Search Results

Search found 9217 results on 369 pages for 'cross apply'.

Page 35/369 | < Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >

  • Using a Cross Thread Boolean to Abort Thread

    - by Jon
    Possible Duplicate: Can a C# thread really cache a value and ignore changes to that value on other threads? Lets say we have this code: bool KeepGoing = true; DataInThread = new Thread(new ThreadStart(DataInThreadMethod)); DataInThread.Start(); //bla bla time goes on KeepGoing = false; private void DataInThreadMethod() { while (KeepGoing) { //Do stuff } } } Now the idea is that using the boolean is a safe way to terminate the thread however because that boolean exists on the calling thread does that cause any issue? That boolean is only used on the calling thread to stop the thread so its not like its being used elsewhere

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • how to apply group by on xslt elements

    - by Amit
    Hello All, I need to group the value based on some attribute and populate it. below mentioned is i/p xml and if you see there are 4 rows for Users and for id 2,4 Division is same i.e. HR while generating actual o/p I need to group by Division ... Any help ??? I/P XML <Users> <User id="2" name="ABC" Division="HR"/> <User id="3" name="xyz" Division="Admin"/> <User id="4" name="LMN" Division="Payroll"/> <User id="5" name="PQR" Division="HR"/> </Users> expected Result: I need to group the values based on Division and populate i.e. <AllUsers> <Division value="HR"> <User> <id>2</id> <name>ABC</name> </User> <User> <id>5</id> <name>PQR</name> </User> </Division> <Division value="ADMIN"> <User> <id>3</id> <name>XYZ</name> </User> </Division> <Division value="Payroll"> <User> <id>4</id> <name>LMN</name> </User> </Division> </AllUsers>

    Read the article

  • asp.net state server session - cross appDomain?

    - by newone1
    When using a State server for session, are sessions still appDomain specific? So for example, I have two different IIS applications(virtual directories) on a web server, and they both point to one state server for session. The session guid from the cookie will be the same across requests from both applications, so will the same session be accessible across both of these applications? Thanks.

    Read the article

  • CRC for cross platform applications

    - by Kangkan
    I wish to use a common CRC logic in a VB.NEt or C# application as well as on a c/Linux application. I have one c/Linux application that interacts with some webservice (c#) and also a web application (VB.NET). For some data, I want to put a CRC to be added to the data itself (say a flie) from the .NET side and check for the integrity of the data (checking the CRC) on the client and also the vice versa. Can somebody please guide me?

    Read the article

  • SQL Server: Cross-tabulation, please help

    - by user335160
    I want to achieve the results shown in the attached image. The table structure and data are: Table relationship: Facility Limit -> one to many -> Facility Sub Limit Tables structure and data Facility Limit Id OverallIBLimitId Product Type 1 1 RPA 2 1 CG 3 2 RPA 4 3 CG Facility Sub Limit Id FacilityLimitId Sub-Limit Type Amount Tenor Status Status Date 1 1 RPA at max 2,000,0000.00 2 months Approved January 5, 2011 2 1 Oil 3,000,0000.00 3 yrs Approved January 5, 2011 3 2 CG at minor 4,000,0000.00 1 yr Approved January 5, 2011 4 2 CG at max 5,000,0000.00 6 months Approved January 5, 2011 5 2 Flood Component 1 5,000,0000.00 6 months Approved January 5, 2011 6 2 Flood Component 2 6,000,0000.00 3 yrs Approved January 5, 2011 7 3 RPA at minor 1,000,0000.00 6 months Approved January 5, 2011 8 4 One-Off 1,000,0000.00 6 months Approved January 5, 2011

    Read the article

  • Approaches for cross server content sharing?

    - by Anonymity
    I've currently been tasked with finding a best solution to serving up content on our new site from another one of our other sites. Several approaches suggested to me, that I've looked into include using SharePoint's Lists Web Service to grab the list through javascript - which results in XSS and is not an option. Another suggestion was to build a server side custom web service and use SharePoint Request Forms to get the information - this is something I've only very briefly looked at. It's been suggested that I try permitting the requesting site in the HTTP headers of the serving site since I have access to both. This ultimately resulted in a semi-working solution that had major security holes. (I had to include username/password in the request to appease AD Authentication). This was done by allowing Access-Control-Allow-Origin: * The most direct approach I could think of was to simply build in the webpart in our new environment to have the authors manually update this content the same as they would on the other site. Are any one of the suggestions here more valid than another? Which would be the best approach? Are there other suggestions I may be overlooking? I'm also not sure if WebCrawling or Content Scrapping really holds water here...

    Read the article

  • Qt cross thread call

    - by QLatvia
    I have a Qt/C++ application, with the usual GUI thread, and a network thread. The network thread is using an external library, which has its own select() based event loop... so the network thread isn't using Qt's event system. At the moment, the network thread just emit()s signals when various events occur, such as a successful connection. I think this works okay, as the signals/slots mechanism posts the signals correctly for the GUI thread. Now, I need for the network thread to be able to call the GUI thread to ask questions. For example, the network thread may require the GUI thread to request put up a dialog, to request a password. Does anyone know a suitable mechanism for doing this? My current best idea is to have the network thread wait using a QWaitCondition, after emitting an object (emit passwordRequestedEvent(passwordRequest);. The passwordRequest object would have a handle on the particular QWaitCondition, and so can signal it when a decision has been made.. Is this sort of thing sensible? or is there another option?

    Read the article

  • Ruby on Rails: What are Erubis' disadvantages and why isn't it packaged with Rails by default? How t

    - by williamjones
    I just discovered Erubis, a replacement for the default view renderer for Ruby on Rails. However, from what I can tell from reading about it, it's superior across the board. It is much faster. It has many more options. It can prevent cross site scripting without having to use h. Does this have any disadvantages versus the standard erb renderer? Why isn't this the standard renderer packaged with Rails? Also, the docs for Erubis say to install it just by installing the gem, and then add the following to environment.rb: require 'erubis/helpers/rails_helper' #Erubis::Helpers::RailsHelper.engine_class = Erubis::Eruby # or Erubis::FastEruby Reading the docs, FastEruby seems to be just a faster renderer than Eruby. Why wouldn't it be default and used by everyone? I'm highly interested in using the engine erubis::EscapedEruby which automatically calls h to escape html on fields from the database. Are there any gotchas I should be aware of or does this pretty much solve all cross site scripting?

    Read the article

  • Cross domain ajax POST ie7 with jquery

    - by DickieBoy
    been having trouble with this script, ive managed to get it working in ie8, works on chrome fine. initilize: function(){ $('#my_form').submit(function(){ if ($.browser.msie && window.XDomainRequest) { var data = $('#my_form').serialize(); xdr=new XDomainRequest(); function after_xhr_load() { response = $.parseJSON(xdr.responseText); if(response.number =="incorrect format"){ $('#errors').html('error'); } else { $('#errors').html('worked'); } } xdr.onload = after_xhr_load; xdr.open("POST",$('#my_form').attr('action')+".json"); xdr.send(data); } else { $.ajax({ type: "POST", url: $('#my_form').attr('action')+".json", data: $('#my_form').serialize(), dataType: "json", complete: function(data) { if(data.statusText =="OK"){ $('#errors').html('error'); } if(data.statusText =="Created"){ response = $.parseJSON(data.responseText); $('#errors').html('Here is your code:' +response.code); } } }); } return false; }); } I understand that ie7 does not have the XDomainRequest() object. How can I replicate this in ie7. Thanks, in advance

    Read the article

  • Android Bluetooth Cross Platform Interoperability

    - by Philipp
    Hi, I have a Bluetooth service that I programmed for .Net on a Windows machine and I would like my Android 2.1 phone to connect to it. The server is listening for the same UUID which the Android is using to connect. But the connection is failing. When I try to connect to devices that are not listening for that UUID, I get an exception with the message "Service discovery failed", but when I try to connect to the server that is listening for the right UUID a message box pops up saying: "There was a problem pairing with bluetooth device." And I get an exception with the message "Connection timed out." So it looks like the server and the Android are communicating, but there is some sort of failure during handshaking. I know that the Android requires that the server is paired with the phone and also encrypts the communication channel. Does anyone know which specifications are used to do this? I would love to get my server to respond properly to the connection attempt. Thanks!

    Read the article

  • Drupal administration theme doesn't apply to Blocks pages (admin/build/block)

    - by hfidgen
    A site I'm creating for a customer in D6 has various images overlaying parts of the main content area. It looks very pretty and they have to be there for the general effect. The problem is, if you use this theme in the administration pages, the images get in the way of everything. My solution was to create a custom admin theme, based on the default one, which has these image areas disabled in the output template files - page.tpl.php The problem is that when you try and edit the blocks page, it uses the default theme and half the blocks admin settings are unclickable behind the images. I KNOW this is by design in Drupal, but it's annoying the hell out of me and is edging towards "bug" rather than "feature" in my mind. It also appears that there is no way of getting around it. You can edit /modules/blocks/block.admin.inc to force Drupal to show the blocks page in the chosen admin theme. BUT whichever changes you then make will not be transferred to the default theme, as Drupal treats each theme separately and each theme can have different block layouts. :x function block_admin_display($theme = NULL) { global $custom_theme; // If non-default theme configuration has been selected, set the custom theme. // $custom_theme = isset($theme) ? $theme : variable_get('theme_default', 'garland'); // Display admin theme $custom_theme = variable_get('admin_theme', '0'); // Fetch and sort blocks $blocks = _block_rehash(); usort($blocks, '_block_compare'); return drupal_get_form('block_admin_display_form', $blocks, $theme); } Can anyone help? the only thing I can think of is to push the $content area well below the areas where the image appear and use blocks only for content display. Thanks!

    Read the article

  • MySQL cross table regular expression match

    - by Josef Sábl
    I have a web application and I am working on engine that analyzes referals. Now I have table with pageviews along with referes that looks something like this: pv_id referer ------------------------------------------------------------ 5531854534 http://www.google.com/search?ie=UTF-8... 8161876343 http://google.cn/search?search=human+rights 8468434831 http://search.yahoo.com/search;_... The second table contains sources definitions like: source regex ------------------------------------------------------------ Google ^https?:\/\/[^\/]*google\.([a-z]{2,4})(\/.*|)$ Yahoo ^https?:\/\/[^\/]*yahoo\.com(\/.*|)$ What I want is third table created by joinin these two: pv_id source ------------------------------------------------------------ 5531854534 Google 8161876343 Google 8468434831 Yahoo How to join these tables with regular expression?

    Read the article

  • Apply PHP regex replace on a multi-line repeated pattern

    - by Hussain
    Let's say I have this input: I can haz a listz0rs! # 42 # 126 I can haz another list plox? # Hello, world! # Welcome! I want to split it so that each set of hash-started lines becomes a list: I can haz a listz0rs! <ul> <li>42</li> <li>126</li> </ul> I can haz another list plox? <ul> <li>Hello, world!</li> <li>Welcome!</li> </ul> If I run the input against the regex "/(?:(?:(?<=^# )(.*)$)+)/m", I get the following result: Array ( [0] => Array ( [0] => 42 ) [1] => Array ( [0] => 126 ) [2] => Array ( [0] => Hello, world! ) [3] => Array ( [0] => Welcome! ) ) This is fine and dandy, but it doesn't distinguish between the two different lists. I need a way to either make the quantifier return a concatenated string of all the occurrences, or, ideally, an array of all the occurrences. Ideally, this should be my output: Array ( [0] => Array ( [0] => 42 [1] => 126 ) [1] => Array ( [0] => Hello, world! [1] => Welcome! ) ) Is there any way of achieving this, and if not, is there a close alternative? Thanks in advance!

    Read the article

  • Database design: How should I add an information which can apply to several tables

    - by Stefan
    I am constructing a database System using Mysql, this will be an application of about 20 tables. The system contains information on farmers, we work with organic certification and need to record a lot of info for that. In my system, there are related parent-child tables for farmers, producing years and fields/areas - it's a simple representation of the real world in which farmers farm crops on their fields. I now need to add several status flags for each one of these levels: a farmer can be certified, or his field can be, or the specific year can be; each of these flags has several states and can occur a number of times. The obvious solution to this would be to add a child table to every one of these tables, and define the states there. What I wonder if there is an easier way to do this to avoid getting to many tables? Where/how would be best practise to keep that data?

    Read the article

  • How to prepare a codebase for compiling on both Windows and Unix-based systems

    - by Max
    Hi! I am wondering about different solutions to easily compile my cross-platform application for both windows and unix. Right now I am using a makefile on Ubuntu, but before my codebase grows larger I'd like to perform the steps necessary to compile it on Windows, and then continue doing so regularly to see that it still works. I'd preferably not contaminate my SVN codebase repository with multiple "makefile" solutions, such as VC++ solutions and so on, I'd like a more automatic way. I tried using mingw with make for windows, but it seems my secondexpansion awesomeness doesn't work on the Windows version (or something like that). It wouldn't compile, and also complained about _winNT or something like that not being defined. How should I prepare my codebase for cross-platform easy compiling? Things like buildtools, perhaps autogenerate VS file from makefile, or something similar. Some preprocessor magic in a stdinc file perhaps? Thanks!

    Read the article

  • ajax cross-domain requests

    - by yoda
    Hi, Since Ajax requests are limited for security reasons, there's not much to it, just follow the rules eh .. but I've crossed with this : https://developer.mozilla.org/en/Same_origin_policy_for_JavaScript It's written that you can "bypass" those rules, in case you're working with subdomains of the same domain, with the following javascript line : document.domain = "company.com"; I haven't tried it yet, since I don't know if this only works (perfectly works) with any other browser, or at least the major ones. Is it possible? Thanks.

    Read the article

  • No data when attempting to get JSONP data from cross domain PHP script

    - by Alex
    I am trying to pull latitude and longitude values from another server on a different domain using a singe id string. I am not very familiar with JQuery, but it seems to be the easiest way to go about getting around the same origin problem. I am unable to use iframes and I cannot install PHP on the server running this javascript, which is forcing my hand on this. My queries appear to be going through properly, but I am not getting any results back. I was hoping someone here might have an idea that could help, seeing as I probably wouldn't recognize most obvious errors here. My javascript function is: var surl = "http://...omitted.../pull.php"; var idnum = 5a; //in practice this is defined above alert("BEFORE"); $.ajax({ url: surl, data: {id: idnum}, dataType: "jsonp", jsonp : "callback", jsonp: "jsonpcallback", success: function (rdata) { alert(rdata.lat + ", " + rdata.lon); } }); alert("BETWEEN"); function jsonpcallback(rtndata) { alert("CALLED"); alert(rtndata.lat + ", " + rtndata.lon); } alert("AFTER"); When my javascript is run, the BEFORE, BETWEEN and AFTER alerts are displayed. The CALLED and other jsonpcallback alerts are not shown. Is there another way to tell if the jsoncallback function has been called? Below is the PHP code I have running on the second server. I added the count table to my database just so that I can tell when this script is run. Every time I call the javascript, count has had an extra item inserted and the id number is correct. <?php header("content-type: application/json"); if (isset($_GET['id']) || isset($_POST['id'])){ $db_handle = mysql_connect($server, $username, $password); if (!$db_handle) { die('Could not connect: ' . mysql_error()); } $db_found = mysql_select_db($database, $db_handle); if ($db_found) { if (isset($_POST['id'])){ $SQL = sprintf("SELECT * FROM %s WHERE loc_id='%s'", $loctable, mysql_real_escape_string($_POST['id'])); } if (isset($_GET['id'])){ $SQL = sprintf("SELECT * FROM %s WHERE loc_id='%s'", $loctable, mysql_real_escape_string($_GET['id'])); } $result = mysql_query($SQL, $db_handle); $db_field = mysql_fetch_assoc($result); $rtnjsonobj -> lat = $db_field["lat"]; $rtnjsonobj -> lon = $db_field["lon"]; if (isset($_POST['id'])){ echo $_POST['jsonpcallback']. '('. json_encode($rtnjsonobj) . ')'; } if (isset($_GET['id'])){ echo $_GET['jsonpcallback']. '('. json_encode($rtnjsonobj) . ')'; } $SQL = sprintf("INSERT INTO count (bullshit) VALUES ('%s')", $_GET['id']); $result = mysql_query($SQL, $db_handle); $db_field = mysql_fetch_assoc($result); } mysql_close($db_handle); } else { $rtnjsonobj -> lat = 404; $rtnjsonobj -> lon = 404; echo $_GET['jsonpcallback']. '('. json_encode($rtnjsonobj) . ')'; }?> I am not entirely sure if the jsonp returned by this PHP is correct. When I go directly to the PHP script without including any parameters, I do get the following. ({"lat":404,"lon":404}) The callback function is not included, but that much can be expected when it isn't included in the original call. Does anyone have any idea what might be going wrong here? Thanks in advance!

    Read the article

  • Potential problems porting to different architectures

    - by Brendan Long
    I'm writing a Linux program that currently compiles and works fine on x86 and x86_64, and now I'm wondering if there's anything special I'll need to do to make it work on other architectures. What I've heard is that for cross platform code I should: Don't assume anything about the size of a pointer, int or size_t Don't make assumptions about byte order (I don't do any bit shifting -- I assume gcc will optimize my power of two multiplication/division for me) Don't use assembly blocks (obvious) Make sure your libraries work (I'm using SQLite, libcurl and Boost, which all seem pretty cross-platform) Is there anything else I need to worry about? I'm not currently targeting any other architectures, but I expect to support ARM at some point, and I figure I might as well make it work on any architecture if I can. Also, regarding my second point about byte order, do I need to do anything special with text input? I read files with getline(), so it seems like that should be done automatically as well.

    Read the article

  • Jsonp cross-domain ajax

    - by Guillaume le Floch
    I'm working on an application which use ajax call to get html from the server. When I run it on the server, everything works fine. But when I'm running on a localhost, I've a 'Access-Control-Allow-Origin' error. I looked arround and it seems like using jsonp could be the solution. So, my ajax call looks like that: $.ajax({ url: url, dataType: 'jsonp', crossDomain: true, type: 'GET', success: function(data){ // should put the data in a div }, error: function(){ //do some stuff with errors } }); I get html from the server, but I always have this error: Uncaught SyntaxError: Unexpected token < Is there a way to wrap the jsonp response in html? Thanks!

    Read the article

  • How to apply changes without access to svn server

    - by JoelFan
    We are using svn for development of a large web application, and we do periodic updates to production. The production server does not have access to svn (for security reasons). What is the best way to push the changes since the last production release for a new release? We would like to avoid re-creating the whole site each time, since it is very large.

    Read the article

  • wordexp followed by strcpy = EXC_BAD_ACCESS + sharedlibrary apply-load-rules-all

    - by fyngyrz
    The implication is a memory problem. I have static allocations for these: char akdir[400]; char homedir[400]; This crashes on the first strcpy(): void setuplibfoo() { long ii; double x; wordexp_t result; // This obtains the user's home directory // -------------------------------------- homedir[0]=0; // in case wordexp fails switch (wordexp("~/",&result,0)) { case 0: // Successful. We'll fall into deallocate when done. { strcpy(homedir,result.we_wordv[0]); // <<--- CRASH! strcpy(akdir,homedir); strcat(akdir,"ak-plugins/"); vs_status(akdir); } case WRDE_NOSPACE: // If the error was WRDE_NOSPACE, then { // perhaps part of the result was allocated. wordfree (&result); } default: // all other errors do not require deallocation { break; } } ...additional code clipped.. doesn't get there on crash. This is in a shared library I've written that is linked to my application, also something I've written. In this case, it doesn't get very far, although if it starts, it's fine. ...I've read the wordexp docs several times; they say they allocate new objects, so you just set up that type and call them with the address. The switch error model is right from the wordexp docs: http://www.gnu.org/s/libc/manual/html_mono/libc.html#Wordexp-Example It doesn't always crash. Just sometimes, and just under 10.6. Never under 10.5 I'm building debug mode with XCode 3.1.1, under OSX 10.5.8 it seems to run ok, I've not seen a crash -- under 10.6, it crashes... sometimes. But always with that same exception, and always in the same place. The Google has it that this actually means, somehow, that it's too soon to allocate memory. But all the instances I could find were memory errors on the part of the programmer. Overruns, etc. And I can't find any docs on when it IS safe to allocate memory. Now, the path that expands there is nowhere near 400 characters. it's this (it it completes): /Users/flake/ak-plugins/ and this: /Users/flake/ ...if it doesn't. the strcpy... copies 2nd param to first. Theirs to mine. And it works! under 10.5. :/ So is wordexp broke? Is 10.6 broke? Am I cRaZy? Here's the debugger output: 0x00013446 <+0049> call 0xc98da <dyld_stub_wordexp> 0x0001344b <+0054> test %eax,%eax 0x0001344d <+0056> je 0x13454 <setuplibfoo+63> 0x0001344f <+0058> jmp 0x134da <setuplibfoo+197> 0x00013454 <+0063> mov -0x1c(%ebp),%eax 0x00013457 <+0066> mov (%eax),%eax 0x00013459 <+0068> mov %eax,0x4(%esp) 0x0001345d <+0072> lea 0xb6cc2(%ebx),%eax 0x00013463 <+0078> mov (%eax),%eax 0x00013465 <+0080> mov %eax,(%esp) 0x00013468 <+0083> call 0xc9898 <dyld_stub_strcpy> 0x0001346d <+0088> lea 0xb6cc2(%ebx),%eax <<--CRASH!

    Read the article

  • how to apply filters in jsf

    - by johnbritto
    Hi I have filter code Page not Found error while any client request for Jsf Page in my Jsf application.I dont Know How to Fix this issue This is My Filter Code: HttpServletRequest req =(HttpServletRequest)request; HttpServletResponse res =(HttpServletResponse)response; HttpSession ses = req.getSession(true); String pageRequested =req.getRequestURL().toString(); if (ses.getAttribute("userDetails")!=null) { fc.doFilter(request,response); }else{ RequestDispatcher dis = request.getRequestDispatcher(LOGIN_PAGE); dis.forward(request,response); } This code inside the DoFilter Method I done all The settings in Web.xml deployment Descriptor

    Read the article

< Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >