Search Results

Search found 35459 results on 1419 pages for 'string escaping'.

Page 350/1419 | < Previous Page | 346 347 348 349 350 351 352 353 354 355 356 357  | Next Page >

  • Why is the output like this?

    - by javatechi
    class another { public void method(Object o) { System.out.println("This is in method which takes object"); } public void method(String s) { System.out.println("This is method which takes string"); } } public class NewClass { public static void main(String args[]) { another an = new another(); an.method(null); } } When I try to execute this, I get This is method which takes string as the output. Why not "This is in method which takes object"? Object can also be null and string can also be null, why doesn't it invoke first method?

    Read the article

  • Why is the Dependency Property not returning its value?

    - by B-Rad
    I have a MyUserControl with the following Xaml: <TextBox Text="{Binding InputValueProperty}" /> In the MyUserControl.xaml.cs I have: public string InputValue { get { return (string)GetValue(InputValueProperty); } set { SetValue(InputValueProperty, value); } } public static readonly DependencyProperty InputValueProperty = DependencyProperty.Register("InputValueProperty", typeof(string), typeof(MyUserControl)); In my MainWindow.xaml I create a user control: <local:MyUserControl InputValue="My Input" /> Later on in my MainWindow.xaml.cs I am trying to access this string. All instances of MyUserControl are contained in a List and I access them with a foreach. string temp = userControl.InputValue; This is always null. In my MainWindow.xaml I can see the "My Input" in the text box of the user control but I can't ever seem to get it out of there.

    Read the article

  • Perl: Greedy nature refuses to work

    - by faezshingeri
    I am trying to replace a string with another string, but the greedy nature doesn't seem to be working for me. Below is my code where "PERFORM GET-APLCY" is identified and replaced properly, but string "PERFORM GET-APLCY-SOI-CVG-WVR" and many other such strings are being replaced by the the replacement string for "PERFORM GET-APLCY". s/PERFORM $func[$i]\.?/# PERFORM $func[$i]\.\n $hash{$func[$i]}/g; where the full stop is optional during string match and replacement. Please help me understand what the issue could be. Thanks in advance, Faez

    Read the article

  • suppose there is a class which contains 4 data fields.i have to read these value from xml file and s

    - by SunilRai86
    suppose there is a class which contains 4 fields.i have to read these value from xml file and set that value to fields the xml file is like that <Root> <Application > <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>ABC</ClassName> <ExecName>XYZ</ExecName> </Application> <Application> <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>abc</ClassName> <ExecName>xyz</ExecName> </Application> </Root> now i have to read all the values from xml file and set each value to particular fields. i hav done reading of the xml file and i saved the retrieved value in arraylist. the code is like that public class CXmlFileHook { string appname; string classname; string idmark; string execname; string ctor; public CXmlFileHook() { this.appname = "Not Set"; this.idmark = "Not Set"; this.classname = "Not Set"; this.execname = "Not Set"; this.ctor = "CXmlFileHook()"; } public void readFromXmlFile(string path) { XmlTextReader oRreader = new XmlTextReader(@"D:\\Documents and Settings\\sunilr\\Desktop\\MLPACK.xml"); //string[] strNodeValues = new string[4] { "?","?","?","?"}; ArrayList oArrayList = new ArrayList(); while (oRreader.Read()) { if (oRreader.NodeType == XmlNodeType.Element) { switch (oRreader.Name) { case "AppName": oRreader.Read(); //strNodeValues[0] =oRreader.Value; oArrayList.Add(oRreader.Value); break; case "IdMark": oRreader.Read(); //strNodeValues[1] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ClassName": oRreader.Read(); //strNodeValues[2] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ExecName": oRreader.Read(); //strNodeValues[3] = oRreader.Value; oArrayList.Add(oRreader.Value); break; } } } Console.WriteLine("Reading from arraylist"); Console.WriteLine("-------------------------"); for (int i = 0; i < oArrayList.Count; i++) { //Console.WriteLine("Reading from Sting[]"+ strNodeValues[i]); Console.WriteLine(oArrayList[i]); } //this.appname = strNodeValues[0]; //this.idmark = strNodeValues[1]; //this.classname = strNodeValues[2]; //this.execname = strNodeValues[3]; this.appname = oArrayList[0].ToString(); this.idmark = oArrayList[1].ToString(); this.classname = oArrayList[2].ToString(); this.execname = oArrayList[3].ToString(); } static string vInformation; public void showCurrentState(string path) { FileStream oFileStream = new FileStream(path, FileMode.Append, FileAccess.Write); StreamWriter oStreamWriter = new StreamWriter(oFileStream); oStreamWriter.WriteLine("****************************************************************"); oStreamWriter.WriteLine(" Log File "); oStreamWriter.WriteLine("****************************************************************"); CXmlFileHook oFilehook = new CXmlFileHook(); //Type t = Type.GetType(this._classname); //Type t = typeof(CConfigFileHook); DateTime oToday = DateTime.Now; vInformation += "Logfile created on : "; vInformation += oToday + Environment.NewLine; vInformation += "Public " + Environment.NewLine; vInformation += "----------------------------------------------" + Environment.NewLine; vInformation += "Private " + Environment.NewLine; vInformation += "-----------------------------------------------" + Environment.NewLine; vInformation += "ctor = " + this.ctor + Environment.NewLine; vInformation += "appname = " + this.appname + Environment.NewLine; vInformation += "idmark = " + this.idmark + Environment.NewLine; vInformation += "classname = " + this.classname + Environment.NewLine; vInformation += "execname = " + this.execname + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; vInformation += "Protected" + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; oStreamWriter.WriteLine(vInformation); oStreamWriter.Flush(); oStreamWriter.Close(); oFileStream.Close(); } } here i set set the fields according to arraylist index but i dont want is there any another solution for this....

    Read the article

  • Casting complex class into a dataset?

    - by iTayb
    This is the class I'm trying to turn into a dataset: public class BookStore { private List<Book> booksList; } public class Book { private string name; private string imageurl; private string subject; private string author; private int level; private int year; private int rating; private List<string> booksellers; private List<decimal> bookprices; } There are proprieties, of course. How can I turn it into a dataset? Thank you very much.

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • call method from main class, gives error

    - by user557039
    try to call method ss from class from it return me error, Blockquote Exception in thread "main" java.lang.NullPointerException at teste1.exp.ss(exp.java:16) at teste1.Main.main(Main.java:64) Java Result: 1 Blockquote <pre> public class Main { public static void main(String[] arguments) { ................... private static String[] ff; exp mega = new exp(); mega.ss(ff); } class exp { public void ss (String gvanswer[]){ String answer[] = new String[3]; answer[0] = "pacific "; answer[1] = "everest"; answer[2] = "amazon "; if (gvnswer[0].equals("pacific")) {System.out.println("eeeeeeeeeeeeee ");} if (gvanswer[1].equals(answer[1])){System.out.println("l ");} }

    Read the article

  • loop for Cursor1.moveToPosition() in android

    - by Edward Sullen
    I want to get data in the first column of all row from my database and convert to String[] ... List<String> item1 = new ArrayList<String>(); // c is a cursor which pointed from a database for(int i=0;i<=nombre_row;i++) { c.moveToPosition(i); item1.add(c.getString(0)); } String[] strarray = new String[item1.size()]; item1.toArray(strarray ); I've tried to command step by step, and found that the problem is in the Loop for.... Please help... thanks in advance for all answer.

    Read the article

  • Is it bad practice to initialize a variable to a dummy value?

    - by froadie
    This question is a result of the answers to this question that I just asked. It was claimed that this code is "ugly" because it initializes a variable to a value that will never be read: String tempName = null; try{ tempName = buildFileName(); } catch(Exception e){ ... System.exit(1); } FILE_NAME = tempName; Is this indeed bad practice? Should one avoid initializing variables to dummy values that will never actually be used? (EDIT - And what about initializing a String variable to "" before a loop that will concatenate values to the String...? Or is this in a separate category? e.g. String whatever = ""; for(String str : someCollection){ whatever += str; } )

    Read the article

  • USB device Set Attribute in C#

    - by p19lord
    I have this bit of code: DriveInfo[] myDrives = DriveInfo.GetDrives(); foreach (DriveInfo myDrive in myDrives) { if (myDrive.DriveType == DriveType.Removable) { string path = Convert.ToString(myDrive.RootDirectory); DirectoryInfo mydir = new DirectoryInfo(path); String[] dirs = new string[] {Convert.ToString(mydir.GetDirectories())}; String[] files = new string[] {Convert.ToString(mydir.GetFiles())}; foreach (var file in files) { File.SetAttributes(file, ~FileAttributes.Hidden); File.SetAttributes(file, ~FileAttributes.ReadOnly); } foreach (var dir in dirs) { File.SetAttributes(dir, ~FileAttributes.Hidden); File.SetAttributes(dir, ~FileAttributes.ReadOnly); } } } I have a problem. It is trying the code for Floppy Disk drive first which and because no Floppy disk in it, it threw the error The device is not ready. How can I prevent that?

    Read the article

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

  • JPA Native Query (SQL View)

    - by Uchenna
    I have two Entities Customer and Account. @Entity @Table(name="customer") public class Customer { private Long id; private String name; private String accountType; private String accountName; ... } @Entity @Table(name="account") public class Account { private Long id; private String accountName; private String accountType; ... } i have a an sql query select a.id as account_id, a.account_name, a.account_type, d.id, d.name from account a, customer d Assumption account and customer tables are created during application startup. accountType and accountName fields of Customer entity should not be created. That is, only id and name columns will be created. Question How do i run the above sql query and return a Customer Entity Object with the accountType and accountName properties populated with sql query's account_name and account_type values. Thanks

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • Methods specific only to an instance? What are they called in Ruby?

    - by daremarkovic
    I know there are "instance methods", "class methods" but what are these types of methods called, for eg: s1 = "This is my STRING!" def s1.m1 downcase end p s1 # => "This is my STRING!" p s1.m1 # => "this is my string!" What type of method is the "m1" method called on the s1 "instance" of the "string" class? It's really weird because I didn't know this was possible at all if I try: s2 = "This is ANOTHER string" s2.m1 # => Won't work! Which kind of makes sense, but not sure why defining methods like m1 on instances on a class are useful at all.

    Read the article

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • error message fix

    - by user1722654
    for (int i = 0; i < dataGridView1.Rows.Count; i++) { //bool sleected = false; if (dataGridView1.Rows[i].Cells[3].Value != null) { selected.Add(i); } } //string donew = ""; // line off error textBox1.Text = ((String)dataGridView1.Rows[1].Cells[2].Value); /* for (int i = 0; i < selected.Count; i++) { textAdded.Add((String)dataGridView1.Rows[0].Cells[2].Value); // donew += (String)dataGridView1.Rows[selected[i]].Cells[2].Value; }*/ I keep getting the error Unable to cast object of type 'System.Double' to type 'System.String' What can I do to overcome this?

    Read the article

  • Problem in populating a dictionary object using Enumerable.Range() (C#3.0)

    - by Newbie
    If I do for (int i = 0; i < appSettings.Count; i++) { string key = appSettings.Keys[i]; euFileDictionary.Add(key, appSettings[i]); } It is working fine. When I am trying the same thing using Enumerable.Range(0, appSettings.Count).Select(i => { string Key = appSettings.Keys[i]; string Value = appSettings[i]; euFileDictionary.Add(Key, Value); }).ToDictionary<string,string>(); I am getting a compile time error The type arguments for method 'System.Linq.Enumerable.Select(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. Any idea? Using C#3.0 Thanks

    Read the article

  • Python "string_escape" vs "unicode_escape"

    - by Mike Boers
    According to the docs, the builtin string encoding string_escape: Produce[s] a string that is suitable as string literal in Python source code ...while the unicode_escape: Produce[s] a string that is suitable as Unicode literal in Python source code So, they should have roughly the same behaviour. BUT, they appear to treat single quotes differently: >>> print """before '" \0 after""".encode('string-escape') before \'" \x00 after >>> print """before '" \0 after""".encode('unicode-escape') before '" \x00 after The string_escape escapes the single quote while the Unicode one does not. Is it safe to assume that I can simply: >>> escaped = my_string.encode('unicode-escape').replace("'", "\\'") ...and get the expected behaviour?

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • parse json news feed array android

    - by user1827260
    I have an json feed from bbc in this format { "name": "ticker", "entries": [ { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, etc........... My code is as follows: ArrayList mylist = new ArrayList(); JSONObject json = JSONfunctions.getJSONfromURL("http:/......"); try{ JSONArray item = json.getJSONArray("entries"); for (int i = 0; i<item.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); JSONObject e = item.getJSONObject(i); JSONObject title = e.JSONObject("headline"); map.put("title", "Title:" + e.getString("headline"); } It gives me the error "java.lang.String cannot be converted to JSONObject" I also tried leaving out JSONObject title = e.JSONObject("headline"); and it gives me a path error (note

    Read the article

  • How to validate phone number(US format) in Java?

    - by Maxood
    I just want to know where am i wrong here: import java.io.*; class Tokens{ public static void main(String[] args) { //String[] result = "this is a test".split(""); String[] result = "4543 6546 6556".split(""); boolean flag= true; String num[] = {"0","1","2","3","4","5","6","7","8","9"}; String specialChars[] = {"-","@","#","*"," "}; for (int x=1; x<result.length; x++) { for (int y=0; y<num.length; y++) { if ((result[x].equals(num[y]))) { flag = false; continue; } else { flag = true; } if (flag == true) break; } if (flag == false) break; } System.out.println(flag); } }

    Read the article

  • Obtaining Index value of dictionary

    - by Maudise
    I have a piece of code which looks at the following public Test As Dictionary(Of String, String()) Which is brought in tester = New Dictionary(Of String, String()) tester.add("Key_EN", {"Option 1_EN", "Option 2_EN", "Option 3_EN"}) tester.add("Key_FR", {"Option 1_FR", "Option 2_FR", "Option 3_FR"}) tester.add("Key_DE", {"Option 1_DE", "Option 2_DE", "Option 3_DE"}) There's then a combo box which looks at the following dim Language as string Language = "_EN" ' note this is done by a drop down combo box to select _EN or _FR etc. cboTestBox.items.AddRange(tester("Key" & Language)) What I need to be able to do is to see what index position the answer is in and convert it back to the Key_EN. So, for example _DE is selected, then the options of "Option 1_DE", "Option 2_DE", "Option 3_DE" would be displayed. If they chose Option 3_DE then I need to be able to convert this to Option 3_EN. Many thanks Maudise

    Read the article

  • Java spliting strings

    - by N0b
    Hi I've got a Java problem. I'm trying split a string when ever a " " occurs, for example the sentence test abc. Then move the first letter in each word from first to last. I got the moving the letter to work on the original string using String text = JOptionPane.showInputDialog(null,"Skriv in en normal text:"); char firstLetter = text.charAt(0); normal = text.substring(1,text.length()+0) + firstLetter; So my question is how would I split the string then start moving the letters around in each part of the cut string? Thanks in advance

    Read the article

< Previous Page | 346 347 348 349 350 351 352 353 354 355 356 357  | Next Page >