Search Results

Search found 32397 results on 1296 pages for 'reference program'.

Page 347/1296 | < Previous Page | 343 344 345 346 347 348 349 350 351 352 353 354  | Next Page >

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • c# Properties.Settings.Default Doesn't work as expected

    - by Jack
    I've been working on a program to automate my backup checks with LogMeIn backup (a windows forms based program). I now need a way to store user settings, to save information easily. I've never worked with the Application/User settings that is somewhat "built-in" - and decided to try it, but ran into problems. I added four settings for now: IncludeCriteria (Specialized.StringCollection) ExcludeCriteria (Specialized.StringCollection) ReportPath (string) ReportType (int) But the behavior doesn't act as expected (go figure). After saving some values in my program, I go back into edit/view my settings values using the VS 2008 settings editor. None of my values are stored. While I think this may be because those values are just default values, wouldn't that be where they can be stored/read/changed? Here is my load form code (still very unrefined): private void setupForm() { txtPath.Text = BackupReport.Properties.Settings.Default.ReportPath == null ? "" : BackupReport.Properties.Settings.Default.ReportPath; if (BackupReport.Properties.Settings.Default.ReportType == 0) { radioHTML.Checked = true; } else radioExcel.Checked = true; if (BackupReport.Properties.Settings.Default.IncludeCriteria.Count > 0) { listIncludeCriteria.DataSource = Properties.Settings.Default.IncludeCriteria; //foreach (string s in Properties.Settings.Default.IncludeCriteria) // listIncludeCriteria.Items.Add(s); } if (BackupReport.Properties.Settings.Default.ExcludeCriteria.Count > 0) { listExcludeCriteria.DataSource = BackupReport.Properties.Settings.Default.ExcludeCriteria; //foreach (string s in Properties.Settings.Default.ExcludeCriteria) // listExcludeCriteria.Items.Add(s); } } listIncludeCriteria is just a listbox. When the user saves I call this method: private void saveSettings() { //var settings = BackupReport.Properties.Settings; if (txtPath.Text != "") { BackupReport.Properties.Settings.Default.ReportPath = txtPath.Text; } if (listIncludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.IncludeCriteria = (StringCollection)listIncludeCriteria.Items.AsQueryable(); foreach (var i in listIncludeCriteria.Items) { if (!isIncludeDuplicate(i.ToString())) BackupReport.Properties.Settings.Default.IncludeCriteria.Add(i.ToString()); } } if (listExcludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.ExcludeCriteria = (StringCollection)listExcludeCriteria.Items.AsQueryable(); foreach (var i in listExcludeCriteria.Items) { if (!isExcludeDuplicate(i.ToString())) Properties.Settings.Default.ExcludeCriteria.Add(i.ToString()); } } if (radioExcel.Checked == true) BackupReport.Properties.Settings.Default.ReportType = 1; else BackupReport.Properties.Settings.Default.ReportType = 0; BackupReport.Properties.Settings.Default.Save(); //Properties.Settings.Default.Save(); this.DialogResult = DialogResult.OK; this.Close(); } The wierd thing is when the form loads, the path I put in the first time seems to come up (ReportPath) - even the listBoxes are populated with a bunch of crap I put in - yet I cant find these values anywhere. Any help would be appreciated! Josh

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • 'dxerr9.h': No such file or directory

    - by numerical25
    I am trying to compile a program I took off a cd from a book that uses directx to render 3d objects. when i press compile I get the following error C1083: Cannot open include file: 'dxerr9.h': No such file or directory I am using VC++ 2008 Express Edition and i am running off of Vista. I went to the following folder C:\Program Files\Microsoft SDKs\Windows\v6.0A\Include and I was not able to find the header there. Unless I am looking in the wrong place. When I initially installed DX sdk I allowed the installer to put everything in a default location. I am not sure If I am looking in the right places or what.

    Read the article

  • Undefined variable from import when using wxPython in pydev

    - by Bibendum
    I just downloaded wxPython, and was running some of the sample programs from here. However, on every line that uses a variable from wx.*, I get a "Undefined variable from import error" For example, the following program generates five errors on lines 1,4,8, and two on line 5: import wx class MyFrame(wx.Frame): """ We simply derive a new class of Frame. """ def __init__(self, parent, title): wx.Frame.__init__(self, parent, title=title, size=(200,100)) self.control = wx.TextCtrl(self, style=wx.TE_MULTILINE) self.Show(True) app = wx.App(False) frame = MyFrame(None, 'Small editor') app.MainLoop() The program, however, compiles and runs perfectly. I haven't made any significant modifications to pydev or eclipse, and the wxPython install is fresh.

    Read the article

  • CodePlex Daily Summary for Thursday, April 22, 2010

    CodePlex Daily Summary for Thursday, April 22, 2010New ProjectsAllegiance Modulus: - Display a list of all mods (installed/not installed/downloadable) - Allow user to install a mod - Allow a user to uninstall a mod - Keep backups ...Chatterbot JBot: PL: Program sieciowy JBot jest chatterbotem. EN: Network program JBot is chatterbot.Composite WPF Extensions: Extensions to Composite Client Application Library for WPFDwarrowdelf: Game concept in progressEntourage FrameG: Entourage lets users quickly and easily edit and create text . You will no longer have to download and install huge files and Entourage is 0% overw...FMon: file monGeckoBrowser: GeckoBrowser is a plugin for the great HTPC software MediaPortal. GeckoBrowser is a integrated WebBrowser for MediaPortal. It uses the Firefox (Gec...General Watcher: Watches things from the config file.GeoUtility Library: GeoUtility is an easy to use coordinate conversion library. It can be used for desktop/web development in CLI implementations like .NET, MONO. Supp...HidLib C++/CLR: HibLib is a USB Hid Communications Library written in C++/CLR IJW for the closest library you can get to a native USB Hid library. The project curr...HTML Shot: Server side component that generates a png/jpg image from arbitrary html code sent from the browser. Provides a quick way to enable printing arbit...MetaTagger: Core: MetaTagger: Core is a core set of meta data tagging libraries for use with .Net applicationsMUD--: MUD-- is a remake of MUD++ which never left devolution. MUD-- is a OOP oriented C++ MUD library, it is still in the planning stage. OpenLigaDB-Databrowser: A Silverlight 4-based Databrowser for the Community-Sportsdata-Webservice www.OpenLigaDB.deReduce Image to Specified Black Pixel Count: Takes in a picure path and an int n, and saves a white bitmap with the darkest n pixels from the image black. Posting this so that I can referen...Salient.MachineKeyUtils: Wraps encryption and password related functions from MachineKey, CookieProtectionHelper and MembershipProvider for use in other scenarios.Silverlight WebRequestHelper: WebRequestHelper is a very simple helper project, created for using HttWebRequest in Silverlight in a very simple and easiest way.Splinger FrameXi: Splinger FrameXi makes spelling a doddle with a huge and getting larger directory with LOADS of people contributing to make it the best in its field!SQL Server and SQL Azure Performance Testing: Enzo SQL Baseline: Run SQL statements in SQL Azure (or SQL Server) and capture performance metrics of your SQL statements (reads, writes, CPU...) against multiple dat...Sql Utils: A series of Java-based SQL import/export utilsSuggested Resources for .NET Developers: Suggested Resources is a proof of concept in aggregation of online content inside Visual Studio and analysis of a developers work, in order to sugg...SupportRoot: SupportRoot is a minimal helpdesk ticketing system focusing on speed and efficiency.Translate !t: Translate !t translates Image/Text containing English, German, French & Spanish to many different languages using Bing Translator. WCF Lab: To demonstrate different connectivity scenarios using WCF servicesWebAPP - Automated Perl Portal: Web portal system written in Perl. Full featured and multilingual.WIM4LAB: Laboratory Information Management System. ASP.NET C# MSSQL2005New Releases3D TagCloud for SharePoint 2010: 3D TagCloud v1.0: This realease contains the webpart itself.Bluetooth Radar: Version 2.1: Fix - "Right Click Crashes the application" bug Change OBX to push send Add current bluetooth device information + change device radiomode Ad...DirectQ: Release 1.8.3b: Contains updates and improvements to 1.8.3a. This should really be 1.8.4 given the extent of the changes, but I don't want to confuse a version nu...DotNetNuke® Store: 02.01.32 RC: What's New in this release? New Features: - A new setting 'Secure Cookie' in the Store Admin module allow to encrypt cookie values. Only the curren...Entourage FrameG: entourage frameg 1.0: Complete starter for entourageframeg.html enclosed as startentouragehtml.html and here you can find test CSS files and more! EXTRACT ALL FILES FROM...Entourage FrameG: FIMYID PRO: fimyid- find-my-id. YOU MUST download hidden.js and have the web server .pl file ready!Event Scavenger: Viewer version 3.0.1: Fixed an issue with the Viewer with highlighting not working properly (due to code rearranging from old version to new one for CodePlex). Viewer ve...FMon: First Edition: First EditionFolder Bookmarks: Folder Bookmarks 1.5.6: This is the latest version of Folder Bookmarks (1.5.6), with the new Quick Add feature and bug fixes. It has an installer that will create a direct...GameStore League Manager: League Manager 1.0.6: Bug fixes for bugs found in 1.0.5 and earlier. Fixes the crashing bug when a membership number of more than 6 digits is entered. Changes the dat...GeckoBrowser: GeckoBrowser v0.1 - RAR Package: GeckoBrowser Release v0.1.0.2 Please read Plugin installation for installation instructions.HTML Shot: Initial Source Code Release: Zip file includes a VS 2008 solution with two projects HTMLShot DLL project HTMLShot sample websiteMapWindow6: MapWindow 6.0 msi April 21: This version includes the latest bug fixes. This also includes the beginnings of some fixes that update the projection library to return NaN value...METAR.NET Decoder: Release 0.5.x (replacement of 0.4.x): Release 0.4.x was upgraded to 0.5.x due to major error issue included in previous one. Release Notes First public release. Main of the application...MongoMvc - A NoSQL Demo App with ASP.NET MVC: MongoMVC: A NoSql demo app using MongoDB, NoRM and ASP.NET MVCPanBrowser: 1.2.1: updated to FSharp 2.0.0.0PokeIn Comet Ajax Library: Chat Sample of PokeIn CS2010: C# Sample of PokeIn. You need to download the latest PokeIn Library and add to project as a reference to run this samplePokeIn Comet Ajax Library: Chat Sample VB 2010: VB.NET Sample of PokeIn. You need to download the latest PokeIn Library and add to project as a reference to run this sampleProject Santa: Project Santa v1.1: fixed some errors created from last minute adjustments. progress bar is now completely functional. added much more error checking. cleaned up some...RoTwee: RoTwee (11.0.0.1): Version for update to .NET Framework 4.0Sem.GenericTools.ProjectSettings: 2010-04-21 ProjectSettings Ex-Importer: Exports and imports project settings from/to CSV files. This release does fix the issue of missing/misordered build types in project files. Also th...Sharepoint Permissions Manager: Version 0.2: Added support of both WSS3.0 and MOSS2007Silverlight WebRequestHelper: WebRequestHelper 1.0: The usage of this project is so simple. all you need to do is following: WebRequest webRequest = WebRequest.Create("http://api.twitte...SilverlightFTP: SilverlightFTP Beta ENG: English version, fixed copy-paste.sNPCedit: sNPCedit v0.8b (Alpha): + Added: support for version 5 (will be imported and saved as version 10) + Fixed: order of chinese week days in event section (week starts with su...Splinger FrameXi: Splinger FrameXi 1.0: DOWNLOAD ALLLL FILES and start in Splinger FrameXi.html . EXTRACT ALL FILES FROM .ZIP ARCHIVE!!!!SQL Server and SQL Azure Performance Testing: Enzo SQL Baseline: Enzo SQL Baseline 1.0: Use this download to install and deploy the sample application and its source code. The installer gives you the option to install the Windows appli...StoreManagement: v1: First (and probably final) version. Should be stable.TFS WitAdminUI: some bug fixed: When project name includes empty space, error fire. So i fix. Download zip file and unzip to TFS2010 or TFS2008. And Excute WitAdminUI.exe. Becaus...TFTP Server: TFTP Server 1.1 Installer: Release 1.1 of the Managed TFTP Server. New Features: Runs as windows service. Supports multiple TFTP servers on different endpoints, each servi...Thinktecture.IdentityModel: Thinktecture.IdentityModel v0.8: Updated version - includes the plumbing for REST/OData Services and UI authorization.Translate !t: Translate !t[Setup]: Translate !tSetupTranslate !t: Translate !t[Source Code]: Translate !tSource CodeWatchersNET CKEditor™ Provider for DotNetNuke: CKEditor Provider 1.10.02: BETA small fixesWeb Service Software Factory: Web Service Software Factory 2010 Beta: To use the Web Service Software Factory 2010, you need the following software installed on your computer: • Microsoft Visual Studio 2010 (Ultima...Windows Workflow Foundation on Codeplex: WF ADO.NET Activity Pack CTP 1: WF ADO.NET Activity Pack CTP 1 The Microsoft WF ADO.NET Activity Pack CTP 1 is the first community technology preview (CTP) release of ADO.NET acti...Windows Workflow Foundation on Codeplex: WF State Machine Activity Pack CTP 1: WF State Machine Activity Pack CTP 1The Microsoft WF State Machine Activity Pack CTP 1 is the first community technology preview (CTP) release of a...WPF Inspirational Quote Management System: Release 1.2.0: - Fixed non-working delete quote button. - Changed layout of quote edit page, font and colour. - Lightened background colour of settings page.WPF Inspirational Quote Management System: Release 1.2.1: - Only display an underline under Author links if a Reference URL is present.xlVBADevTools: 0.1 Two mostly inadequate tools...: Since I was blogging about it (), it seemed appropriate to upload LOCutus, in all its 2002 "glory" (hah!) and make it available for download.XP-More: 0.9.5: Added support for saved state files (.vsv) Added version updates check Added a check to make sure the assumed VM folder exists (this will be do...Most Popular ProjectsRawrWBFS ManagerSilverlight ToolkitAJAX Control ToolkitMicrosoft SQL Server Product Samples: DatabaseWindows Presentation Foundation (WPF)patterns & practices – Enterprise LibraryASP.NETMicrosoft SQL Server Community & SamplesPHPExcelMost Active Projectspatterns & practices – Enterprise LibraryRawrBlogEngine.NETFarseer Physics EngineDotNetZip LibraryNB_Store - Free DotNetNuke Ecommerce Catalog ModulePHPExcelGMap.NET - Great Maps for Windows Forms & PresentationIonics Isapi Rewrite FilterEsferatec.Text.RegularExpressions

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • Why do I get a null pointer exception from TabWidget?

    - by rushinge
    I'm writing an android program in which I have an activity that uses tabs. The Activity public class UnitActivity extends TabActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TabHost tabHost = getTabHost(); TabSpec spec; Resources res = getResources(); LayoutInflater.from(this).inflate(R.layout.unit_view, tabHost.getTabContentView(), true); spec = tabHost.newTabSpec("controls"); spec.setIndicator("Control", res.getDrawable(R.drawable.ic_tab_equalizer)); spec.setContent(R.id.txtview); tabHost.addTab(spec); } } The XML referenced by R.layout.unit_view <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content"/> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TextView android:id="@+id/txtview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:gravity="bottom" android:text="nullpointer this!" /> </FrameLayout> </LinearLayout> </TabHost> As far as I can see I'm doing the same thing I see in the tabs1 api sample from the android sdk. I've tried "getLayoutInflator()" instead of "LayoutInflator.from(this)" with the same result. If I replace the LayoutInflater line with "setContentView(R.layout.unit_view)" my program doesn't crash with a null pointer exception but my content is completely blank and empty. I get the tab and that's it. I've checked to make sure R.layout.unit_view and tabHost are not null when it runs the LayoutInflater line and they seem to be fine. They're defenitely not null. I've also checked to make sure LayoutInflater.from(this) returns a valid layout inflater object and it does. The logcat indicating the error says E/AndroidRuntime( 541): java.lang.NullPointerException E/AndroidRuntime( 541): at android.widget.TabWidget.dispatchDraw(TabWidget.java:206) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1531) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1830) E/AndroidRuntime( 541): at android.view.ViewRoot.draw(ViewRoot.java:1349) E/AndroidRuntime( 541): at android.view.ViewRoot.performTraversals(ViewRoot.java:1114) E/AndroidRuntime( 541): at android.view.ViewRoot.handleMessage(ViewRoot.java:1633) E/AndroidRuntime( 541): at android.os.Handler.dispatchMessage(Handler.java:99) E/AndroidRuntime( 541): at android.os.Looper.loop(Looper.java:123) E/AndroidRuntime( 541): at android.app.ActivityThread.main(ActivityThread.java:4363) E/AndroidRuntime( 541): at java.lang.reflect.Method.invokeNative(Native Method) E/AndroidRuntime( 541): at java.lang.reflect.Method.invoke(Method.java:521) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) E/AndroidRuntime( 541): at dalvik.system.NativeStart.main(Native Method) I/Process ( 61): Sending signal. PID: 541 SIG: 3 I/dalvikvm( 541): threadid=7: reacting to signal 3 I/dalvikvm( 541): Wrote stack trace to '/data/anr/traces.txt' Anybody have any idea how I can get this content into a tab without crashing my application? My actual program is more complex and has more than one tab but I simplified it down to this in an attempt to find out why it's crashing but it still crashes and I don't know why. If I don't use LayoutInflator my program doesn't crash but I don't get any content either, just tabs.

    Read the article

  • CodePlex Daily Summary for Sunday, November 11, 2012

    CodePlex Daily Summary for Sunday, November 11, 2012Popular ReleasesZXMAK2: Version 2.7.2.0: show extended rzx error info fix reset lag for PROFI ULA 5.xx fix reset behavior fix PROFI ULA timings (thanks to solegstar) fix #FF port for PROFI ULA add ATM710 memory module add new predefined machine configs: ATM Turbo 2, PROFI 3.XX???????: Monitor 2012-11-11: This is the first releaseVidCoder: 1.4.5 Beta: Removed the old Advanced user interface and moved x264 preset/profile/tune there instead. The functionality is still available through editing the options string. Added ability to specify the H.264 level. Added ability to choose VidCoder's interface language. If you are interested in translating, we can get VidCoder in your language! Updated WPF text rendering to use the better Display mode. Updated HandBrake core to SVN 5045. Removed logic that forced the .m4v extension in certain ...ImageGlass: Version 1.5: http://i1214.photobucket.com/albums/cc483/phapsuxeko/ImageGlass/1.png v1.5.4401.3015 Thumbnail bar: Increase loading speed Thumbnail image with ratio Support personal customization: mouse up, mouse down, mouse hover, selected item... Scroll to show all items Image viewer Zoom by scroll, or selected rectangle Speed up loading Zoom to cursor point New background design and customization and others... v1.5.4430.483 Thumbnail bar: Auto move scroll bar to selected image Show / Hi...Building Windows 8 Apps with C# and XAML: Full Source Chapters 1 - 10 for Windows 8 Fix 002: This is the full source from all chapters of the book, compiled and tested on Windows 8 RTM. Includes: A fix for the Netflix example from Chapter 6 that was missing a service reference A fix for the ImageHelper issue (images were not being saved) - this was due to the buffer being inadequate and required streaming the writeable bitmap to a buffer first before encoding and savingmyCollections: Version 2.3.2.0: New in this version : Added TheGamesDB.net API for Games and NDS Added Support for Windows Media Center Added Support for myMovies Added Support for XBMC Added Support for Dune HD Added Support for Mede8er Added Support for WD HDTV Added Fast search options Added order by Artist/Album for music You can now create covers and background for games You can now update your ID3 tag with the info of myCollections Fixed several provider Performance improvement New Splash ...Draw: Draw 1.0: Drawing PadPlayer Framework by Microsoft: Player Framework for Windows 8 (v1.0): IMPORTANT: List of breaking changes from preview 7 Ability to move control panel or individual elements outside media player. more info... New Entertainment app theme for out of the box support for Windows 8 Entertainment app guidelines. more info... VSIX reference names shortened. Allows seeing plugin name from "Add Reference" dialog without resizing. FreeWheel SmartXML now supports new "Standard" event callback type. Other minor misc fixes and improvements ADDITIONAL DOWNLOADSSmo...WebSearch.Net: WebSearch.Net 3.1: WebSearch.Net is an open-source research platform that provides uniform data source access, data modeling, feature calculation, data mining, etc. It facilitates the experiments of web search researchers due to its high flexibility and extensibility. The platform can be used or extended by any language compatible for .Net 2 framework, from C# (recommended), VB.Net to C++ and Java. Thanks to the large coverage of knowledge in web search research, it is necessary to model the techniques and main...Umbraco CMS: Umbraco 4.10.0: NugetNuGet BlogRead the release blog post for 4.10.0. Whats newMVC support New request pipeline Many, many bugfixes (see the issue tracker for a complete list) Read the documentation for the MVC bits. Breaking changesWe have done all we can not to break backwards compatibility, but we had to do some minor breaking changes: Removed graphicHeadlineFormat config setting from umbracoSettings.config (an old relic from the 3.x days) U4-690 DynamicNode ChildrenAsList was fixed, altering it'...SQL Server Partitioned Table Framework: Partitioned Table Framework Release 1.0: SQL Server 2012 ReleaseSharePoint Manager 2013: SharePoint Manager 2013 Release ver 1.0.12.1106: SharePoint Manager 2013 Release (ver: 1.0.12.1106) is now ready for SharePoint 2013. The new version has an expanded view of the SharePoint object model and has been tested on SharePoint 2013 RTM. As a bonus, the new version is also available for SharePoint 2010 as a separate download.D3D9Client: D3D9Client R7: New release for Orbiter 2010-P1 - Added horizon/sun angle for night-lights into the configuration file (default 10deg) - Some runway lights related bugs are fixed - Added more configuration options for runway lightsFiskalizacija za developere: FiskalizacijaDev 1.2: Verzija 1.2. je, prije svega, odgovor na novu verziju Tehnicke specifikacije (v1.1.) koja je objavljena prije nekoliko dana. Pored novosti vezanih uz (sitne) izmjene u spomenutoj novoj verziji Tehnicke dokumentacije, projekt smo prošili sa nekim dodatnim feature-ima od kojih je vecina proizašla iz vaših prijedloga - hvala :) Novosti u v1.2. su: - Neusuglašenost zahtjeva (http://fiskalizacija.codeplex.com/workitem/645) - Sample projekt - iznosi se množe sa 100 (http://fiskalizacija.codeplex.c...MFCMAPI: October 2012 Release: Build: 15.0.0.1036 Full release notes at SGriffin's blog. If you just want to run the MFCMAPI or MrMAPI, get the executables. If you want to debug them, get the symbol files and the source. The 64 bit builds will only work on a machine with Outlook 2010 64 bit installed. All other machines should use the 32 bit builds, regardless of the operating system. Facebook BadgeDictationTool: DictationCool-WPF: • Open a media file to start a new dication. • Open a dct file to continue a dictation. • Compare your dictation with original text if exists. • Save your dictation to dct file, and restore it to continue later. • Save the compared result to html file.MCEBuddy 2.x: MCEBuddy 2.3.7: Changelog for 2.3.7 (32bit and 64bit) 1. Improved performance of MP4 Fast and M4V Fast Profiles (no deinterlacing, removed --decomb) 2. Improved priority handling 3. Added support for Pausing and Resume conversions 4. Added support for fallback to source directory if network destination directory is unavailable 5. MCEBuddy now installs ShowAnalyzer during installation 6. Added support for long description atom in iTunesDyanamic Reports (RDLC) - SharePoint 2010 Visual WebPart: Initial Release: This is a Initial Release.HTML Renderer: HTML Renderer 1.0.0.0 (3): Major performance improvement (http://theartofdev.wordpress.com/2012/10/25/how-i-optimized-html-renderer-and-fell-in-love-with-vs-profiler/) Minor fixes raised in issue tracker and discussions.Window Manager: Window Manager 1.0: First releaseNew Projectsarteytex: este es una prueba blockworld: An implementation of a goal stack planner.Customer Note: customer note is windows store applicationDraw: ?????????????:??????、CAD??、????。Football Management: Football Management System is web management system for football (soccer) leagues, teams and players. Hijri Converter API: This project is aimed to create a simple RESTful API using VB and ASP.NET to do Hijri-to-Gregorian and Gregorian-to-Hijri conversion.httpclient?????????: httpclient?????????(1)??????????(2)?????????(3)??2012-11-06??,???????。 Imagine Cup 2013: Develop project to Imagine Cup 2013MyAppReji: MyAppN2F Request: The N2F Request object is used to handle interactions between N2F and the global $_REQUEST variable, sanitizing any results which are returned.Orchard Metro Theme: Orchard Metro Theme is a clean and flexible multi-zone theme.Poker Clock And Goodies: poker w8ProjectASPReviewer: Review website for notebooks, tablets and smartphones.Prototype: Its about making an proto type for the final project.Prototype - 7COM0207: 7COM0207 web scripting module, Assignment 2QuickToAD: QuickToAD is a foundational development project for the purpose of jump-starting data-driven application projects.Release Manager: Release Manager is a project to design and develop Windows based Release Management Software.ResW File Code Generator: A Visual Studio 2012 Custom Tool for generating a strongly typed helper class for accessing localized resources from a .ResW file.SEO Tools: This is a website containing some commonly used SEO tools. I have only added a blog ping utility at this time but there is more to come. Thales communicator: A C# library that helps communicate with Thales HSMTrivial: A trivia framework: Trivial is a C# framework that helps you creating custom trivia-like applications.

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

  • CodePlex Daily Summary for Thursday, March 25, 2010

    CodePlex Daily Summary for Thursday, March 25, 2010New ProjectsAccessibilityChecker: Accessibility Checker is custom feature developed to check accessibility requirements in a SharePoint PortalAnne Epstein - Personal Repository: Project Description This project contains multiple samples with various snippets and projects from blog posts, user group talks, and conference se...BatterySaver: BatterySaver is a simple application, in C#, that allows laptop users to perform actions based on battery notification events (switching from batte...dtxJson: C# coded JSON (JavaScript Object Notation) parser.eCamp: eCamp is a modular and extensible electronic camp management application. Written in C# and WPF, it follows many of the latest technology trends su...epdevplatform: epdevplatformERP: Environment Colaborative Resources ProjectFaceLight - Simple Silverlight Face Detection: FaceLight is a simple facial recognition method that can be used with Silverlight 's webcam. It searches for a certain sized skin color region in a...Forum PAF - The Open Source .Net Forum - From Viet Nam - By Thomas John (jntpaf): The Open Source .Net Forum - From Viet Nam ------------------------- Các phần mềm cần thiết để chạy Forum PAF: 1. .Net Framework 2.0 (trở lên) 2....Gawam Savel - Sistema de Avaliação Eletrônica: Projeto de TCC ...Html5 Helpers and tools for Asp.Net MVC: Html5 Helper aims to provide a generic helper context to produce HTML5 content in ASP.NET MVCIfeanyi Echeruo's WPF Recipes: WPF Recipes C# code samples showing how to solve some non-trivial problems in WPFITM 495 - iPhone App: school project iphone appKnowledge Exchange: Stack Overflow Inspired Knowledge ExchangeMailCheck: Mail检查程序。NetBoard: NetBoard is a lightweight system designed to act as the Blackboard in a micro-blackboard architecture for use within an OO system - even when withi...RodBass.com: RodBass.comsemanticrest: This is a vision of semantics mashups for rest web services.StatSpaceUI: StatSpaceUITFS Merge Tool: A small tool for merging changesets between TFS branches.The Interface To End All Interfaces: We interfaced everything, so that you can implement anything...Tim - Open Source Projects And Samples: Open source projects / Samples for http://tim.bellette.netWindows XNA: A place for those who enjoy there XNA Game Studio programing on Windows. For a place to share XNA Game Studio games for Windows in English. I'm loo...XAML Code Snippets addin for Visual Studio 2010: Provides support for adding XAML code snippets in the Visual Studio 2010 code editor for XAML in WPF and Silverlight projects.New ReleasesAnyWorks: AnyWorks1.2Bin: AnyWorks1.2AnyWorks: AnyWorks1.2Src: AnyWorks1.2AppFabric Caching Admin Tool: AppFabric Caching Admin Tool 1.0: System Requirements:.NET 4.0 RC AppFabric Caching Beta2 Test On:Win 7 (64x) Note: Must run as Administrator !!!ASP.NET Wiki Control: Release 1.1: - Modified text and varchar columns to nvarchar for unicode support. - Modified path info logic to disable its use if the page's raw url currently...B&W Port Scanner: Black`n`White Port Scanner 2.0: Fast Cross-Platform Port Scanner with Vulnerability Detection Tools. 3 vulnerability detection tools are included in this version: - Detection of ...BatterySaver: 0.1: Initial Release This is the initial release of the application. The application is very much beta with lots of changes upcoming. Known Issues The...BatterySaver: 0.2: Changes+ Add support for enabling and disabling devices (6)Compare .NET Objects: Version 1.2.0.0: New Features: Compare Generic Classes that Implement IList Indexers Compare Datasets Compare DataTables Compare DataRows Consider IList and...Controlled Vocabulary: 1.0.0.3: System Requirements Outlook 2007 / 2010 .Net Framework 3.5 Installation 1. Close Outlook (Use Task Manager to ensure no running instances in the b...crudwork is a library of reuseable classes for developing .NET applications: crudwork 2.2.0.2: minor changes. new guid for msi and new strongly named guidDigitallyCreated Utilities: DigitallyCreated Utilities v1.0.0: This release is the v1.0.0 version of DigitallyCreated Utilities. Binary Distribution The binary distribution contains the following: Compiled bin...DirectQ: Release 1.8.2: Adds several bugfixes and improved functionality. This release supersedes 1.8.1 which will be shortly removed. A very big THANK YOU to everyone w...DotNetNuke® Community Edition: 05.03.01: Major Highlights Issue fixed issue with the email notifications where the From and To addresses were swapped. Issue fixed with signature ch...Encrypted Notes: Encrypted Notes 1.5: This is the latest version of Encrypted Notes (1.5). It has an installer - it will create a directory 'CPascoe' in My Documents. Once you have ext...EnhSim: Release v1.9.8.1: Release v1.9.8.1Adding in the Glyph of Flame Shock changes in 3.3.3FlickrNet API Library: 3.0 Beta: A brand new version of the FlickrNet library, exposing 100% of the Flickr API's methods, along with streamlined class and method names. All classe...Forum PAF - The Open Source .Net Forum - From Viet Nam - By Thomas John (jntpaf): Forum PAF - The Open Source .Net Forum: A, Các phần mềm cần thiết để chạy Forum PAF: 1. .Net Framework 2.0 (trở lên) 2. Ajax Extension 1.0 (trở lên) 3. Sql Server 2005 (Sql Server Expr...HydroDesktop - CUAHSI Hydrologic Information System Desktop Application: HydroDesktop 0.7.3735 Alpha Installer: This is the testing release of the HydroDesktop 0.7 alpha version. Features supported in this version include: Search for data and download of Hydr...MDownloader: MDownloader-0.15.9.56953: Fixed Uploading.com links detection.MiniTwitter: 1.10: MiniTwitter 1.10 更新内容 追加 未読管理時に未読数をタブに表示する機能を実装 サイレントモードを実装(通知領域アイコンを右クリックして出るメニューから切り替え) 修正 「お気に入りワードを含む項目だけ表示する」オプションが機能していなかった問題を修正NoteExpress User Tools (NEUT) - Do it by ourselves!: NoteExpress User Tools 1.9.1: 测试版本:NoteExpress 2.5.0.1147 #修正一个改动的bugOneCMS: OneCMS 2.6: OneCMS 2.6 is finally here! Along with various bug fixes 2.6 also brings with it many new features such as the videos module, plugins system, and m...Quantity System Framework: Quantity System Calculator 1.1.9.93: Experience the new edition of the quantity system with text support and function treated as values now you can multiply functions and divide funct...Selection Maker: Selection Maker 1.4: some minor bugs fixed. icon added for running and uninstalling the application.sPATCH: sPatcher v0.8a: + Disabled patchers proxy settings to increase connection speed sPatch - Server Example *Contains a sample Patch that "downgrades" PWI 1.4.2 Clien...VSTT 2008 Quick Reference Guide: VS Performance Testing Quick Reference V2.0: Visual Studio Performance Testing Quick Reference Guide (Version 2.0)WeatherBar: WeatherBar 2.0: WeatherBar 2.0 Changelog: Introduced application settings. Modified UI. Ability to switch between Fahrenheit and Celsius (application-wide). ...WillStrohl.LightboxGallery Module for DotNetNuke: WillStrohl.LightboxGallery v1.02.01: This version of the Lightbox Gallery Module adds the following features: Upgraded the Autocomplete jQuery plugin Fixed an IE8 error that was occu...Windows XNA: Base Defense Alpha 0.339: Alpha 0.338 had a really bad bug that made the game crash, that is what I get for coding after 3am... I also made some AI for the Raptor. So now it...WPF Dynamic Data Display: Silverlight DynamicDataDisplay v0.2 - Spring 2010: Silverlight version of WPF DynamicDataDisplay charting library The version 0.2 shows a greater performance comparing with version 0.1 while having...Most Popular ProjectsMetaSharpRawrWBFS ManagerASP.NET Ajax LibrarySilverlight ToolkitMicrosoft SQL Server Product Samples: DatabaseAJAX Control ToolkitLiveUpload to FacebookWindows Presentation Foundation (WPF)ASP.NETMost Active ProjectsRawrjQuery Library for SharePoint Web ServicesFarseer Physics EngineBlogEngine.NETFacebook Developer ToolkitNB_Store - Free DotNetNuke Ecommerce Catalog ModulePHPExcelTable2ClassFluent Ribbon Control SuiteLINQ to Twitter

    Read the article

  • MIPS assembly: how to declare integer values in the .data section?

    - by Barney
    I'm trying to get my feet wet with MIPS assembly language using the MARS simulator. My main problem now is how do I initialize a set of memory locations so that I can access them later via assembly language instructions? For example, I want to initialize addresses 0x1001000 - 0x10001003 with the values 0x99, 0x87, 0x23, 0x45. I think this can be done in the data declaration (.data) section of my assembly program but I'm not sure of the syntax. Is this possible? Alternatively, in the .data section, how do I specify storing the integer values in some memory location (I don't care where, but I just want to reference them somewhere). So I'm looking for the C equivalent of "int x = 20, y=30, z=90;" I know how to do that using MIPS instructions but is it possible to declare something like that in the .data section of a MIPS assembly program?

    Read the article

  • Using Python to call Mencoder with some arguments

    - by Manu
    Hello, I'll start by saying that I am very, very new to Python. I used to have a Windows/Dos batch file in order to launch Mencoder with the right set of parameters, without having to type them each time. Things got messy when I tried to improve my script, and I decided that it would be a good opportunity to try coding something in python. I've come up with that : #!/usr/bin/python import sys, os #Path to mencoder mencoder = "C:\Program Files\MPlayer-1.0rc2\mencoder.exe" infile = "holidays.avi" outfile = "holidays (part1).avi" startTime = "00:48:00" length = "00:00:15" commande = "%s %s -ovc copy -oac copy -ss %s -endpos %s -o %s" os.system(commande % (mencoder, infile, startTime, length, outfile)) #Pause raw_input() But that doesn't work, windows complains that "C:\Program" is not recognized command. I've trying putting some "\"" here and there, but that didn't help.

    Read the article

  • C# timer won't tick

    - by Andrej
    hi, i have a strange problem... I've been going out of my mind for the past couple of hours... the timer i put in my winform code (from the toolbar) won't tick... I have timers on a couple of forms in my program, they all work fine... I try to do exactly the same it this it won't tick... I select it, drag it on to a form, enable it, set interval and handle the tick event... and nothing happens... i even tried putting random code like messagebox.show in the tick event just to see if anything happens, and nothing!!! as I said, a have a couple of more timer in my program (on other forms, not in the one i'm trying to put this timer) and they all work fine... any suggestions? thanks in advance!

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • WIX will not add HKLM registry setting during Windows 7 install

    - by Scott Boettger
    Good Morning, I have written a WiX installer that works perfectly with Windows XP but when installing to a Windows 7 box I am running into difficulty with Registry Entries. What I need to do is add a HKLM entry as well as the registry entry for the program to show in the start menu. Here is the code i am using for both types of entry: <!-- Create the registry entries for the program --> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntriesInst" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="installed" Value="true" KeyPath="yes"/> </RegistryKey> </Component> <Component Id="RegistryEntriesVer" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="version" Value="$(var.ProductVersion)" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <!-- To add shortcuts to the start menu to run and uninstall the program--> <DirectoryRef Id="ApplicationProgramsFolder"> <Component Id="ApplicationShortcut" Guid="..."> <Shortcut Id="ApplicationStartMenuShortcut" Name="$(var.ProductName)" Description="..." Target="[SERVERLOCATION]$(var.Project.TargetFileName)" WorkingDirectory="SERVERLOCATION"/> <Shortcut Id="UninstallProduct" Name="Uninstall $(var.ProductName)" Description="..." Target="[System64Folder]msiexec.exe" Arguments="/x [ProductCode]"/> <RemoveFolder Id="SERVERLOCATION" On="uninstall"/> <RegistryValue Root="HKCU" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Name="installed" Type="integer" Value="1" KeyPath="yes"/> </Component> </DirectoryRef> Any help/suggestions that can be given will be appreciated. On a side note the registry permissions are the same on the XP and 7 computers. Thanks

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Installing Office Customization

    - by user187229
    Name: From: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto ********** Exception Text ********** Microsoft.VisualStudio.Tools.Applications.Deployment.AddInAlreadyInstalledException: The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.VerifySolutionCodebaseIsUnchanged(Uri uri, String subscriptionId, Boolean previouslyInstalled) at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.InstallAddIn()

    Read the article

  • delete pointer to 2d array c ++

    - by user1848054
    i have this pointer to 2d array of Robot class Robot ***rob; and this is here the code for the constructor !! and the program works fine !!! but now i am trying to build a destructor to delete this pointer !! and it keeps on crashing the program !! my question is , how to delete this pointer to 2d array of robots ? RobotsWorld::RobotsWorld(int x , int y) { X=x;Y=y; // returns the limitation of the matrix rob = new Robot**[x]; for(int i = 0; i < x; i++) { rob[i] = new Robot*[y]; for(int j = 0; j < y; j++) { rob[i][j] = NULL; } } }

    Read the article

  • MIDL2003 Error in VC6 project

    - by graham.reeds
    While bug fixing I tracked a problem to an old vc6 compiled dll that hasn't been touched in nearly 3 years. After checking out the most recent source I am getting the following error when trying to compile. Processing C:\PROGRAM FILES\MICROSOFT SDK\INCLUDE\msxml.idl msxml.idl .\ocidl.idl(1524) : error MIDL2003 : redefinition : IErrorLog .\ocidl.idl(1541) : error MIDL2003 : redefinition : IPropertyBag Google gives lots of suggestions regarding Visual Studio 2002 - 2003 errors but I can't find anything that relates to Visual Studio 6 or can be applied to my problem. I did find this page but following it's advice didn't fix my problem. Does anyone have any suggestions on how to fix this? (I am presuming that it did work once.) Other items of interest: I have the February 2003 Platform SDK installed, and looking at the add/remove program page I have Micrsoft XML Parser and SDK, MSXML 4.0 SP2 and MSXML 6.0 Parser too.

    Read the article

  • BufferedReader.readLine() gives error java.net.SocketException: Software caused connection abort: re

    - by javatcp
    I am trying to code my program such that until the buffered reader gets something in readLine() from my tcp client it should keep running in the while loop checking but I get this error as soon as the program executes Mar 31, 2010 11:03:36 PM deswash.DESWashView$5 run SEVERE: null java.net.SocketException: Software caused connection abort: recv failed at java.net.SocketInputStream.socketRead0(Native Method) at java.net.SocketInputStream.read(SocketInputStream.java:129) at sun.nio.cs.StreamDecoder.readBytes(StreamDecoder.java:264) at sun.nio.cs.StreamDecoder.implRead(StreamDecoder.java:306) at sun.nio.cs.StreamDecoder.read(StreamDecoder.java:158) at java.io.InputStreamReader.read(InputStreamReader.java:167) at java.io.BufferedReader.fill(BufferedReader.java:136) at java.io.BufferedReader.readLine(BufferedReader.java:299) at java.io.BufferedReader.readLine(BufferedReader.java:362) at deswash.DESWashView$5.run(DESWashView.java:448) the second line in the following code throws the error while(running){ String temp = in.readLine(); if(!(temp.equals(null))){ int inid = Integer.parseInt(temp); stationList.add(inid); } }

    Read the article

  • interaction between javascript (desktop application) and C#

    - by Roman Dorevich
    Hello. I am writing for my desktop some application for handling some services. I wrote in C# an application that calculates something (lets call it cl.exe) I created a .bat file that starts the cl.exe. I want to call that .bat file from my javascript so I WShell.Run(**.bat). 2 question: The javascript program will not continue till the cl.exe will end ? (It is synchronized ?) The cl.exe returns a value. How can the javascript take it (It is a javascript program that call .bat file that wrapp the execution of the cl.exe) ? Thanks

    Read the article

  • Windows Workflow and sql script in declarative config like InRule

    - by Satish
    We have been using InRule for our Rule needs we have found that it does not scale well and so are investigating the Windows Work Flow. Within InRule we could configure pretty much have any task for example our sql scripts and stored procedures where all part of a separate rule config file, I am wondering if there is a similar functionality within windows work flow where I could just call a declarative task and pass it a bunch of parameters – This task should contain the sql script I would be executing , we should be able to change the script at runtime without recompilation to the WF code. Is this possible in Windows Work flow – How can I accomplish this within work flow. Additionally for sql execution within Work Flow, how does it get the connection string. Should it be passed from the calling program – is passing it as input parameter from the Calling app via the Dictionary object the best way or can the work flow code have visibility to my calling program app.config and get the connection string ?

    Read the article

  • VSNewFile: A Visual Studio Addin to More Easily Add New Items to a Project

    - by InfinitiesLoop
    My first Visual Studio Add-in! Creating add-ins is pretty simple, once you get used to the CommandBar model it is using, which is apparently a general Office suite extensibility mechanism. Anyway, let me first explain my motivation for this. It started out as an academic exercise, as I have always wanted to dip my feet in a little VS extensibility. But I thought of a legitimate need for an add-in, at least in my personal experience, so it took on new life. But I figured I can’t be the only one who has felt this way, so I decided to publish the add-in, and host it on GitHub (VSNewFile on GitHub) hoping to spur contributions. Adding Files the Built-in Way Here’s the problem I wanted to solve. You’re working on a project, and it’s time to add a new file to the project. Whatever it is – a class, script, html page, aspx page, or what-have-you, you go through a menu or keyboard shortcut to get to the “Add New Item” dialog. Typically, you do it by right-clicking the location where you want the file (the project or a folder of it): This brings up a dialog the contains, well, every conceivable type of item you might want to add. It’s all the available item templates, which can result in anywhere from a ton to a veritable sea of choices. To be fair, this dialog has been revamped in Visual Studio 2010, which organizes it a little better than Visual Studio 2008, and adds a search box. It also loads noticeably faster.   To me, this dialog is just getting in my way. If I want to add a JavaScript script to my project, I don’t want to have to hunt for the script template item in this dialog. Yes, it is categorized, and yes, it now has a search box. But still, all this UI to swim through when all I need is a new file in the project. I will name it. I will provide the content, I don’t even need a ‘template’. VS kind of realizes this. In the add menu in a class library project, for example, there is a “Add Class…” choice. But all this really does is select that project item from the dialog by default. You still must wait for the dialog, see it, and type in a name for the file. How is that really any different than hitting F2 on an existing item? It isn’t. Adding Files the Hack Way What I often find myself doing, just to avoid going through this dialog, is to copy and paste an existing file, rename it, then “CTRL-A, DEL” the content. In a few short keystrokes I’ve got my new file. Even if the original file wasn’t the right type, it doesn’t matter – I will rename it anyway, including the extension. It works well enough if the place I am adding the file to doesn’t have much in it already. But if there are a lot of files at that level, it sucks, because the new file will have the name “Copy of xyz”, causing it to be moved into the ‘C’ section of the alphabetically sorted items, which might be far, far away from the original file (and so I tend to try and copy a file that starts with ‘C’ *evil grin*). Using ‘Export Template’ To be completely fair I should at least mention this feature. I’m not even sure if this is new in VS 2010 or not (I think so). But it allows you to export a project item or items, including potential project references required by it. Then it becomes a new item in the available ‘installed templates’. No doubt this is useful to help bootstrap new projects. But that still requires you to go through the ‘New Item’ dialog. Adding Files with VSNewFile So hopefully I have sufficiently defined the problem and got a few of you to think, “Yeah, me too!”… What VSNewFile does is let you skip the dialog entirely by adding project items directly to the context menu. But it does a bit more than that, so do read on. For example, to add a new class, you can right-click the location and pick that option. A new .cs file is instantly added to the project, and the new item is selected and put into the ‘rename’ mode immediately. The default items available are shown here. But you can customize them. You can also customize the content of each template. To do so, you create a directory in your documents folder, ‘VSNewFile Templates’. In there, you drop the templates you want to use, but you name them in a particular way. For example, here’s a template that will add a new item named “Add TITLE”. It will add a project item named “SOMEFILE.foo” (or ‘SOMEFILE1.foo’ if that exists, etc). The format of the file name is: <ORDER>_<KEY>_<BASE FILENAME>_<ICON ID>_<TITLE>.<EXTENTION> Where: <ORDER> is a number that lets you determine the order of the items in the menu (relative to each other). <KEY> is a case sensitive identifier different for each template item. More on that later. <BASE FILENAME> is the default name of the file, which doesn’t matter that much, since they will be renaming it anyway. <ICON ID> is a number the dictates the icon used for the menu item. There are a huge number of built-in choices. More on that later. <TITLE> is the string that will appear in the menu. And, the contents of the file are the default content for the item (the ‘template’). The content of the file can contain anything you want, of course. But it also supports two tokens: %NAMESPACE% and %FILENAME%, which will be replaced with the corresponding values. Here is the content of this sample: testing Namespace = %NAMESPACE% Filename = %FILENAME% I kind went back and forth on this. I could have made it so there’d be an XML or JSON file that defines the templates, instead of cramming all this data into the filename itself. I like the simplicity of this better. It makes it easy to customize since you can literally just throw these files around, copy them from someone else, etc, without worrying about merge data into a central description file, in whatever format. Here’s our new item showing up: Practical Use One immediate thing I am using this for is to make it easier to add very commonly used scripts to my web projects. For example, uh, say, jQuery? :) All I need to do is drop jQuery-1.4.2.js and jQuery-1.4.2.min.js into the templates folder, provide the order, title, etc, and then instantly, I can now add jQuery to any project I have without even thinking about “where is jQuery? Can I copy it from that other project?”   Using the KEY There are two reasons for the ‘key’ portion of the item. First, it allows you to turn off the built-in, default templates, which are: FILE = Add File (generic, empty file) VB = Add VB Class CS = Add C# Class (includes some basic usings) HTML = Add HTML page (includes basic structure, doctype, etc) JS = Add Script (includes an immediately-invoking function closure) To turn one off, just include a file with the name “_<KEY>”. For example, to turn off all the items except our custom one, you do this: The other reason for the key is that there are new Visual Studio Commands created for each one. This makes it possible to bind a keyboard shortcut to one of them. So you could, for example, have a keyboard combination that adds a new web page to your website, or a new CS class to your class library, etc. Here is our sample item showing up in the keyboard bindings option. Even though the contents of the template directory may change from one launch of Visual Studio to the next, the bindings will remain attached to any item with a particular key, thanks to it taking care not to lose keyboard bindings even though the commands are completely recreated each time. The Icon Face ID Visual Studio uses a Microsoft Office style add-in mechanism, I gather. There are a predetermined set of built-in icons available. You can use your own icons when developing add-ins, of course, but I’m no designer. I just wanted to find appropriate-ish icons for the built-in templates, and allow you to choose from an existing built-in icon for your own. Unfortunately, there isn’t a lot out there on the interwebs that helps you figure out what the built-in types are. There’s an MSDN article that describes at length a way to create a program that lists all the icons. But I don’t want to write a program to figure them out! Just show them to me! Sheesh :) Thankfully, someone out there felt the same way, and uses a novel hack to get the icons to show up in an outlook toolbar. He then painstakingly took screenshots of them, one group at a time. It isn’t complete though – there are tens of thousands of icons. But it’s good enough. If anyone has an exhaustive list, please let me, and the rest of the add-in community know. Icon Face ID Reference Installing the Add-in It will work with Visual Studio 2008 and Visual Studio 2010. Just unzip the release into your Documents\Visual Studio 20xx\Addins folder. It contains the binary and the Visual Studio “.addin” file. For example, the path to mine is: C:\Users\InfinitiesLoop\Documents\Visual Studio 2010\Addins Conclusion So that’s it! I hope you find it as useful as I have. It’s on GitHub, so if you’re into this kind of thing, please do fork it and improve it! Reference: VSNewFile on GitHub VSNewFile release on GitHub Icon Face ID Reference

    Read the article

< Previous Page | 343 344 345 346 347 348 349 350 351 352 353 354  | Next Page >