A As Object) myString = myString.Replace(",", "|") myString = myString.Replace(":", "|") myString = myString.Replace(";", "|") myString = myString.Replace("/", "|") myString = myString.Replace(")(", "|") myString = myString.Replace("(", String.Empty) myString = myString.Replace(")", String.Empty) Dim parts As String() = myString.Split("|"c) A = parts End Sub ' ' End Class

    Read the article

  • How can I determine a file extension given a file path in LaTeX?

    - by Frank
    I am attempting to write a LaTeX package which leverages the minted package's \inputminted command. My \mycommand command takes two parameters, the first being a path to a file, and I want to pass the file's extension to the \inputminted command: \newcommand\mycommand[2]{ \inputminted{#1}{...} } Note that the above won't work since the full path is passed to \inputminted. Example: \mycommand{/path/to/Test.java}{blah} should invoke \inputminted{java}{...}

    Read the article

  • problem with if statement used to determine function return

    - by Patrick
    Im using an if statement to determine what to return in a function, but it seems to be not working the way i want it to. function DoThis($dogs, $cats){ // do something with dogs, pet them perhaps. $reg = $dogs[0]; $nate = $dogs[1]; if($cats = "dave"){return $reg;} if($cats = "tom"){return $nate;} } $cats is a string (if that helps), and when entered it doesn't yield any return. If i manually set a return, that works, but the above doesnt for some reason.

    Read the article

  • Linq duplicate removal with a twist

    - by Danthar
    I got a list that contains al the status items of each order. The problem that i have is that i need to remove all the items of which the status - logdate combination is not the highest. e.g var inputs = new List<StatusItem>(); //note that the 3th id is simply a modifier that adds that amount of secs //to the current datetime, to make testing easier inputs.Add(new StatusItem(123, 30, 1)); inputs.Add(new StatusItem(123, 40, 2)); inputs.Add(new StatusItem(123, 50, 3)); inputs.Add(new StatusItem(123, 40, 4)); inputs.Add(new StatusItem(123, 50, 5)); inputs.Add(new StatusItem(100, 20, 6)); inputs.Add(new StatusItem(100, 30, 7)); inputs.Add(new StatusItem(100, 20, 8)); inputs.Add(new StatusItem(100, 30, 9)); inputs.Add(new StatusItem(100, 40, 10)); inputs.Add(new StatusItem(100, 50, 11)); inputs.Add(new StatusItem(100, 40, 12)); var l = from i in inputs group i by i.internalId into cg select from s in cg group s by s.statusId into sg select sg.OrderByDescending(n => n.date).First() ; This creates a list that returnes me the following: order 123 status 30 date 4/9/2010 6:44:21 PM order 123 status 40 date 4/9/2010 6:44:24 PM order 123 status 50 date 4/9/2010 6:44:25 PM order 100 status 20 date 4/9/2010 6:44:28 PM order 100 status 30 date 4/9/2010 6:44:29 PM order 100 status 40 date 4/9/2010 6:44:32 PM order 100 status 50 date 4/9/2010 6:44:31 PM This is ALMOST correct. However that last line which has status 50 needs to be filtered out as well because it was overruled by status 40 in the historylist. U can tell by the fact that its date is lower then the "last" status-item with the status 40. I was hoping someone could give me some pointers because im stuck.

    Read the article

  • strcasecmp in C returns 156 instead of 0, any ideas why?

    - by hora
    I have the following code: printf("num: %d\n", strcasecmp(buf, "h\n")); And I get the following results when I try plugging in different letters: a: -7 g: -1 i: 1 j: 2 h: 156 H: 156 Should strcasecmp not return 0 when buf is equal to H or h? Any ideas why it's returning 156? I need to figure out how to check whether the user types H or h. Thanks!

    Read the article

  • Simple way to repeat a String in java

    - by e5
    I'm looking for a simple commons method or operator that allows me to repeat some String n times. I know I could write this using a for loop, but I wish to avoid for loops whenever necessary and a simple direct method should exist somewhere. String str = "abc"; String repeated = str.repeat(3); repeated.equals("abcabcabc"); Related to: repeat string javascript Create NSString by repeating another string a given number of times Edited I try to avoid for loops when they are not completely necessary because: They add to the number of lines of code even if they are tucked away in another function. Someone reading my code has to figure out what I am doing in that for loop. Even if it is commented and has meaningful variables names, they still have to make sure it is not doing anything "clever". Programmers love to put clever things in for loops, even if I write it to "only do what it is intended to do", that does not preclude someone coming along and adding some additional clever "fix". They are very often easy to get wrong. For loops that involving indexes tend to generate off by one bugs. For loops often reuse the same variables, increasing the chance of really hard to find scoping bugs. For loops increase the number of places a bug hunter has to look.

    Read the article

  • Help with Arrays in Objective C.

    - by NJTechie
    Problem : Take an integer as input and print out number equivalents of each number from input. I hacked my thoughts to work in this case but I know it is not an efficient solution. For instance : 110 Should give the following o/p : one one zero Could someone throw light on effective usage of Arrays for this problem? #import <Foundation/Foundation.h> int main (int argc, const char * argv[]) { NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; int input, i=0, j,k, checkit; int temp[i]; NSLog(@"Enter an integer :"); scanf("%d", &input); checkit = input; while(input > 0) { temp[i] = input%10; input = input/10; i++; } if(checkit != 0) { for(j=i-1;j>=0;j--) { //NSLog(@" %d", temp[j]); k = temp[j]; //NSLog(@" %d", k); switch (k) { case 0: NSLog(@"zero"); break; case 1: NSLog(@"one"); break; case 2: NSLog(@"two"); break; case 3: NSLog(@"three"); break; case 4: NSLog(@"four"); break; case 5: NSLog(@"five"); break; case 6: NSLog(@"six"); break; case 7: NSLog(@"seven"); break; case 8: NSLog(@"eight"); break; case 9: NSLog(@"nine"); break; default: break; } } } else NSLog(@"zero"); [pool drain]; return 0; }

    Read the article

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >