Search Results

Search found 29111 results on 1165 pages for 'program structure'.

Page 345/1165 | < Previous Page | 341 342 343 344 345 346 347 348 349 350 351 352  | Next Page >

  • Array Related Doubt.......

    - by AGeek
    I have the following program........... int insert(int *array, int arraySize, int newElement) { array[arraySize + 1] = newElement; return (arraySize+1); // Return new Array size...... } int main() { int array[] = {1,2,3,4,5}; int arraySize = sizeof(array) / sizeof(int); insertInArray(array, arraySize,6); print(array); } I am trying to work out this program in C programming language... But when i print the array after insertion,,, it doesn't prints the desired output which is needed.. Please correct me if i am doing something wrong..... Thanks..

    Read the article

  • What kind of string is this? What can I do in php to read it?

    - by kevin
    This is a string (see below, after the dashed line) in a database.inf file for a free program I downloaded that lists some websites. The file is plain text as you can see , but there is a string after it that looks base64 encoded (due to the end chars of ==). But b64_decoding it gives giberish. I wanted to decode it so I could add to the list of sites it had (the program lists a bunch of sites and data about them which I can read in the GUI) and to do that I need to decode this, add to it, and re-encode it. I think the program uses .net since I think the .net library was required on install, but I know nothing of the original source language. I am using php to figure out if there is a simple way to read this. I have tried using unpack, binhex, base_convert, etc as I suspect the file is binary at some level, but I am lost. Nothing illegal, just wanting to know what it is and if I can add a few things to it to make it more useful for me. here is the file - any ideas how to decode and recode this for playing with? Site List file size: 62139 db version: 13 generated: 2010-04-27 11:53:40 eJztPWmT27iVnze/gjVVk56pXXXz1BW3XW2PPXaNr/iIa69SUSIkMaZIhaQstys/fgHwEIiDBEjQk6Q2lUraeuAD8PDwbgAPtkl6eBoZsX8At1enDKRXRvGfL350gj/9uEmBn4MVAqFGP14Z+f0R3FoP//CA+Rb9ddXj26OfZYJ+EeicpEHrt/5V/2/XA75FDTjzlf7WvlL/NgWXnlW/BQc/jPjzxaAfMUzU7+Xr7m+pj7cVZ/C63pa8Iewa/e+299fbMM3yuv8+fa8wCs5Cy/W9EmwLztfU51Eb2SKZoUe9v458gmq9+l4hFDyiS/W9Ei0Z52tO5/W8+VQ3aGwipvcjIRGUMPmnfN8XE40qCFKABSaFpgQg2ggGARtwB9D55SbM77lfIkCxGIIvsxw2460jBrRxwbfwyJdVEFB2eSERTaTstP4r2OQsG+RhHoEfL7+XOGy6d9yObKaKwE/zJo4eCFYNDD0QhJsIXHD0RHAZRV8EzF6WRQCXkU/ECnDBIUSwB37A8oEsgg3kuF2S3rOCtASwCNq1H4ECCYVCuTT4mRlDUwH2QNDUgT1HcFGDfUewIobQjaBVGdIYkMqoV0I8h2gIgqZK7DmCi1bsOYKVcB25CFp1I38djAY6wXqeokg8Enk8qEWSXg0eT4GHGFFPPMk5BmkHn8rgaVoOA+ZVStCaTgPoo2U8eBzD6bNdHUHci38Ycwi14Xk2F0C7aCpZh3Vv1BAQQ1BFUDDdAATk9PsjuBiW/WjQGIUqglPamACBAJpBH9+9JIwFsbkE27GaXhoBXkZiHKoIzmCdhTnH9VBEsKrHoIoAfd0gZB8i8pexAnQpGMhBySndsIKmAnDsJc6GXocJX1RBQJfJViwkgaEfAmIMqgjI0fcbwTo55cINLYOg0BsXPL1GQGrnnkQMQA65hvRWxQgoDAHINlxbBQHS8JiHSUz6nswQiHZXvRCUVGzi4SNpV98NDCoIstPh4BPeR8scWkdA4FFEkOVJo38JBBSGz+AehSWzKwZDBekwe8s5EHj6IVhdMHQioN3AJM5BnHPWocQtsSFXTSTqCPAc1klAhWLUEAyaAmpGzKIfghx87UuDQqYMQFBFNGoMiggu1JcmImP5VpGD8BKW4AcV2udQtV2FZCqAiwCOIQeHYwSBxotfbq/uChTGL362Xyd+GhhRsgtjOzutD2EOO7g+7o9XD//wbw+yI9iEfrRCmB5KffbgpvENxLGN/F328O/P/axo//e7U54U3/z9wU0Bhc0wDNk+D2+4aC/wS+MMpA+DZHM6QIa83oH8aQTQn9nj+9eQVj9BYtd5qZ//2/zfa0ymGhX6usaFsicduOrMC4sLf13j2oZxmO0f3tQzwCKYnEbZAlEYt0HzsvkfkA1g+xTswiyH/gKmVBbu4tOxaNiAXDAXQrpjanW08jI149b4oQzU/fCn/4H/6cRQKRkKB6knJDHhbUahqTaYJApob9IYahNUEgVUDjSKWl/88Kd6ZUoCXygeJDEoludwX466sZQ1nPokSpLPcKtb9UZ7f9psoEeGgi33xtsELm7QRFJ/ATGVDnXRcfmPolsSQjQkMTx8C2IDTb3Z510QoC65X5C8KMVjDSeTomsjlSizPGU+Uhc6ztYmEdWpVbmh6cS2paQXiahIHMlgiVqwRNJYSmpbAkRVGkkGVZHd4eNBCR4ZHDgrxUeB81IyOIr8FB9JkaJCO51mdCTpUSx2s/fjHXhom+Z8YjoT2zKsxdKyl5YHBT3R4A8PbioF/JBWxjdhHICvaKc+Ovo7cIsVBKt8uc10KFs+Xo62rTb+R6g3jZdkM0IkSCpm1GBV8qQ1TC8Tm43GxNfK9YRZZUz+u54VnKrx5pQ3W5NzbqhwipwNjc4o88s/rRrhc5AC4z45GRs/NooGRgzORmUVkEgsrjTmLWsFHGImNPOBPS0FKqJNK3l++FcebRaHxyPIh9kgNTK+QXOxRGRsAGohDlBCwv+XNwb+E9os1eIbe7iv1wBUjNFqEHB+t5vYwqwDj82RdLOJucCSbrq05kvPVJB0aGdf413EdzCoBkLpdhdFydl4/uHVS0LQ8aUbjbGPF1FERAc7EBLuA7Gzy6FDnXpN2JCPHjW2PyN9ur/hOBH4o+Kn1EdbBH8FZc4BHNYgvX0Nzv/+Cv85RHoMkhp15EZsj3du6ktUlyd0UERSWjIUGMpIyCe4w5Pzdf0Zcl6uwzgGKeJQUmKgf0t0IuVHcUSPijlOKuAhpuUlJT3MuMTjoTdaH1ten+2t046vckOsJsF5me/FvRQSWQa+BO0xB19JWcRYT1gLw7KgObw05wp6ohhndiMyhRtwCRuYrxooLH00w8dLdGmgFfu224ptCPpq8NU63ARJp5ynvxkizT8MkebvdQSKnoXsACrDbRuKzDMVGfmRjR2S27+ua+8e61ttgqTC9CSJoZl8GI7wGTK2Xw9XBC/9VjSyeuCpBhXwOEx2qX/cs4b7RVRKSjBvYi8M21ma9tK25SXYVRs2c2nPl46CPCzDgR9SP4CG2iY5CEPzlya9pSL+86afOMQHSLTYydIh9uZwOzx56PxAD+oLgF4PEeSETXcgMKCHIOPiW1WU/qbdEuc04ojkWnxr8Mt1uOVaQvhknq93EL9RwTDYYJfwHzQY1MMVhS4L+G64YkBNH8uhURGmlr10vKXlKpiD5+OkLWhAgnWEDJr4+shB2EyDGDzLRQpsPGI/OEA5eEyyfAIdd4nMITnLR/4Gbe2WIGH970omvit/MJ4lqfFhH2bGe+jfEB+ywlNiE6HxDwsvHjZwowRhDt0cc5iXrsPBLhyYwVJByTlW3IzmdOk6CpuxULjGT2s/MPb5IfqZsyOZNv+61ohena9f4Uhzg2UhT92ZLW1LnhtevH/6y+vrJN2xTFCDdIjkgp6TykjhMwSRrwlj44/G+yJ3clfnTYYkq/TUkGC9KS3W6VkX/nsp6itgPOGVGAiqRZoI+WUjjAR/gpnKuIuNu80mOcU5j7bD5H5lXw6zO1uqRiQjr63WJoFjoG4gTkMNc7oPYRBEYAXdlRxuMArZ9wveQn/z6Mc07SXI3Vq9IV9OMLwQ4JgmX8J401UJ0IkG2i/MOqiVNRz3SUwPQ6KQwf/KlFN8h6i0DneFI117mkn6wvUbNVRKSnaG0qa2Sji8zfnR5flUYptE2Fdf+hqrLv0VZYAV9O7Umit5rVj9a2gVpZ8OrYxYZVC/5/i0wMAITL6KwvgzOgvUP+OUrvApT95oWK0qwPb4/kXw01WIwtXICUueQtfMuvp5UOp0oPLlcmdPiVNwp6geTkHgFIhsHYh0yGR/aKIRSo0NLiUYppb9lZSKUgrmm0vbWbrTVvkbhKkB0d9enc/na0j5z0kcQoZNY5DX8XckH/jgBzel7EBc9PCVn34GeRjvDD8OjAxEEfo7ieH/AeMc5nvDN7KDH0VGkhr75ACM9SmDsAxa1RgBRLRLkl0EHk6ga1b+CX/0I/DVx78Vf1Fh6n2eH5c3N/wh3hQG/Ko04K+Rl94azx6EzVYTpNXlHT3laHFiqVVicUQIyy7uxLQxu7hLh/WJIYswnOIf/G9o5RgeIQFN7rgrIcxau+xSW3PPnBGrrexHE4tIjuimqPMpolXXm+1hQJkUa9KPVy3VyPmozq0jVbRPwfb2Bzib2pCA3z7CLFjWdK7uk1NaQTO51JFokFQ/sjtRFgdr9IiQ1LYQxvD7pqSInI1Ffq9S80WWaykIA2VnXlMllQZfXOOxCP1VCxIGjqQu7yGci0Vfh99Y8dwAUQK6rJV9HH5jZPSUldGeNTOtVhlNSGaRaGgMh3Jo2tPOvbCoq2fUUhzEIoq4ZYodMTZhKEqlCLzExbWAiYsopBENEl8ljuFByQpRq0U+kkWTAT+FLaqAMbT3GhuHBTc3z3sMv0SJqf3jcWwcZ+bNZ90mLdszFd1W0aPKyBR3DK8uqvdJB26FlBJ3D6rdu2tVqTLFf+Eu9vNTyqfIqNxcWSXNQipKC+REDRVPERQ1VlK87E3nU132Oj24MjX6KABZfnvJPP7DJkqFxrrSxIYVeMkd4WodnFSKtxVDnf6lZ6jrYBZzrFL1aFaADoKE6xOK36zIm9V0H9ZqdKTjiAcPr86SturiiGFJxuoEXHk5T3e6UX3REOrVMfLZ6pN2Kfv/FW/aPBRvYs9wScV8abGH5HjqqQyKTzZJmvoRo59YcK2gdFzTgfVZGac3nuA+GCXnsErOtheeaxNaToeiBpUtVoRJGVJw4PppUZmtxhvciUyEbu5NvXkHLSxMCw+Ro5MWMUhqC5QgQfNn/TN/DZK76sSyRFjSsuYzT+OsCb2Zhpu9yFCrYKOtvPEO9iBDAddzGk6/RgJ8gYLGF1GgBo5Ggr+gHmTEgOWac1RHqJUGh/tS5q1PYcQz2XkN9NPi1b1RycXHRT9SFHHMhauTK2r/FP4CNijJsUuioEETcRP9VPml6uJX2IVRY6p+ldk39tS1zREo5KbgmIZxzqUNCRxRabjGu6IfhhAmJ2o4s217JBG69UOhr1vBxhOhz2APDAVsDis4c9ObjkOBLAY5SlqKqEDCR+SI10UvUrLDMq2FTkMCzTZOcnD0g+vySG1FhMvPIxgSBW6ZKU89+B9X85RPx9M6gq4+nNw2acy6AdE/8Y/G2wI/USLbLQ8905nqXvUqDRAleS4OehHg8WTB46ITGW6YzSxzoZkS2xSAKqA7CcAxYWs5+E30U+QZ7OeiMlE/MkRxp/OF9i2Shrt9dT8RQw8aqJ8S71APFSmkbG3L9izdiuLo536cQ1syO0VFRUulGr748JcGTTra6ifRW9whMkFRj/DPzHiBi29wgRXHS+eEomeOO7VnI6lXHG0SKtcaOp5qvUNdyFgZlu0ubO2CxY8i6BsgsxLE4JQijcJSg99mBJpE0VOioxdYvUlQZr5wF7oZBHyrHRJGAVMw/YR4+l+17m3xSni6Z+o4C61uCcrAX2++3dSapRrOxTkRNhlPHSu5apY7s2Y6iUKIiA2I2GgnBRuPDE9gDzI+GnRVLVMnBa7a+xN3ZZmoK9vDZ6ndpSMXXa62G9bpcXIWCmyywXgyGyv+18mZIT2nxtW25wvt7lCtn04b1vChgeOx33vUhYwKt73ZwtYdYSvn+dlPD8IoYw0cjQi/oR6kAkbuwprqjpOgaxn/dgIZMlKuT58pY68BG8O4KzuQmf5s6lnaI+1lOGxSRlJZH4CFj+AGFJ1UcVYZYixmnjOSResHX+AgTqlQLjQajCcb7qpuZMwW6BU5nnYNbU2SYx4ewm/FxZCku9MkTEvDEQhkTd4QvUlEnzuPTggLOFom1nr9Pldnu4YJdba5NNkLolv48VAdIamP2lP82GgwHj/WR1nkMkLWCOGKKvcHcpSXF6YGL+ARs4NFJ1J7E7rf2oMWdRKQVyxAA8cjw19C2UoBbzGf6SZCqZW2JxCBgKECAx2tYuIZ7kKKDObMm+q244LT4RCCbHcKA5Cz0QcWrJ8QH/bwu6If41fUkQwxFtO5N9ettML4S5iFaygW16xRSwP1E+JF1cOrx3cyNHBm5szVLSfzvZ9nh/s43OxZK4YGjsEMsAfj1b3xGvUhRQUbunj6qVBVCp2TNGLlAwc+zsaovv+EupGSElNvrt3TgdMtJeImSWNONojXYByCEIVmsWw9heNYuhkEneGr8htMiJIG6qcEvo2/23jl88fMHKligCkr4cBGsyd+ffPyF5mAtePazlglEwdo2SXHJAo5J3l5LUa0uOt+pIooZtPFQmuMskqKnsG6FAwsSTjwETKm754+NT6BdSU4pOgxm831kwO/5wGCyy1arIXBNhjDysC9iOsLeEkec6rf9IS+FhRcqJA6Cr9A37Ccdp3A4ASUuj8YI8JU9Wq8xN1KyF2e2IF62TV10/Ds7w9ihmKg+qnz6e75q4kSK808z/S66r77yl8/Pol92gt0zEgH6kMmLWTPp+58rMx6GGcoTSJMTxDwEQvXXhS9tGwUHl2mtjt3RmKQjTj0sxk57POEE/HhZSqcETRxHd3yo4M49FUC+RSQfEaOCnRBlHJli97CstpnPZ2YHn4TxFracolLZF9wdASdqhE3G06JZr2WyjaYtO8AdWocQbqF3QuVBQc+fP5vC6RiY4PHDPbcnC/aC+DVpr+FIyZWuTF1DkzDssO2Brn2UpUSpgudM93LTs6NTgJQMD3srjBjG/rl3rRdB6rN+LN/hhPa+2WRLkpskIvNBw+f928l3qp4l5fp4B6AWkxnHcEa9RWvHG6opUAsdMdrqJLCk7CAfsWYZQoTPHPecYpDffKHe7E5TMF0TfzVvUy9GO/Qn23PdS7+8Logc7F00Du0UqT+GzR0w/yeECIsyQVtdJH+zwX6hqiV8kJcqGQcnSqG2Fq1ESEMAjVbfIdCPZYm3GIpx5yJhfGFSWboIkSLvYiWR5Mo8FEEND0USXD6HhgWrJ8aL3+5I/ooeKVinH6uvOWZC7GeJgllzXg3RnLzkX6aRGHsC7cSr8EIWcmyF6XjJ9bUk6LHdOnA/y7kNtN60xkQErQZYUM9ftLvoKJltVXPk5RBkkaOU8opx+DrSShhauB4wuU16kLGk7Es1xbXYJI0gBvGk9M9+LwNMt3F2p7fRJfmwVIEm/nCjcIlxXwxd3UavGQAIzkcw6guNuLGOJpNRqyNvnQk5/qYltgSarCIs/TkBMgO1dhUS4/Ef3JgmUTUSBeb/IrwX8xD2IPxCnYhQ5Pp3LQX7fHi/iZKNQGhhUI2GNFAqb6VqmOeOmJyXHjEW3rO0mZfJuKGz4tLoi8SgrZPeA108canArdSbMRFx5BGchiz2M/Fl2ZcoKOxw3vchSEZM+Pdm7bwxDZ9g0MgbeSkyD5Zr+87DRFhK1288hx10C/hb9mLxdTSHVYqJzspbkAE8Y53246okeaQw+Q9gf93ia0GAByFhggNHOFGDdiDkvvrebOZ3E5xob6Vk6U130+S7UVeMrUx4mYj3jRivNkq2WmOYzVvYGwhkLc0lZIwAeaGA+/EBLeFrs1SvryFK4deg7MwMv099osfJPgCvWr9W1y8tpYjaKKyu74RvelUcl85ztLp3lenz9fr1IcuzBpOoUEbBqKLTR4jrOjGhZ1avmpmubO5tSCPSHPuxmSGfUOvSvN2TJbZqucnoQqXOL9YC5jsGAYg3VCnF/lgQT4A3U143bnLMKInyScleWPPLdsy20vc1XdZvgenzxIJ0JZ2Q0iBqjU//tYv++k4ZmuMrR9BCmue5x83IIJJFxeaZjdtiaBPFR6pU3nzmWe77RuGGRxxhqjaOYUYl9s5tolOEXEekW/XWAnvjCML5l98zL+nhHfZhNes6Zd765W9NJcYEfssWXXK6nd5wrP9XZL2y4TJWcXgXCVuO98pa8fU/oiZyrWuJZks4VMWRq8nKQQof4dXAs9aHgjUgaX7kS2ll60slNCRiLxW70t9jpMz5KIdyKAxSR2Cb2nTlA6Py4a/VQ3f44ZydQPedDZvF5wt42hKzqGPTpVojIFP+BVIylro/pfko3umfchPrzks71Nvn0lcle9NzJlhLZauJVtqhp4P3KWodoI9JULBmvzwEgJ/LYBy94pMZ2YHD3D6pF955L3P0EoGp3ubVLgBfv01TU4x97JNGt4kB6qdM57iFv1MKNtcLOwOc1wwEuFl9TzKWCaijDNbmtLmODSjwm+UFcaC+MbE86KBlH01c8xGgYWSPcEO6FIR1PqM+IfE8IPA8GOj2tX3yck4nLIc9Uq8JqD+QCpu9l2fppcgxiP8rvhtYZJImSIcbMVra1mBb5PfHtNkGyKztvOV8WdhFBnQhTG2IYiCzFgD9EpGnhhVS8M34NgMRKP/QE8lwj8MqAv4T4+rGDz0avS0KzTdY6/nGnuogLZymNTeL8ZCwptDZ03eZ4c0PO8TvsN+gTXFxEe4uJ/27M1lPB9zbi08zjMrtXiwZeQDOZSbR2Fwe2f9k7yCKN7m7JwclX3Nfm7L7uMwRsIyNQKQQ2rUm3kPYmMThZvPxnv0SAu6p+6ev3+5zGfhwjZXJnO82QP/CB3ufZKh+you0WoMKH9NwZcQnOGCfAk3IMNPwAdIeJGcOhRRk62foI/wMbbnxZeqtoDpTht3vHAWf+iI6+W/3EFHvYZVx/snuDgDA7MsTGJJSwOvI8pIdIcvAHqa8pJfICufWVCT1k8x/BIA9nN/7cfs9cs8kYKumeqwudjui5+ouI4KSTx76XbfC4NyLMckiVA86QtcwKbfxoU2CfOphBjobsi3sK2Ur2YvPIvz+KycEcYdVfnQ0z/wm1WcZefPROVVKD6G+lWoYcEbuTd55PW9ZVjmEp1R6t6qB7gF/CrBgxK5IcWaogbUc9m4Ve0r3RXtpG4GXszdRUccVjSGm80unKwhNxbfXB/ZUIKYPlAloepACa86gUvHPj9a/yqIWJ+Pk64gPYFCppoRDn/Bf2Sx4XTXWNEQsHtwc4T6QylW2cAhGaWsDIF3lemPCq7yfQgNCUgIeYsBBcWK67bkEgto2ML8Pw1ssi2CKpUAefa0+W6SYA3obrtixmI29dylK0cHaz6fC+lAA5t0QFAxHXinR1zT7q1XeOMpUwVFOLCPasm/5vrSBRBZ/4wBMzXqVVJuyFO0ERlk9WYs0PR/fjD/WgVhBwQ8v+aDIq9oDDix1x1T70Cj5b1AiKd8t7DjOcOBb/DBflqyIj3zNfwN0DMswt8APUMbENkmidXwyXBO63PpJVRyrvskBtSTjlIfbv2vVz0+Qwqxz3eohNyP7zlrLPW5jlcbEZulNBLZwR/Y9IqiXWstzfnSlCuKq+RmmEV+LKy2JsACS67weIyf1n5gIKn7c+fVCxij1LGvKXTQzPZLsvtUeE0Ofp6GX5mS6gZk6HSDySuMS+qiuOl0Pm2/B6zH8eow9uMNmFTpxknksxekixo1LaBnRSujSowad3FgvPTPxrsydymXFlvYjt0W1ey0i0Sj/ad0u1snVHrfjx5J20JCVC1uuHIqWUcmWefjxZIPLEtiwy8h63gHuXgGufsRZDG6D/6uwBhu07p4pUzBfwrjIDlf1x+uk+D+OoxjkCLUSqNmu7GVumlO6V/q8WVfT9ZqLYdG6QFmdNBsaUkeVi1PXYYb4YHMAqRHvUNkMlX+C2vutFSx91Ts8b3Qw6dgVAI/vlc6VOzC0VtOd5yD6vQGWt3tfq6CfyoWVTKlXoWxSYtNpeqbwt5Ex+3V7M3yeWvBre8EmFtkofJytTdz3Mapq9LeuItQ5g7JLNLgaK9wJMZF1+nwIlbKirVd7SgsibN0F7LnUMEXkN4HvnjX8BpQGSmqhdx9g1OnsS4C0vN6V01BFbLSlKNHtkmSY/U0SpMSTVCTBu8R7M+yD55YrjdrXvAhmH6zy5tqAyhTwF3ai6Ut9zgDCj5P3JCdPwmgiuPevPlt4r74IBcgXkwtTtmT0o4kh0JHDwfuRa7Jtg3TLP/RKP6BaChjhHAxyZofG5+R7fAnsEvSe5kYRF/7nAk+qZnkjKWjZjpvWkKcCvIPcru3tLtLefAVQGeQsamr+tcmn/8Z/Sz18LU7h//t3t91P9+jOgHSxYHaWu4Ki3wPinOxRSEdTSAW3KQUOl1TnHs18I2+UifoZ47tSKSO2L6pkmmV/JGLLn2xJF/USsEhBOnlEBJtwPAaNOnytmiheHDc9UyZvCave/pATrvx2UKluaxF4Uw9oTFBwZq0gUCVU2kLy5pyMmyEHpEPKlHjujkkwQn9jeo90Uhu0bnU1d1mk5zQK16/71Ed1HzVP/vWOdfiKO6qPoErGXxSouEfkyMqycVTHxKTyvBzo6qGs0pEAl08qz8XpS8RhblBR8BDxFY9Ax8NdLbmCAiSSTN8SlnpPohjmgjvpKpgXJfzLQTKnbA2p5wjgn28zWo8OGKQnOOBdi2bkqIO3LTustO6Mj5XvVJrKG6ozb2doVsNJC9IIa929ONA9BikuBmVBFG9yXEOdZQpcYhWPIBKga+qEq5BbLD1/Q1vCfu7ORgjV/4o+TsYzaDUQoFhUEwMo1hHp5T1Y+jziyrcOlc80ZztEyg9henYGsqPjj1HYKnaV3QxokQQgukXiaQoxAXX1352fARlw61m0SRf2kI4qPRZ3MvCK62XN1tacqGSKs+2D3f7CL9YQHsE3Bb8k6bG86qNzOKhBzssicXjDgDfkDBpOgRDAtFf83LrGkbPzYtQ7IEfQJYaXKG0Gn5MFSJZ36NgbwdjyiDCQrVL5sqNCbOkEJOkwEaICnnNrJaSxEZ4tJZA1c3RAkKyHPRgxYZoU0ooV+asypv2VqLKHgUBM8e3RIoiDv8H/FOXyg==

    Read the article

  • How do you stop Eclipse from inserting a certain class in Content-Assist?

    - by fletchgqc.mp
    I'm using SpringSource Tool Suite (Eclipse) to program with Grails, and I'm also using JFreechart in the program. In Grails you log by typing log.info("method worked"). Unfortunately JFrechart has a class called "Log" with Static methods like "info". This means that in STS I type log.info and then when I type space or ( Eclipse "assists" me by importing the JFreechart Log class and changing what I've typed to Log.info(message). Very irritating. I reckon I could turn off the Eclipse option to "insert single proposals automatically", but I like this feature. Can I instruct Eclipse not to give me content assist from this particular JFreechart class?

    Read the article

  • Force to reimplement a static function in inherit classes

    - by pacopepe
    Hi, I have a program in C++ with plugins (dynamic libs). In the main program, I want to execute a static function to check if i can create a object of this type. An example without dynamic libs (aren't neccesary to understand the problem): #include "libs/parent.h" #include "libs/one.h" #include "libs/two.h" int main(int argc, char * argv[]) { Parent obj; if (One.match(argv[1])) { obj = new One(); else if (Two.match(argv[1])) { obj = new Two(); } Now, i have a interface class named Parent. All plugins inherit from this class. Ideally, I have a virtual static function in Parent named match, and all the plugins need to reimplement this function. The problem with this code is that i can't do a static virtual function in C++, so i don't know how to solve the problem. Sorry for mi english, i did my best

    Read the article

  • Fastest way to move records from an Oracle database into SQL Server

    - by user347748
    Ok this is the scenario... I have a table in Oracle that acts like a queue... A VB.net program reads the queue and calls a stored proc in SQL Server that processes and then inserts the message into another SQL Server table and then deletes the record from the oracle table. We use a DataReader to read the records from Oracle and then call the stored proc for each of the records. The program seems to be a little slow. The stored procedure itself isn't slow. The SP by itself when called in a loop can process about 2000 records in 20 seconds. But when called from the .Net program, the execution time is about 5 records per second. I have seen that most of the time consumed is in calling the stored procedure and waiting for it to return. Is there a better way of doing this? Here is a snippet of the actual code Function StartDataXfer() As Boolean Dim status As Boolean = False Try SqlConn.Open() OraConn.Open() c.ErrorLog(Now.ToString & "--Going to Get the messages from oracle", 1) If GetMsgsFromOracle() Then c.ErrorLog(Now.ToString & "--Got messages from oracle", 1) If ProcessMessages() Then c.ErrorLog(Now.ToString & "--Finished Processing all messages in the queue", 0) status = True Else c.ErrorLog(Now.ToString & "--Failed to Process all messages in the queue", 0) status = False End If Else status = True End If StartDataXfer = status Catch ex As Exception Finally SqlConn.Close() OraConn.Close() End Try End Function Private Function GetMsgsFromOracle() As Boolean Try OraDataAdapter = New OleDb.OleDbDataAdapter OraDataTable = New System.Data.DataTable OraSelCmd = New OleDb.OleDbCommand GetMsgsFromOracle = False With OraSelCmd .CommandType = CommandType.Text .Connection = OraConn .CommandText = GetMsgSql End With OraDataAdapter.SelectCommand = OraSelCmd OraDataAdapter.Fill(OraDataTable) If OraDataTable.Rows.Count > 0 Then GetMsgsFromOracle = True End If Catch ex As Exception GetMsgsFromOracle = False End Try End Function Private Function ProcessMessages() As Boolean Try ProcessMessages = False PrepareSQLInsert() PrepOraDel() i = 0 Dim Method As Integer Dim OraDataRow As DataRow c.ErrorLog(Now.ToString & "--Going to call message sending procedure", 2) For Each OraDataRow In OraDataTable.Rows With OraDataRow Method = GetMethod(.Item(0)) SQLInsCmd.Parameters("RelLifeTime").Value = c.RelLifetime SQLInsCmd.Parameters("Param1").Value = Nothing SQLInsCmd.Parameters("ID").Value = GenerateTransactionID() ' Nothing SQLInsCmd.Parameters("UID").Value = Nothing SQLInsCmd.Parameters("Param").Value = Nothing SQLInsCmd.Parameters("Credit").Value = 0 SQLInsCmd.ExecuteNonQuery() 'check the return value If SQLInsCmd.Parameters("ReturnValue").Value = 1 And SQLInsCmd.Parameters("OutPutParam").Value = 0 Then 'success 'delete the input record from the source table once it is logged c.ErrorLog(Now.ToString & "--Moved record successfully", 2) OraDataAdapter.DeleteCommand.Parameters("P(0)").Value = OraDataRow.Item(6) OraDataAdapter.DeleteCommand.ExecuteNonQuery() c.ErrorLog(Now.ToString & "--Deleted record successfully", 2) OraDataAdapter.Update(OraDataTable) c.ErrorLog(Now.ToString & "--Committed record successfully", 2) i = i + 1 Else 'failure c.ErrorLog(Now.ToString & "--Failed to exec: " & c.DestIns & "Status: " & SQLInsCmd.Parameters("OutPutParam").Value & " and TrackId: " & SQLInsCmd.Parameters("TrackID").Value.ToString, 0) End If If File.Exists("stop.txt") Then c.ErrorLog(Now.ToString & "--Stop File Found", 1) 'ProcessMessages = True 'Exit Function Exit For End If End With Next OraDataAdapter.Update(OraDataTable) c.ErrorLog(Now.ToString & "--Updated Oracle Table", 1) c.ErrorLog(Now.ToString & "--Moved " & i & " records from Oracle to SQL Table", 1) ProcessMessages = True Catch ex As Exception ProcessMessages = False c.ErrorLog(Now.ToString & "--MoveMsgsToSQL: " & ex.Message, 0) Finally OraDataTable.Clear() OraDataTable.Dispose() OraDataAdapter.Dispose() OraDelCmd.Dispose() OraDelCmd = Nothing OraSelCmd = Nothing OraDataTable = Nothing OraDataAdapter = Nothing End Try End Function Public Function GenerateTransactionID() As Int64 Dim SeqNo As Int64 Dim qry As String Dim SqlTransCmd As New OleDb.OleDbCommand qry = " select seqno from StoreSeqNo" SqlTransCmd.CommandType = CommandType.Text SqlTransCmd.Connection = SqlConn SqlTransCmd.CommandText = qry SeqNo = SqlTransCmd.ExecuteScalar If SeqNo > 2147483647 Then qry = "update StoreSeqNo set seqno=1" SqlTransCmd.CommandText = qry SqlTransCmd.ExecuteNonQuery() GenerateTransactionID = 1 Else qry = "update StoreSeqNo set seqno=" & SeqNo + 1 SqlTransCmd.CommandText = qry SqlTransCmd.ExecuteNonQuery() GenerateTransactionID = SeqNo End If End Function Private Function PrepareSQLInsert() As Boolean 'function to prepare the insert statement for the insert into the SQL stmt using 'the sql procedure SMSProcessAndDispatch Try Dim dr As DataRow SQLInsCmd = New OleDb.OleDbCommand With SQLInsCmd .CommandType = CommandType.StoredProcedure .Connection = SqlConn .CommandText = SQLInsProc .Parameters.Add("ReturnValue", OleDb.OleDbType.Integer) .Parameters("ReturnValue").Direction = ParameterDirection.ReturnValue .Parameters.Add("OutPutParam", OleDb.OleDbType.Integer) .Parameters("OutPutParam").Direction = ParameterDirection.Output .Parameters.Add("TrackID", OleDb.OleDbType.VarChar, 70) .Parameters.Add("RelLifeTime", OleDb.OleDbType.TinyInt) .Parameters("RelLifeTime").Direction = ParameterDirection.Input .Parameters.Add("Param1", OleDb.OleDbType.VarChar, 160) .Parameters("Param1").Direction = ParameterDirection.Input .Parameters.Add("TransID", OleDb.OleDbType.VarChar, 70) .Parameters("TransID").Direction = ParameterDirection.Input .Parameters.Add("UID", OleDb.OleDbType.VarChar, 20) .Parameters("UID").Direction = ParameterDirection.Input .Parameters.Add("Param", OleDb.OleDbType.VarChar, 160) .Parameters("Param").Direction = ParameterDirection.Input .Parameters.Add("CheckCredit", OleDb.OleDbType.Integer) .Parameters("CheckCredit").Direction = ParameterDirection.Input .Prepare() End With Catch ex As Exception c.ErrorLog(Now.ToString & "--PrepareSQLInsert: " & ex.Message) End Try End Function Private Function PrepOraDel() As Boolean OraDelCmd = New OleDb.OleDbCommand Try PrepOraDel = False With OraDelCmd .CommandType = CommandType.Text .Connection = OraConn .CommandText = DelSrcSQL .Parameters.Add("P(0)", OleDb.OleDbType.VarChar, 160) 'RowID .Parameters("P(0)").Direction = ParameterDirection.Input .Prepare() End With OraDataAdapter.DeleteCommand = OraDelCmd PrepOraDel = True Catch ex As Exception PrepOraDel = False End Try End Function WHat i would like to know is, if there is anyway to speed up this program? Any ideas/suggestions would be highly appreciated... Regardss, Chetan

    Read the article

  • Using libraries with different licenses (CPOL + LGPL)

    - by jaens
    I'm developing a program that will be published on my university's website. In this program I use two libraries, one under the LGPL and one under the CPOL (link text). I plan on releasing the complete source code, libraries included (without modification). Do those licenses clash? What do I have to do to "fix" it? Do I have to do anything in particular (put text in source code files, put references in documentation...)? Thanks in advance.

    Read the article

  • Highest value datatype can store in c#

    - by user472832
    I am writing a small program for my assignment to find the primitive roots of a prime number. So far, the program works for smaller prime numbers till 13 and gives correct number of roots. But for higher primes numbers, it is showing only fewer primitive roots. And now i got stuck for the prime number 41, shows no primitive roots for it. I used DOUBLE datatype for the calculation, and again tried with the datatype DECIMAL, but no luck. Does anyone know about this kind of problem??? Thank you.

    Read the article

  • C# Console Application Output to .csv file

    - by Zinn
    I am trying to make a program that will show the numbers: 1, 10 +30 2, 40 (the scale goes up in this pattern by adding 20 to the last number added) 3, 90 +50 4, 160 5, 250 +70 So far I have this code: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO;// namespace Myloop { class Program { static void Main(string[] args) /// </summary> { StreamWriter myOutputStream = new StreamWriter("loopdata.csv"); int forloop; for (forloop = 1; forloop < 21; forloop++) Console.WriteLine(forloop); Console.ReadLine(); myOutputStream.Close(); } } } This is showing the first sequence of numbers 1 - 20, but could anyone give me any guidance how to do the other sequence next to it in the console application and how I can output these to a .csv file, as the information I have so far doesn't appear in the .csv file

    Read the article

  • C#, working with files, "Unauthorized Access"?

    - by Rob
    Hi, I'm learning about opening and saving files with C# and it seems that vista won't let my program save to a file on the root of C:\ , unless I run it in administrator mode. Any ideas how to allow my program to play around with whatever files it wants? Thanks! string name; private void button2_Click(object sender, EventArgs e) ///// OPEN ///// { if (openFileDialog1.ShowDialog() == DialogResult.OK) { name = openFileDialog1.FileName; textBox1.Clear(); textBox1.Text = File.ReadAllText(name); textBox2.Text = name; } } private void button1_Click(object sender, EventArgs e) ///// SAVE ///// { File.WriteAllText(name, textBox1.Text); }

    Read the article

  • How can I find out how much memory an instance of a C++ class consumes?

    - by Shadow
    Hi, I am developing a Graph-class, based on boost-graph-library. A Graph-object contains a boost-graph, so to say an adjacency_list, and a map. When monitoring the total memory usage of my program, it consumes quite a lot (checked with pmap). Now, I would like to know, how much of the memory is exactly consumed by a filled object of this Graph-class? With filled I mean when the adjacency_list is full of vertices and edges. I found out, that using sizeof() doesn't bring me far. Using valgrind is also not an alternative as there is quite some memory allocation done previously and this makes the usage of valgrind impractical for this purpose. I'm also not interested in what other parts of the program cost in memory, I want to focus on one single object. Thank you.

    Read the article

  • In .NET Xml Serialization, is it possible to serialize a class with an enum property with different

    - by Lasse V. Karlsen
    I have a class, containing a list property, where the list contains objects that has an enum property. When I serialize this, it looks like this: <?xml version="1.0" encoding="ibm850"?> <test> <events> <test-event type="changing" /> <test-event type="changed" /> </events> </test> Is it possible, through attributes, or similar, to get the Xml to look like this? <?xml version="1.0" encoding="ibm850"?> <test> <events> <changing /> <changed /> </events> </test> Basically, use the property value of the enum as a way to determine the tag-name? Is using a class hierarchy (ie. creating subclasses instead of using the property value) the only way? Edit: After testing, it seems even a class-hierarchy won't actually work. If there is a way to structure the classes to get the output I want, even with sub-classes, that is also an acceptable answer. Here's a sample program that will output the above Xml (remember to hit Ctrl+F5 to run in Visual Studio, otherwise the program window will close immediately): using System; using System.Collections.Generic; using System.Xml.Serialization; namespace ConsoleApplication18 { public enum TestEventTypes { [XmlEnum("changing")] Changing, [XmlEnum("changed")] Changed } [XmlType("test-event")] public class TestEvent { [XmlAttribute("type")] public TestEventTypes Type { get; set; } } [XmlType("test")] public class Test { private List<TestEvent> _Events = new List<TestEvent>(); [XmlArray("events")] public List<TestEvent> Events { get { return _Events; } } } class Program { static void Main(string[] args) { Test test = new Test(); test.Events.Add(new TestEvent { Type = TestEventTypes.Changing }); test.Events.Add(new TestEvent { Type = TestEventTypes.Changed }); XmlSerializer serializer = new XmlSerializer(typeof(Test)); XmlSerializerNamespaces ns = new XmlSerializerNamespaces(); ns.Add("", ""); serializer.Serialize(Console.Out, test, ns); } } }

    Read the article

  • Execute a line in a text file

    - by apophis
    Hi I have a program that reads text files filled with code designed to be executed line by line by the program, like a script file. The problem is that I don't no how to do the line executing part. Here is my code, I thought using the \r would fool the console. But it just shows me a list of lines in the file. if (tok[0] == "read" && length == 2) { try { StreamReader tr = new StreamReader(@"C:\Users\Public\"+tok[1]+".txt"); while (!tr.EndOfStream) { Console.WriteLine(tr.ReadLine()); } } catch { Console.WriteLine("No such text file.\n"); } Prompt(); If I knew what to search for to fix my problem in Google, I would have. But I've got no idea. Thanks

    Read the article

  • how to find which libraries to link to? or, how can I create *-config (such as sdl-config, llvm-con

    - by numeric
    Hey, I want to write a program that outputs a list of libraries that I should link to given source code (or object) files (for C or C++ programs). In *nix, there are useful tools such as sdl-config and llvm-config. But, I want my program to work on Windows, too. Usage: get-library-names -l /path/to/lib a.cpp b.cpp c.cpp d.obj Then, get-library-names would get a list of function names that are invoked from a.cpp, b.cpp, c.cpp, and d.obj. And, it'll search all library files in /path/to/lib directory and list libraries that are needed to link properly. Is there such tool already written? Is it not trivial to write a such tool? How do you find what libraries you should link to? Thanks.

    Read the article

  • soft stoppped working

    - by Jack Morton
    this is might be really weird, but I have no idea what kinda wizardry of this. Basically, my Visual Studio stopped responding to my changes, it stopped building solution. I can comment code, which would completely ruin the logic of program, and Visual Studio will still run program that I guess it has in memory. It's really annoying, and I have no idea what it is. I keep restarting software, but it's still does the same. It's a licensed software. I was wondering If someone knew what was going on. Thanks!

    Read the article

  • Python: How to quit CLI when stuck in blocking raw_input?

    - by christianschluchter
    I have a GUI program which should also be controllable via CLI (for monitoring). The CLI is implemented in a while loop using raw_input. If I quit the program via a GUI close button, it hangs in raw_input and does not quit until it gets an input. How can I immediately abort raw_input without entering an input? I run it on WinXP but I want it to be platform independent, it should also work within Eclipse since it is a developer tool. Python version is 2.6. I searched stackoverflow for hours and I know there are many answers to that topic, but is there really no platform independent solution to have a non-blocking CLI reader? If not, what would be the best way to overcome this problem? Thanks

    Read the article

  • Ruby on Rails: Modules vs. Classes

    - by Jack
    I'm trying to add a function that will be accessible throughout all parts of my program. I want something like: def GlobalFunctions.my_function(x,y) puts x + y end to be accessible for all models. Specifically I am trying to use a function like this in my seeds.rb file but I am most likely going to be reusing the code and don't want any redundancy. Now I know I can make a simple class, but I could also make a module. What are some reasons to go in either direction? And once I've decided on which type to use, how do I make it accessible throughout the whole program? I have tried a module, but I keep getting " Expected app/[module file] to define [ModuleName]"

    Read the article

  • problem with exporting a customized form from dll

    - by mavric
    I'm working on an application so i have write an dll which contain a form with some additional work and methods. so in the beginning of my program the thread launch this form (from my dll) to get some informations and then hide it and initialize some components and the application form and then show it. when the thread come the line where it define new instance of the exported form "MyForm inputform = new MyForm();" it throw an Exception called "Top-level control cannot be added to a control." so i don't know what to do ?!!. i tried to take the code of the form from the dll source code and put it in the main program and it works.... .but still i want to know what happen and what impede my application from run that form from my dll. thanks.

    Read the article

  • Boost Shared Pointers and Memory Management

    - by Izza
    I began using boost rather recently and am impressed by the functionality and APIs provided. In using boost::shared_ptr, when I check the program with Valgrind, I found a considerable number of "Still reachable" memory leaks. As per the documentation of Valgrind, these are not a problem. However, since I used to use the standard C++ library only, I always made sure that any program written is completely free from memory leaks. My question is, are these memory leaks something to worry about? I tried using reset(), however it only decrements the reference count, doesn't deallocate memory. Can I safely ignore these, or any way to forcibly deallocate the memory allocated by boost::shared_ptr? Thank you.

    Read the article

  • Count Clicks in excel

    - by rockbala
    Hi, Can some one recommend any free program which counts the number of clicks Clicked inside a cell. For Example Imagine something like Spreadsheet I click on A1 cell the value shows 1 Then I click A1 cell again the value shows 2 and so on If I click A3 cell somewhere in between the click count on Cell A3 shows 1 and so on If something like this can be achieved as a macro with in excel (2003 please) please suggest or any other free program that you might be aware about, please do let me know. I appreciate all your help and thank you in advance. rockbala

    Read the article

  • input tags with array

    - by Dumbledore of flash
    Hi , Recently i am doing a project in which i encountered a strange problem this is the program which previous programmer did MPAN <input name="mpan[]" id="mpan[]" value="" maxlength="2" size="2" > ///this one to read <input name="mpan[]" id="mpan[]" value="" maxlength="3" size="3"> <input name="mpan[]" id="mpan[]" value="" maxlength="3" size="3"> <input name="mpan[]" id="mpan[]" value="" maxlength="2" size="2"> ///this one to read <input name="mpan[]" id="mpan[]" value="" maxlength="11" size="12"> i have to read it from a javascript what i did 1) document.getElementById("mpan").value == not reading script does not work 2) document.getElementById("mpan[]").value == reading first one 3) document.getElementById("mpan[0]").value == script does not work 4) document.getElementById("mpan[3]").value == script does not work can any body tell me how to read this from a javascript program

    Read the article

  • What's this UI pattern called?

    - by Bears will eat you
    I'm trying to figure out what this sort of thing is called, and eventually how I can create one in a web browser. It looks like this (screenshot of the first app that came to mind): The specific component/pattern I'm looking for is the two list boxes ("Included Gear" and "Excluded Gear") that represent inclusion/exclusion of items from a set. I'm not really looking for the WPF name (if there is one) but it might be helpful. I am looking for the name of this thingy, if there is one, and if you really want to make my day, you can point me toward a jQuery or YUI way of making one of these dealies in a browser. In case you were wondering, the screenshot is a World of Warcraft gear optimization program. Go figure why it was the first program that came to mind when I was trying to think of an example.

    Read the article

  • unittest in python: ignore an import from the code I want to test

    - by vaidab
    I have a python program that imports pythoncom (and uses pythoncom.CoCreateInstance from it). I want to create a unittest for the program logic without it importing pythoncom (so I can run the test on Linux as well). What options are there? Can I do it without modifying the system under test? What I found so far: sys.modules["pythoncom"] = "test" import module_that_imports_pythoncom My problem with it is if I have: from pythoncom.something import something I'll get: ImportError: No module named something.something And sys.modules["something.something"] or sys.modules["pythoncom.something.something"] doesn't work. Any ideas?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Make a USB Device, Control It In Java

    - by yar
    I'm thinking about making a physical controller (device?) with knobs, buttons, and LEDs. I'd like to interact with it using Java (respond to the knobs, light up LEDs, etc). The reason I mention Java is two-fold: first, I know Java well1. Second, I've written the rest of the program I need to interface with in Java (though there are ways to talk to the Java program from another language). I would like the device to connect via USB and be (computer-)platform independent. I haven't the slightest idea of where to start, except to start reading the Arduino website. Is this my best/only option? Is there something better suited for communicating with Java? Note: I know that Arduino has something to do with Java (not sure what), but it seems like code must be written in a subset of C. How would I get moving on this topic? 1 - No laughter, please.

    Read the article

< Previous Page | 341 342 343 344 345 346 347 348 349 350 351 352  | Next Page >