Search Results

Search found 9335 results on 374 pages for 'extension modules'.

Page 346/374 | < Previous Page | 342 343 344 345 346 347 348 349 350 351 352 353  | Next Page >

  • Large File Download - Connection With Server Reset

    - by daveywc
    I have an asp.net website that allows the user to download largish files - 30mb to about 60mb. Sometimes the download works fine but often it fails at some varying point before the download finishes with the message saying that the connection with the server was reset. Originally I was simply using Server.TransmitFile but after reading up a bit I am now using the code posted below. I am also setting the Server.ScriptTimeout value to 3600 in the Page_Init event. private void DownloadFile(string fname, bool forceDownload) { string path = MapPath(fname); string name = Path.GetFileName(path); string ext = Path.GetExtension(path); string type = ""; // set known types based on file extension if (ext != null) { switch (ext.ToLower()) { case ".mp3": type = "audio/mpeg"; break; case ".htm": case ".html": type = "text/HTML"; break; case ".txt": type = "text/plain"; break; case ".doc": case ".rtf": type = "Application/msword"; break; } } if (forceDownload) { Response.AppendHeader("content-disposition", "attachment; filename=" + name.Replace(" ", "_")); } if (type != "") { Response.ContentType = type; } else { Response.ContentType = "application/x-msdownload"; } System.IO.Stream iStream = null; // Buffer to read 10K bytes in chunk: byte[] buffer = new Byte[10000]; // Length of the file: int length; // Total bytes to read: long dataToRead; try { // Open the file. iStream = new System.IO.FileStream(path, System.IO.FileMode.Open, System.IO.FileAccess.Read, System.IO.FileShare.Read); // Total bytes to read: dataToRead = iStream.Length; //Response.ContentType = "application/octet-stream"; //Response.AddHeader("Content-Disposition", "attachment; filename=" + filename); // Read the bytes. while (dataToRead > 0) { // Verify that the client is connected. if (Response.IsClientConnected) { // Read the data in buffer. length = iStream.Read(buffer, 0, 10000); // Write the data to the current output stream. Response.OutputStream.Write(buffer, 0, length); // Flush the data to the HTML output. Response.Flush(); buffer = new Byte[10000]; dataToRead = dataToRead - length; } else { //prevent infinite loop if user disconnects dataToRead = -1; } } } catch (Exception ex) { // Trap the error, if any. Response.Write("Error : " + ex.Message); } finally { if (iStream != null) { //Close the file. iStream.Close(); } Response.Close(); } }

    Read the article

  • Clojure vars and Java static methods

    - by j-g-faustus
    I'm a few days into learning Clojure and are having some teething problems, so I'm asking for advice. I'm trying to store a Java class in a Clojure var and call its static methods, but it doesn't work. Example: user=> (. java.lang.reflect.Modifier isPrivate 1) false user=> (def jmod java.lang.reflect.Modifier) #'user/jmod user=> (. jmod isPrivate 1) java.lang.IllegalArgumentException: No matching method found: isPrivate for class java.lang.Class (NO_SOURCE_FILE:0) at clojure.lang.Compiler.eval(Compiler.java:4543) From the exception it looks like the runtime expects a var to hold an object, so it calls .getClass() to get the class and looks up the method using reflection. In this case the var already holds a class, so .getClass() returns java.lang.Class and the method lookup obviously fails. Is there some way around this, other than writing my own macro? In the general case I'd like to have either an object or a class in a varible and call the appropriate methods on it - duck typing for static methods as well as for instance methods. In this specific case I'd just like a shorter name for java.lang.reflect.Modifier, an alias if you wish. I know about import, but looking for something more general, like the Clojure namespace alias but for Java classes. Are there other mechanisms for doing this? Edit: Maybe I'm just confused about the calling conventions here. I thought the Lisp (and by extension Clojure) model was to evaluate all arguments and call the first element in the list as a function. In this case (= jmod java.lang.reflect.Modifier) returns true, and (.getName jmod) and (.getName java.lang.reflect.Modifier) both return the same string. So the variable and the class name clearly evaluate to the same thing, but they still cannot be called in the same fashion. What's going on here? Edit 2 Answering my second question (what is happening here), the Clojure doc says that If the first operand is a symbol that resolves to a class name, the access is considered to be to a static member of the named class... Otherwise it is presumed to be an instance member http://clojure.org/java_interop under "The Dot special form" "Resolving to a class name" is apparently not the same as "evaluating to something that resolves to a class name", so what I am trying to do here is something the dot special form does not support.

    Read the article

  • Code golf - hex to (raw) binary conversion

    - by Alnitak
    In response to this question asking about hex to (raw) binary conversion, a comment suggested that it could be solved in "5-10 lines of C, or any other language." I'm sure that for (some) scripting languages that could be achieved, and would like to see how. Can we prove that comment true, for C, too? NB: this doesn't mean hex to ASCII binary - specifically the output should be a raw octet stream corresponding to the input ASCII hex. Also, the input parser should skip/ignore white space. edit (by Brian Campbell) May I propose the following rules, for consistency? Feel free to edit or delete these if you don't think these are helpful, but I think that since there has been some discussion of how certain cases should work, some clarification would be helpful. The program must read from stdin and write to stdout (we could also allow reading from and writing to files passed in on the command line, but I can't imagine that would be shorter in any language than stdin and stdout) The program must use only packages included with your base, standard language distribution. In the case of C/C++, this means their respective standard libraries, and not POSIX. The program must compile or run without any special options passed to the compiler or interpreter (so, 'gcc myprog.c' or 'python myprog.py' or 'ruby myprog.rb' are OK, while 'ruby -rscanf myprog.rb' is not allowed; requiring/importing modules counts against your character count). The program should read integer bytes represented by pairs of adjacent hexadecimal digits (upper, lower, or mixed case), optionally separated by whitespace, and write the corresponding bytes to output. Each pair of hexadecimal digits is written with most significant nibble first. The behavior of the program on invalid input (characters besides [a-fA-F \t\r\n], spaces separating the two characters in an individual byte, an odd number of hex digits in the input) is undefined; any behavior (other than actively damaging the user's computer or something) on bad input is acceptable (throwing an error, stopping output, ignoring bad characters, treating a single character as the value of one byte, are all OK) The program may write no additional bytes to output. Code is scored by fewest total bytes in the source file. (Or, if we wanted to be more true to the original challenge, the score would be based on lowest number of lines of code; I would impose an 80 character limit per line in that case, since otherwise you'd get a bunch of ties for 1 line).

    Read the article

  • ASP.NET Application Level vs. Session Level and Global.asax...confused

    - by contactmatt
    The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

    Read the article

  • PHP miniwebsever file download

    - by snikolov
    $httpsock = @socket_create_listen("9090"); if (!$httpsock) { print "Socket creation failed!\n"; exit; } while (1) { $client = socket_accept($httpsock); $input = trim(socket_read ($client, 4096)); $input = explode(" ", $input); $input = $input[1]; $fileinfo = pathinfo($input); switch ($fileinfo['extension']) { default: $mime = "text/html"; } if ($input == "/") { $input = "index.html"; } $input = ".$input"; if (file_exists($input) && is_readable($input)) { echo "Serving $input\n"; $contents = file_get_contents($input); $output = "HTTP/1.0 200 OK\r\nServer: APatchyServer\r\nConnection: close\r\nContent-Type: $mime\r\n\r\n$contents"; } else { //$contents = "The file you requested doesn't exist. Sorry!"; //$output = "HTTP/1.0 404 OBJECT NOT FOUND\r\nServer: BabyHTTP\r\nConnection: close\r\nContent-Type: text/html\r\n\r\n$contents"; function openfile() { $filename = "a.pl"; $file = fopen($filename, 'r'); $filesize = filesize($filename); $buffer = fread($file, $filesize); $array = array("Output"=$buffer,"filesize"=$filesize,"filename"=$filename); return $array; } $send = openfile(); $file = $send['filename']; $filesize = $send['filesize']; $output = 'HTTP/1.0 200 OK\r\n'; $output .= "Content-type: application/octet-stream\r\n"; $output .= 'Content-Disposition: attachment; filename="'.$file.'"\r\n'; $output .= "Content-Length:$filesize\r\n"; $output .= "Accept-Ranges: bytes\r\n"; $output .= "Cache-Control: private\n\n"; $output .= $send['Output']; $output .= "Content-Transfer-Encoding: binary"; $output .= "Connection: Keep-Alive\r\n"; } socket_write($client, $output); socket_close ($client); } socket_close ($httpsock); Hello, I am snikolov i am creating a miniwebserver with php and i would like to know how i can send the client a file to download with his browser such as firefox or internet explore i am sending a file to the user to download via sockets, but the cleint is not getting the filename and the information to download can you please help me here,if i declare the file again i get this error in my server Fatal error: Cannot redeclare openfile() (previously declared in C:\User s\fsfdsf\sfdsfsdf\httpd.php:31) in C:\Users\hfghfgh\hfghg\httpd.php on li ne 29, if its possible, i would like to know if the webserver can show much banwdidth the user request via sockets, perl has the same option as php but its more hardcore than php i dont understand much about perl, i even saw that a miniwebserver can show much the client user pulls from the server would it be possible that you can assist me with this coding, i much aprreciate it thank you guys.

    Read the article

  • CMake: Mac OS X: ld: unknown option: -soname

    - by Alex Ivasyuv
    I try to build my app with CMake on Mac OS X, I get the following error: Linking CXX shared library libsml.so ld: unknown option: -soname collect2: ld returned 1 exit status make[2]: *** [libsml.so] Error 1 make[1]: *** [CMakeFiles/sml.dir/all] Error 2 make: *** [all] Error 2 This is strange, as Mac has .dylib extension instead of .so. There's my CMakeLists.txt: cmake_minimum_required(VERSION 2.6) PROJECT (SilentMedia) SET(SourcePath src/libsml) IF (DEFINED OSS) SET(OSS_src ${SourcePath}/Media/Audio/SoundSystem/OSS/DSP/DSP.cpp ${SourcePath}/Media/Audio/SoundSystem/OSS/Mixer/Mixer.cpp ) ENDIF(DEFINED OSS) IF (DEFINED ALSA) SET(ALSA_src ${SourcePath}/Media/Audio/SoundSystem/ALSA/DSP/DSP.cpp ${SourcePath}/Media/Audio/SoundSystem/ALSA/Mixer/Mixer.cpp ) ENDIF(DEFINED ALSA) SET(SilentMedia_src ${SourcePath}/Utils/Base64/Base64.cpp ${SourcePath}/Utils/String/String.cpp ${SourcePath}/Utils/Random/Random.cpp ${SourcePath}/Media/Container/FileLoader.cpp ${SourcePath}/Media/Container/OGG/OGG.cpp ${SourcePath}/Media/PlayList/XSPF/XSPF.cpp ${SourcePath}/Media/PlayList/XSPF/libXSPF.cpp ${SourcePath}/Media/PlayList/PlayList.cpp ${OSS_src} ${ALSA_src} ${SourcePath}/Media/Audio/Audio.cpp ${SourcePath}/Media/Audio/AudioInfo.cpp ${SourcePath}/Media/Audio/AudioProxy.cpp ${SourcePath}/Media/Audio/SoundSystem/SoundSystem.cpp ${SourcePath}/Media/Audio/SoundSystem/libao/AO.cpp ${SourcePath}/Media/Audio/Codec/WAV/WAV.cpp ${SourcePath}/Media/Audio/Codec/Vorbis/Vorbis.cpp ${SourcePath}/Media/Audio/Codec/WavPack/WavPack.cpp ${SourcePath}/Media/Audio/Codec/FLAC/FLAC.cpp ) SET(SilentMedia_LINKED_LIBRARY sml vorbisfile FLAC++ wavpack ao #asound boost_thread-mt boost_filesystem-mt xspf gtest ) INCLUDE_DIRECTORIES( /usr/include /usr/local/include /usr/include/c++/4.4 /Users/alex/Downloads/boost_1_45_0 ${SilentMedia_SOURCE_DIR}/src ${SilentMedia_SOURCE_DIR}/${SourcePath} ) #link_directories( # /usr/lib # /usr/local/lib # /Users/alex/Downloads/boost_1_45_0/stage/lib #) IF(LibraryType STREQUAL "static") ADD_LIBRARY(sml-static STATIC ${SilentMedia_src}) # rename library from libsml-static.a => libsml.a SET_TARGET_PROPERTIES(sml-static PROPERTIES OUTPUT_NAME "sml") SET_TARGET_PROPERTIES(sml-static PROPERTIES CLEAN_DIRECT_OUTPUT 1) ELSEIF(LibraryType STREQUAL "shared") ADD_LIBRARY(sml SHARED ${SilentMedia_src}) # change compile optimization/debug flags # -Werror -pedantic IF(BuildType STREQUAL "Debug") SET_TARGET_PROPERTIES(sml PROPERTIES COMPILE_FLAGS "-pipe -Wall -W -ggdb") ELSEIF(BuildType STREQUAL "Release") SET_TARGET_PROPERTIES(sml PROPERTIES COMPILE_FLAGS "-pipe -Wall -W -O3 -fomit-frame-pointer") ENDIF() SET_TARGET_PROPERTIES(sml PROPERTIES CLEAN_DIRECT_OUTPUT 1) ENDIF() ### TEST ### IF(Test STREQUAL "true") ADD_EXECUTABLE (bin/TestXSPF ${SourcePath}/Test/Media/PlayLists/XSPF/TestXSPF.cpp) TARGET_LINK_LIBRARIES (bin/TestXSPF ${SilentMedia_LINKED_LIBRARY}) ADD_EXECUTABLE (bin/test1 ${SourcePath}/Test/test.cpp) TARGET_LINK_LIBRARIES (bin/test1 ${SilentMedia_LINKED_LIBRARY}) ADD_EXECUTABLE (bin/TestFileLoader ${SourcePath}/Test/Media/Container/FileLoader/TestFileLoader.cpp) TARGET_LINK_LIBRARIES (bin/TestFileLoader ${SilentMedia_LINKED_LIBRARY}) ADD_EXECUTABLE (bin/testMixer ${SourcePath}/Test/testMixer.cpp) TARGET_LINK_LIBRARIES (bin/testMixer ${SilentMedia_LINKED_LIBRARY}) ENDIF (Test STREQUAL "true") ### TEST ### ADD_CUSTOM_TARGET(doc COMMAND doxygen ${SilentMedia_SOURCE_DIR}/doc/Doxyfile) There was no error on Linux. Build process: cmake -D BuildType=Debug -D LibraryType=shared . make I found, that incorrect command generate in CMakeFiles/sml.dir/link.txt. But why, as the goal of CMake is cross-platforming.. How to fix it?

    Read the article

  • Myself throwing NullReferenceException... needs help

    - by Amit Ranjan
    I know it might be a weird question and its Title too, but i need your help. I am a .net dev , working on platform for the last 1.5 years. I am bit confused on the term usually we say " A Good Programmer ". I dont know ,what are the qualities of a good programmer ? Is the guy who writes a bug free code? or Can develop applications solely? or blah blah blah...lots of points. I dont know... But as far i am concerned , I know I am not a good programmer, still in learning phase an needs a lot to learn in coming days. So you guys are requested to please help me with this two problems of mine My first problem is regarding the proper Error Handling, which is a most debatable aspect of programming. We all know we use ` try { } catch { } finally { } ` in our code to manage exception. But even if I use try { } catch(exception ex) { throw ex } finally { } , different guys have different views. I still dont know the good way to handle errors. I can write code, use try-catch but still i feel I lacks something. When I saw the codes generated by .net fx tools even they uses throw ex or `throw new Exception("this is my exception")`.. I am just wondering what will be the best way to achieve the above. All means the same thing but why we avoid something. If it has some demerits then it must be made obselete.Anyways I still dont have one [how to handle errors efficiently?]. I generally follow the try-catch(execoption ex){throw ex}, and usually got stucked in debates with leads why you follow this why not that... 2.Converting your entire code blocks in modules using Design patterns of some OOPs concepts. How do you guys decide what architeture or pattern will be the best for my upcoming application based on its working, flow etc. I need to know what you guys can see that I can't. Since I know , I dont have that much experience but I can say, with my experience that experience doesnot comes either from degree/certificates or success you made instead it cames from failures you faced or got stucking situations. Pleas help me out.

    Read the article

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • How to perform add/update of a model object that contains EntitySet

    - by David Liddle
    I have a similar concept to the SO questions/tags scenario however am trying to decide the best way of implementation. Tables Questions, QuestionTags and Tags Questions QuestionTags Tags --------- ------------ ---- QID QID TID QName TID TName When adding/updating a question I have 2 textboxes. The important part is a single textbox that allows users to enter in multiple Tags separated by spaces. I am using Linq2Sql so the Questions model has an EntitySet of QuestionTags with then link to Tags. My question is regarding the adding/updating of Questions (part 1), and also how to best show QuestionTags for a Question (part 2). Part 1 Before performing an add/update, my service layer needs to deal with 3 scenarios before passing to their respective repositories. Insert Tags that do not already exist Insert/Update Question Insert QuestionTags - when updating need to remove existing QuestionTags Here is my code below however started to get into a bit of a muddle. I've created extension methods on my repositories to get Tags WithNames etc. public void Add(Question q, string tags) { var tagList = tags.Split(new string[] { " " }, StringSplitOptions.RemoveEmptyEntries).ToList(); using (DB.TransactionScope ts = new DB.TransactionScope()) { var existingTags = TagsRepository.Get() .WithName(tagList) .ToList(); var newTags = (from t in tagList select new Tag { TName = t }).Except(existingTags, new TagsComparer()).ToList(); TagsRepository.Add(newTags); //need to insert QuestionTags QuestionsRepository.Add(q); ts.Complete(); } } Part 2 My second question is, when displaying a list of Questions how is it best to show their QuestionTags? For example, I have an Index view that shows a list of Questions in a table. One of the columns shows an image and when the user hovers over it shows the list of Tags. My current implementation is to create a custom ViewModel and show a List of QuestionIndexViewModel in the View. QuestionIndexViewModel { Question Question { get; set; } string Tags { get; set; } } However, this seems a bit clumsy and quite a few DB calls. public ViewResult Index() { var model= new List<QuestionIndexViewModel>(); //make a call to get a list of questions //foreach question make a call to get their QuestionTags, //to be able to get their Tag names and then join them //to form a single string. return View(model); } Also, just for test purposes using SQL Profiler, I decided to iterate through the QuestionTags entity set of a Question in my ViewModel however nothing was picked up in Profiler? What would be the reason for this?

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • Problem updating through LINQtoSQL in MVC application using StructureMap, Repository Pattern and UoW

    - by matt
    I have an ASP MVC application using LINQ to SQL for data access. I am trying to use the Repository and Unit of Work patterns, with a service layer consuming the repositories and unit of work. I am experiencing a problem when attempting to perform updates on a particular repository. My application architecture is as follows: My service class: public class MyService { private IRepositoryA _RepositoryA; private IRepositoryB _RepositoryB; private IUnitOfWork _unitOfWork; public MyService(IRepositoryA ARepositoryA, IRepositoryB ARepositoryB, IUnitOfWork AUnitOfWork) { _unitOfWork = AUnitOfWork; _RepositoryA = ARepositoryA; _RepositoryB = ARepositoryB; } public PerformActionOnObject(Guid AID) { MyObject obj = _RepositoryA.GetRecords() .WithID(AID); obj.SomeProperty = "Changed to new value"; _RepositoryA.UpdateRecord(obj); _unitOfWork.Save(); } } Repository interface: public interface IRepositoryA { IQueryable<MyObject> GetRecords(); UpdateRecord(MyObject obj); } Repository LINQtoSQL implementation: public class LINQtoSQLRepositoryA : IRepositoryA { private MyDataContext _DBContext; public LINQtoSQLRepositoryA(IUnitOfWork AUnitOfWork) { _DBConext = AUnitOfWork as MyDataContext; } public IQueryable<MyObject> GetRecords() { return from records in _DBContext.MyTable select new MyObject { ID = records.ID, SomeProperty = records.SomeProperty } } public bool UpdateRecord(MyObject AObj) { MyTableRecord record = (from u in _DB.MyTable where u.ID == AObj.ID select u).SingleOrDefault(); if (record == null) { return false; } record.SomeProperty = AObj.SomePropery; return true; } } Unit of work interface: public interface IUnitOfWork { void Save(); } Unit of work implemented in data context extension. public partial class MyDataContext : DataContext, IUnitOfWork { public void Save() { SubmitChanges(); } } StructureMap registry: public class DataServiceRegistry : Registry { public DataServiceRegistry() { // Unit of work For<IUnitOfWork>() .HttpContextScoped() .TheDefault.Is.ConstructedBy(() => new MyDataContext()); // RepositoryA For<IRepositoryA>() .Singleton() .Use<LINQtoSQLRepositoryA>(); // RepositoryB For<IRepositoryB>() .Singleton() .Use<LINQtoSQLRepositoryB>(); } } My problem is that when I call PerformActionOnObject on my service object, the update never fires any SQL. I think this is because the datacontext in the UnitofWork object is different to the one in RepositoryA where the data is changed. So when the service calls Save() on it's IUnitOfWork, the underlying datacontext does not have any updated data so no update SQL is fired. Is there something I've done wrong in the StrutureMap registry setup? Or is there a more fundamental problem with the design? Many thanks.

    Read the article

  • jquery 1.4.1 breaks my slideshow

    - by JMC Creative
    After toying with the jquery slideshow extension, I created my own that better suited my purposes ( I didn't like that all the images needed to load at the beginning for instance). Now, upon upgrading to jQuery 1.4.2 (I know I'm late), the slideshow loads the first image fine ( from the line$('div#slideshow img#ssone').fadeIn(1500); towards the bottom), but doesn't do anything beyond that. Does anyone have any idea which jquery construct is killing my script? The live page is at lplonline.org which is using 1.3.2 for the time being. Thanks in advance. Array.prototype.random = function( r ) { var i = 0, l = this.length; if( !r ) { r = this.length; } else if( r > 0 ) { r = r % l; } else { i = r; r = l + r % l; } return this[ Math.floor( r * Math.random() - i ) ]; }; jQuery(function($){ var imgArr = new Array(); imgArr[1] = "wp-content/uploads/rotator/Brbrshop4-hrmnywkshp72006.jpg"; imgArr[2] = "wp-content/uploads/rotator/IMGA0125.JPG"; //etc, etc, about 30 of these are created dynamically from a db function randImgs () { var randImg = imgArr.random(); var img1 = $('div#slideshow img#ssone'); var img2 = $('div#slideshow img#sstwo'); if(img1.is(':visible') ) { img2.fadeIn(1500); img1.fadeOut(1500,function() { img1.attr({src : randImg}); }); } else { img1.fadeIn(1500); img2.fadeOut(1500,function() { img2.attr({src : randImg}); }); } } setInterval(randImgs,9000); // 9 SECONDS $('div#slideshow img#ssone').fadeIn(1500); }); </script> <div id="slideshow"> <img id="ssone" style="display:none;" src="wp-content/uploads/rotator/quote-investments.png" alt="" /> <img id="sstwo" style="display:none;" src="wp-content/uploads/rotator/quote-drugs.png" alt="" /> </div>

    Read the article

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • Is "Systems Designer" the job title that best describes what I do? [closed]

    - by ivo-rossi
    After having worked as Java developer for almost 3 years in the same company that I currently work at, I moved to a new position associated with the development of the same application. I’m in this new position for more than 1 year now. My official job title is Systems Designer, but I’m not sure this is a title that expresses well what I do. So my question here is what would be the most appropriate job title for me? I see this question as important for my career development. After all, I should be able to explain in one word what I do. And it’s no longer “Java Developer”. Well, in more than one word, this is what I do: The business analysts gather requirements / business problems to be solved with the clients and then discuss these requirements with me. Given the requirements, I design the high level solutions to be implemented in our system (e.g. a new screen on the client application, modifications to existing reports, extension to the XML export format of some objects, etc). I base my decision on the current capabilities of the system, the overall impact that the solutions would have on the system and the estimated effort to implement them (as I was a developer of this same application for almost 3 years before I moved to this position, I’m confident in my estimates). The solutions are discussed iteratively with the business analysts until we agree that they are good. The outcome of this analysis is what we call the “requirements design” document, which is written by me, shared with clients for approval and then also with the team that is going to implement the solutions and test them. Note that there are a few problems that I need to find a solution for that are non-functional. If the users are unhappy with the performance of a certain tool, I will investigate what can be done to speed it up. I will do some research – often based in the Java code itself - to identify possibilities of optimizations. But in this new position I no longer code, the main outcome of my work is really the “requirements design”. Is “Systems Designer” really the most appropriate job title?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Using ImageMagick to create an image from a PDF...efficiently

    - by bigsweater
    I'm using ImageMagick to create a tiny JPG thumbnail image of an already-uploaded PDF. The code works fine. It's a WordPress widget, though this isn't necessarily WordPress specific. I'm unfamiliar with ImageMagick, so I was hoping somebody could tell me if this looks terrible or isn't following some best practices of some sort, or if I'm risking crashing the server. My questions, specifically, are: Is that image cached, or does the server have to re-generate the image every time somebody views the page? If it isn't cached, what's the best way to make sure the server doesn't have to regenerate the thumbnail? I tried to create a separate folder (/thumbs) for ImageMagick to put all the images in, instead of cluttering up the WP upload folders with images of PDFs. It kept throwing a permission error, despite 777 permissions on the folder in my testing environment. Why? Do the source/destination directories have to be the same? Am I doing anything incorrectly/inefficiently here that needs to be improved? The whole widget is on Pastebin: http://pastebin.com/WnSTEDm7 Relevant code: <?php if ( $url ) { $pdf = $url; $info = pathinfo($pdf); $filename = basename($pdf,'.'.$info['extension']); $uploads = wp_upload_dir(); $file_path = str_replace( $uploads['baseurl'], $uploads['basedir'], $url ); $dest_path = str_replace( '.pdf', '.jpg', $file_path ); $dest_url = str_replace( '.pdf', '.jpg', $pdf ); exec("convert \"{$file_path}[0]\" -colorspace RGB -geometry 60 $dest_path"); ?> <div class="entry"> <div class="widgetImg"> <p><a href="<?php echo $url; ?>" title="<?php echo $filename; ?>"><?php echo "<img src='".$dest_url."' alt='".$filename."' class='blueBorder' />"; ?></a></p> </div> <div class="widgetText"> <?php echo wpautop( $desc ); ?> <p><a class="downloadLink" href="<?php echo $url; ?>" title="<?php echo $filename; ?>">Download</a></p> </div> </div> <?php } ?> As you can see, the widget grabs whatever PDF is attached to the current page being viewed, creates an image of the first page of the PDF, stores it, then links to it in HTML. Thanks for any and all help!

    Read the article

  • Custom onsynctopreference for XUL textbox

    - by Alexey Romanov
    I wanted to enable custom shortcuts in my Firefox extension. The idea is that the user just focuses on a textbox, presses key combination, and it's shown in the textbox and saved to a preference. However, I couldn't get it to work. With this XUL <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <?xml-stylesheet href="chrome://mozapps/skin/pref/pref.css" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://nextplease/locale/nextplease.dtd"> <prefwindow id="nextpleaseprefs" title="&options.title;" buttons="accept, cancel" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <prefpane id="nextplease.general" label="&options.general.title;" image="chrome://nextplease/skin/Sound Mixer.png"> <preferences> <preference id="nextkey" name="nextplease.nextkey" type="int"/> </preferences> <vbox flex="1"> <hbox align="center"> <label value="&options.general.nextKey;" /> <textbox id="nextkey" flex="1" editable="false" onkeyup="return nextplease.handleKeySelection(this, event);" preference-editable="true" preference="nextkey" onsynctopreference="alert('syncing'); return nextplease.syncKeySelector(this);"/> </hbox> </vbox> </prefpane> <script type="application/x-javascript" src="chrome://nextplease/content/nextpleaseCommon.js" /> <script type="application/x-javascript" src="chrome://nextplease/content/nextpleaseOptions.js" /> </prefwindow> the event in onkeyup works. But when I click the OK button, I don't see a "syncing" alert. Why isn't onsynctopreference working? Is it impossible to have custom onsynctopreference attribute for a textbox?

    Read the article

  • how to use window.onload?

    - by Patrick
    I'm refactoring a website using MVC. What was a set of huge pages with javascript, php, html etc etc is becoming a series of controllers and views. I'm trying to do it in a modular way so views are split in 'modules' that I can reuse in other pages when needed eg. "view/searchform displays only one div with the searchform "view/display_events displays a list of events and so on. One of the old pages was supposed to load a google map with a marker on it. Amongst the rest of the code, I can identify the relevant bits as follows <head> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=blablabla" type="text/javascript"></script> <script type="text/javascript"> //<![CDATA[ function load() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map")); var point = new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>); map.setCenter(new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>), 15); map.addControl(new GLargeMapControl()); map.addControl(new GScaleControl()); map.addOverlay(new GMarker(point)); var marker = createMarker(point,GIcon(),"CIAO"); map.addOverlay(marker); } } //]]> </script> </head> ...then <body onload="load()" onunload="GUnload()"> ...and finally this div where the map should be displayed <div id="map" style="width: 440px; height: 300px"> </div> Don't know much about js, but my understanding is that a) I have to include the scripts in the view module I'm writing (directly in the HTML? I would prefer to load a separate script) b) I have to trigger that function using the equivalent of body onload... (obviously there's no body tag in my view. In my ignorance I've tried div onload=.... but didn't seem to be working :) What do you suggest I do? I've read about window.onload but don't know what's the correct syntax for that. please keep in mind that other parts of the page include other js functions (eg, google adsense) that are called after the footer.

    Read the article

  • Wordpress installed in root folder, subdomain now not working, GoDaddy host

    - by Kristin
    Hi, please forgive me for being a complete beginner at this, I'd rather not have to try to deal with this myself but as GoDaddy support have not replied after 2 days I'm going to have to. I think my problem is the same as the one above, but I'm not 100% sure, so I'm reposting it, I'm not really confident enough to attempt to try the fixes I've seen here so I need someone to give me baby instructions? Our original website (www.mwpics.com.au) was built in Dreamweaver etc, recently we created a new website in Wordpress, in a subdomain, then migrated it over to the root folder where it is now operating fine. I also moved the files for the old website into another directory which I called 'old', so they're all still there. The problem is that I have a subdomain set up - which is still showing as set up in the control panel on godaddy the url is www.mwpics.com.au/clients and it is at www.clients.mwpics.com.au. This directory contains loads of other directories, each of which is password protected by .htaccess files and which our clients access directly (not through the site) to download their finished work. The test one and the one for random clients is www.mwpics.com.au/clients/temp - username and password both temp (the usernames are all the same as the directory names). Since the WP install to the root directory the /clients extension no longer works (it should bring up an information page which is an .html index page in the directory) and the /clients/name extensions no longer works - it goes back to the wp site with a 'not found' error message. Strangely it does bring up the box for the username and password, but when you enter it it just goes back to the 'not found' message. Someone told me it was the .htaccess file - so as an experiment, I renamed the .htaccess file in the root directory and then copied the .htaccess file from the old root files into the root directory, eureka! It worked - and also the WP site opened to the home page... but bummer - the /pages in the WP site now no longer worked! But at least I know the source of the problem. So I switched it back and this is the status quo - I have no idea how to fix this, and with everyone back at work tomorrow, clients are going to want to start downloading their stuff... Can anyone help me? I'm starting to panic a bit

    Read the article

  • how to register the app to open the pdf file in my app in ipad

    - by uttam
    i want to open the pdf file in my app from pdf page, but i am not getting any option of opening the pdf in my app. this my info.plist file <key>CFBundleDevelopmentRegion</key> <string>English</string> <key>CFBundleDocumentTypes</key> <array> <dict> <key>CFBundleTypeName</key> <string>PDF</string> <key>CFBundleTypeRole</key> <string>Viewer</string> <key>CFBundleTypeIconFiles</key> <string>Icon.png</string> <key>LSItemContentTypes</key> <string>com.neosofttech.pdf</string> <key>LSHandlerRank</key> <string>Owner</string> </dict> </array> <key>UTExportedTypeDeclarations</key> <array> <dict> <key>UTTypeConformsTo</key> <array> <string>public.pdf</string> </array> <key>UTTypeDescription</key> <string>PDFReader File</string> <key>UTTypeIdentifier</key> <string>com.neosofttech.pdf</string> <key>UTTypeTagSpecification</key> <dict> <key>public.filename-extension</key> <string>pdf</string> </dict> </dict> pls tell me where i am wrong in this, how can i open the pdf file in my app.

    Read the article

  • [c++] upload image to imageshack

    - by cinek1lol
    Hi! I would like to send pictures via a program written in C + +. - OK WinExec("C:\\curl\\curl.exe -H Expect: -F \"fileupload=@C:\\curl\\ok.jpg\" -F \"xml=yes\" -# \"http://www.imageshack.us/index.php\" -o data.txt -A \"Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.8.1.1) Gecko/20061204 Firefox/2.0.0.1\" -e \"http://www.imageshack.us\"", NULL); It works, but I would like to send the pictures from pre-loaded carrier to a variable char (you know what I mean? First off, I load the pictures into a variable and then send the variable), cause now I have to specify the path of the picture on a disk. I wanted to write this program in c++ by using the curl library, not through exe. extension. I have also found such a program (which has been modified by me a bit) #include <stdio.h> #include <string.h> #include <iostream> #include <curl/curl.h> #include <curl/types.h> #include <curl/easy.h> int main(int argc, char *argv[]) { CURL *curl; CURLcode res; struct curl_httppost *formpost=NULL; struct curl_httppost *lastptr=NULL; struct curl_slist *headerlist=NULL; static const char buf[] = "Expect:"; curl_global_init(CURL_GLOBAL_ALL); /* Fill in the file upload field */ curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "send", CURLFORM_FILE, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "nowy.jpg", CURLFORM_COPYCONTENTS, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "submit", CURLFORM_COPYCONTENTS, "send", CURLFORM_END); curl = curl_easy_init(); headerlist = curl_slist_append(headerlist, buf); if(curl) { curl_easy_setopt(curl, CURLOPT_URL, "http://www.imageshack.us/index.php"); if ( (argc == 2) && (!strcmp(argv[1], "xml=yes")) ) curl_easy_setopt(curl, CURLOPT_HTTPHEADER, headerlist); curl_easy_setopt(curl, CURLOPT_HTTPPOST, formpost); res = curl_easy_perform(curl); curl_easy_cleanup(curl); curl_formfree(formpost); curl_slist_free_all (headerlist); } system("pause"); return 0; }

    Read the article

  • mod_rewrite not working for a specific directory

    - by punkish
    This has got me completely foxed for a couple of days now, and I am convinced that I will look stupid once I solve it, but will be even stupider if I don't ask for help now. I have mod_rewrite working successfully on my localhost (no vhosts involved; this is my laptop, my development machine), and I use .htaccess in various directories to help rewrite crufty URLs to clean ones. EXCEPT... it doesn't work in one directory. Since it is impossible to reproduce my entire laptop in this question, I provide the following details. In my httpd.conf, I have mod_rewrite.so loaded. LoadModule rewrite_module modules/mod_rewrite.so In my httpd.conf, I have included another conf file like so Include /usr/local/apache2/conf/other/punkish.conf In my punkish.conf, I have directories defined like so DocumentRoot "/Users/punkish/Sites" <Directory "/Users/punkish/Sites"> Options ExecCGI AllowOverride None Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/one"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/two"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> In ~/Sites/one I have the following .htaccess file RewriteEngine On RewriteBase /one/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, everything works just fine. However, in my directory ~/Sites/two I have the following .htaccess file RewriteEngine On RewriteBase /two/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, nothing works. Nada. Zip. Zilch. I just get a 404. I have determined that mod_rewrite is not even looking at my ~/Sites/two/.htaccess by putting spurious commands in it and not getting any error other than 404. Another confounding issue -- I have turned on RewriteLog in my httpd.conf with RewriteLogLevel 3, but my rewrite_log is completely empty. I know this is hard to trouble shoot unless sitting physically at the computer in question, but I hope someone can give me some indication as to what is going on. **Update: ** There are no aliases involved anywhere. This is my laptop, and everything is under the above stated Document Root, so I just access each directory as http://localhost/. Yes, typos are a big possibility (I did say that I will look stupid once I solve it, however, for now, I have not discovered a single typo anywhere, and yes, I have restarted Apache about a dozen times now. I even thought that perhaps I had two different Apaches running, but no, I have only one, the one under /usr/local/apache2, and I installed it myself a while back.

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

  • How to interpret kernel panics?

    - by Owen
    Hi all, I'm new to linux kernel and could barely understand how to debug kernel panics. I have this error below and I don't know where in the C code should I start checking. I was thinking maybe I could echo what functions are being called so I could check where in the code is this null pointer dereferenced. What print function should I use ? How do you interpret the error message below? Unable to handle kernel NULL pointer dereference at virtual address 0000000d pgd = c7bdc000 [0000000d] *pgd=4785f031, *pte=00000000, *ppte=00000000 Internal error: Oops: 17 [#1] PREEMPT Modules linked in: bcm5892_secdom_fw(P) bcm5892_lcd snd_bcm5892 msr bcm5892_sci bcm589x_ohci_p12 bcm5892_skeypad hx_decoder(P) pinnacle hx_memalloc(P) bcm_udc_dwc scsi_mod g_serial sd_mod usb_storage CPU: 0 Tainted: P (2.6.27.39-WR3.0.2ax_standard #1) PC is at __kmalloc+0x70/0xdc LR is at __kmalloc+0x48/0xdc pc : [c0098cc8] lr : [c0098ca0] psr: 20000093 sp : c7a9fd50 ip : c03a4378 fp : c7a9fd7c r10: bf0708b4 r9 : c7a9e000 r8 : 00000040 r7 : bf06d03c r6 : 00000020 r5 : a0000093 r4 : 0000000d r3 : 00000000 r2 : 00000094 r1 : 00000020 r0 : c03a4378 Flags: nzCv IRQs off FIQs on Mode SVC_32 ISA ARM Segment user Control: 00c5387d Table: 47bdc008 DAC: 00000015 Process sh (pid: 1088, stack limit = 0xc7a9e260) Stack: (0xc7a9fd50 to 0xc7aa0000) fd40: c7a6a1d0 00000020 c7a9fd7c c7ba8fc0 fd60: 00000040 c7a6a1d0 00000020 c71598c0 c7a9fd9c c7a9fd80 bf06d03c c0098c64 fd80: c71598c0 00000003 c7a6a1d0 bf06c83c c7a9fdbc c7a9fda0 bf06d098 bf06d008 fda0: c7159880 00000000 c7a6a2d8 c7159898 c7a9fde4 c7a9fdc0 bf06d130 bf06d078 fdc0: c79ca000 c7159880 00000000 00000000 c7afbc00 c7a9e000 c7a9fe0c c7a9fde8 fde0: bf06d4b4 bf06d0f0 00000000 c79fd280 00000000 0f700000 c7a9e000 00000241 fe00: c7a9fe3c c7a9fe10 c01c37b4 bf06d300 00000000 c7afbc00 00000000 00000000 fe20: c79cba84 c7463c78 c79fd280 c7473b00 c7a9fe6c c7a9fe40 c00a184c c01c35e4 fe40: 00000000 c7bb0005 c7a9fe64 c79fd280 c7463c78 00000000 c00a1640 c785e380 fe60: c7a9fe94 c7a9fe70 c009c438 c00a164c c79fd280 c7a9fed8 c7a9fed8 00000003 fe80: 00000242 00000000 c7a9feb4 c7a9fe98 c009c614 c009c2a4 00000000 c7a9fed8 fea0: c7a9fed8 00000000 c7a9ff64 c7a9feb8 c00aa6bc c009c5e8 00000242 000001b6 fec0: 000001b6 00000241 00000022 00000000 00000000 c7a9fee0 c785e380 c7473b00 fee0: d8666b0d 00000006 c7bb0005 00000300 00000000 00000000 00000001 40002000 ff00: c7a9ff70 c79b10a0 c79b10a0 00005402 00000003 c78d69c0 ffffff9c 00000242 ff20: 000001b6 c79fd280 c7a9ff64 c7a9ff38 c785e380 c7473b00 00000000 00000241 ff40: 000001b6 ffffff9c 00000003 c7bb0000 c7a9e000 00000000 c7a9ff94 c7a9ff68 ff60: c009c128 c00aa380 4d18b5f0 08000000 00000000 00071214 0007128c 00071214 ff80: 00000005 c0027ee4 c7a9ffa4 c7a9ff98 c009c274 c009c0d8 00000000 c7a9ffa8 ffa0: c0027d40 c009c25c 00071214 0007128c 0007128c 00000241 000001b6 00000000 ffc0: 00071214 0007128c 00071214 00000005 00073580 00000003 000713e0 400010d0 ffe0: 00000001 bef0c7b8 000269cc 4d214fec 60000010 0007128c 00000000 00000000 Backtrace: [] (__kmalloc+0x0/0xdc) from [] (gs_alloc_req+0x40/0x70 [g_serial]) r8:c71598c0 r7:00000020 r6:c7a6a1d0 r5:00000040 r4:c7ba8fc0 [] (gs_alloc_req+0x0/0x70 [g_serial]) from [] (gs_alloc_requests+0x2c/0x78 [g_serial]) r7:bf06c83c r6:c7a6a1d0 r5:00000003 r4:c71598c0 [] (gs_alloc_requests+0x0/0x78 [g_serial]) from [] (gs_start_io+0x4c/0xac [g_serial]) r7:c7159898 r6:c7a6a2d8 r5:00000000 r4:c7159880 [] (gs_start_io+0x0/0xac [g_serial]) from [] (gs_open+0x1c0/0x224 [g_serial]) r9:c7a9e000 r8:c7afbc00 r7:00000000 r6:00000000 r5:c7159880 r4:c79ca000 [] (gs_open+0x0/0x224 [g_serial]) from [] (tty_open+0x1dc/0x314) [] (tty_open+0x0/0x314) from [] (chrdev_open+0x20c/0x22c) [] (chrdev_open+0x0/0x22c) from [] (__dentry_open+0x1a0/0x2b8) r8:c785e380 r7:c00a1640 r6:00000000 r5:c7463c78 r4:c79fd280 [] (__dentry_open+0x0/0x2b8) from [] (nameidata_to_filp+0x38/0x50) [] (nameidata_to_filp+0x0/0x50) from [] (do_filp_open+0x348/0x6f4) r4:00000000 [] (do_filp_open+0x0/0x6f4) from [] (do_sys_open+0x5c/0x170) [] (do_sys_open+0x0/0x170) from [] (sys_open+0x24/0x28) r8:c0027ee4 r7:00000005 r6:00071214 r5:0007128c r4:00071214 [] (sys_open+0x0/0x28) from [] (ret_fast_syscall+0x0/0x2c) Code: e59c4080 e59c8090 e3540000 159c308c (17943103) ---[ end trace be196e7cee3cb1c9 ]--- note: sh[1088] exited with preempt_count 2 process '-/bin/sh' (pid 1088) exited. Scheduling for restart. Welcome to Wind River Linux

    Read the article

< Previous Page | 342 343 344 345 346 347 348 349 350 351 352 353  | Next Page >