Search Results

Search found 61241 results on 2450 pages for 'empty set'.

Page 351/2450 | < Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Nhibernate beginner - asking for directions

    - by George
    Hello guys. I'm starting off with NHibernate now and I still don't have a testable environment. I would like to know from you, experienced fellows if there is a problem to map IList to an Set in .hbm file. Like this: //c# IList<TrechoItem> trechos_item; <!-- xml .hbm --> <set name="TrechosItem" table="trecho_item" lazy="true" inverse="true" fetch="select"> <key column="id_item"/> <one-to-many class="TrechoItem"/> </set> Or, in this: IList<Autor> Autores; <set name="Autores" lazy="true" table="item_possui_autor"> <key column="id_item"/> <many-to-many class="Autor" column="id_autor"/> </set> Is this possible? Or am I doing the wrong thing? I tried using and but these did not gave me all the options in . Thanks in advanced

    Read the article

  • Rails more statements with ; doesnt work... :s

    - by user305270
    I have this code, but i cant make it work: images = Image.find_by_sql('PREPARE stmt FROM \' SELECT * FROM images AS i WHERE i.on_id = 1 AND i.on_type = "profile" ORDER BY i.updated_at LIMIT ?, 6\'; SET @lower_limit := ((5 DIV 6) * 6); EXECUTE stmt USING @lower_limit;') I got this error: Mysql::Error: You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'SET @lower_limit := ((5 DIV 6) * 6); EXECUTE stmt USING @lower_limit' at line 1: PREPARE stmt FROM ' SELECT * FROM images AS i WHERE i.on_id = 1 AND i.on_type = "profile" ORDER BY i.updated_at LIMIT ?, 6'; SET @lower_limit := ((5 DIV 6) * 6); EXECUTE stmt USING @lower_limit; but if i use a sql app, like this, it works: PREPARE stmt FROM ' SELECT * FROM images AS i WHERE i.on_id = 1 AND i.on_type = "profile" ORDER BY i.updated_at LIMIT ?, 6'; SET @lower_limit := ((5 DIV 6) * 6); EXECUTE stmt USING @lower_limit;

    Read the article

  • SQl Server: serializable level not working

    - by Zé Carlos
    I have the following SP: CREATE PROCEDURE [dbo].[sp_LockReader] AS BEGIN SET NOCOUNT ON; begin try set transaction isolation level serializable begin tran select * from teste commit tran end try begin catch rollback tran set transaction isolation level READ COMMITTED end catch set transaction isolation level READ COMMITTED END The table "test" has many values, so "select * from teste" takes several seconds. I run the sp_LockReader at same time in two diferent query windows and the second one starts showing test table contents without the first one terminates. Shouldn't serializeble level forces the second query to wait? How do i get the described behaviour? Thanks

    Read the article

  • Java SOAP WSDL 1.1 message sending all the parameters (even future ones)

    - by Eduardo
    I have to communicate with a SOAP Web Service defined in a WSDL 1.1. All the parameters are optional in the WSDL like: <xsd:element name="Submitter" type="xsd:string"/> but if I do not send them I get an error because the parameter was not sent, so instead I have to send an empty string for any parameter I do not intent to send. So instead of not sending the element I have to send: <Submitter></Submitter> The problem is that the WebService publisher does not have any problem adding new parameters at any point in time but I must sent at least an empty string for all the parameters. How may I call this WebService in Java so every time I call the WebService the WSDL is read so that all the parameters are sent having the parameters I care for are actually filled with the data I provide? I am currently using Apache CXF but I am open to anything to solve this problem.

    Read the article

  • Asp.Net MVC - Binding of parameter to model value!

    - by Pino
    This seems like the model binding is causing me issues. Essentially I have a model called ProductOption and for the purpose of this question it has 2 fields ID (Int) PK ProductID (Int) FK I have a standard route set-up context.MapRoute( "Product_default", "Product/{controller}/{action}/{id}", new { controller = "Product", action = "Index", id = UrlParameter.Optional } ); and if the user wants to add an option the URL is, /Product/Options/Add/1 in the above URL 1 is the ProductID, I have the following code to return a blank model the the view, [HttpGet] public ActionResult Add(int id) { return View("Manage", new ProductOptionModel() { ProductID = id }); } Now in my view I keep a hidden field <%= Html.HiddenFor(x=>x.ID) %> This is used to determine (on submit) if we are editing or adding a new option. However the Model binder in .net seems to replace .ID (Which was 0 when leaving the above get actionresult) with 1 (or the value of the id parameter in the URL) How can I stop or work around this? ViewModel public class ProductExtraModel { //Database public int ID { get; set; } public string Name { get; set; } public int ProductID { get; set; } public ProductModel Product { get; set; } }

    Read the article

  • Range annotation between nothing and 100?

    - by aticatac
    Hi I have a [Range] annotation that looks like this: [Range(0, 100)] public int AvailabilityGoal { get; set; } It works as it should, I can only enter values between 0 and 100 but I also want the input box to be optional, the user shouldn't get an validation error if the input box is empty. If the user leaves it empty it should make AvailabilityGoal = 0 but I don't want to force the user to enter a zero. I tried this but it (obviously) didn't work: [Range(typeof(int?), null, "100")] Is it possible to solve this with Data Annotations or in some other way? Thanks in advance. Bobby

    Read the article

  • Adding defaults and indexes to a script/generate command in a Rails Template?

    - by charliepark
    I'm trying to set up a Rails Template that would allow for comprehensive set-up of a specific Rails app. Using Pratik Naik's overview (http://m.onkey.org/2008/12/4/rails-templates), I was able to set up a couple of scaffolds and models, with a line that looks something like this ... generate("scaffold", "post", "title:string", "body:string") I'm now trying to add in Delayed Jobs, which normally has a migration file that looks like this: create_table :delayed_jobs, :force => true do |table| table.integer :priority, :default => 0 # Allows some jobs to jump to the front of the queue table.integer :attempts, :default => 0 # Provides for retries, but still fail eventually. table.text :handler # YAML-encoded string of the object that will do work table.text :last_error # reason for last failure (See Note below) table.datetime :run_at # When to run. Could be Time.now for immediately, or sometime in the future. table.datetime :locked_at # Set when a client is working on this object table.datetime :failed_at # Set when all retries have failed (actually, by default, the record is deleted instead) table.string :locked_by # Who is working on this object (if locked) table.timestamps end So, what I'm trying to do with the Rails template, is to add in that :default = 0 into the master template file. I know that the rest of the template's command should look like this: generate("migration", "createDelayedJobs", "priority:integer", "attempts:integer", "handler:text", "last_error:text", "run_at:datetime", "locked_at:datetime", "failed_at:datetime", "locked_by:string") Where would I put (or, rather, what is the syntax to add) the :default values in that? And if I wanted to add an index, what's the best way to do that?

    Read the article

  • Using Excel VBA to Create SQL Tables

    - by user307655
    Hi All, I am trying to use Excel VBA to automate the creation of a SQL table in an existing SQL Database. I have come across the following code on this side. Private Sub CreateDatabaseFromExcel() Dim dbConnectStr As String Dim Catalog As Object Dim cnt As ADODB.Connection Dim dbPath As String Dim tblName As String 'Set database name in the Excel Sheet dbPath = ActiveSheet.Range("B1").Value 'Database Name tblName = ActiveSheet.Range("B2").Value 'Table Name dbConnectStr = "Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" & dbPath & ";" 'Create new database using name entered in Excel Cell ("B1") Set Catalog = CreateObject("ADOX.Catalog") Catalog.Create dbConnectStr Set Catalog = Nothing 'Connect to database and insert a new table Set cnt = New ADODB.Connection With cnt .Open dbConnectStr .Execute "CREATE TABLE tblName ([BankName] text(50) WITH Compression, " & _ "[RTNumber] text(9) WITH Compression, " & _ "[AccountNumber] text(10) WITH Compression, " & _ "[Address] text(150) WITH Compression, " & _ "[City] text(50) WITH Compression, " & _ "[ProvinceState] text(2) WITH Compression, " & _ "[Postal] text(6) WITH Compression, " & _ "[AccountAmount] decimal(6))" End With Set cnt = Nothing End Sub However i can't successfully get it to work? What I am trying to do is actually use Excel to create a table not a database? The database already exists. I would just like to create a new table. The name of the table will be referenced from cell A1 in Sheet 1. Can somebody please help. Thanks Regards Gerard

    Read the article

  • adding Buttons to Columns in Datagride view

    - by kasunmit
    HiHi, I wrote C# application for import unread e-mails from outlook 2007, I could import sender name, sender mail address,subject and body to data grid view as following foreach (Microsoft.Office.Interop.Outlook._MailItem mailItem in fldEmails.Items) { if (mailItem.UnRead) { UnreadEmails mail = new UnreadEmails(); // mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : mailItem.Attachments.Session.OpenSharedItem; foreach (Microsoft.Office.Interop.Outlook.Attachment Atmt in mailItem.Attachments) { mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : Atmt.DisplayName; } emails.Add(mail); } } UnreadEmails is a separte class. but couldn't find a way to import attachments (word pdf ppt excel) because i need it for my filter pls help me about it but i could import inly name of the attachment but i need to import attachment content (word, pdf , ppt .. atc. ) to this data grid pls tell how i can do it ... with the code

    Read the article

  • finding subfolder of a folder getting by getFolder method in asp

    - by Abhisheks.net
    hello guys, i am troubling from this problem , i want to find the list of folder but there is some problem , i have a support folder in root directory, first i have the subfolder of this "Support" folder then in each folder i have to find a specific say "x" folder and then in this x folder i want to check each file and folder. i am sending here code . please help me .... dim fs, fso, fo, s, x, f, filePath, a, sfPath set fs=Server.CreateObject("Scripting.FileSystemObject") set fo=fs.GetFolder(Server.MapPath("support/")) a = Split(pSku,"-",-1) for each x in fo.SubFolders sfPath= "support/" + x.Name + "/" + a(0) + "/" 'a(0) contains a folder name set s = fs.GetFolder(server.MapPath(sfPath)) set s = nothing next Please tell me solution ..

    Read the article

  • Linq - How to collect Anonymous Type as Result for a Function

    - by GibboK
    I use c# 4 asp.net and EF 4. I'm precompiling a query, the result should be a collection of Anonymous Type. At the moment I use this code. public static readonly Func<CmsConnectionStringEntityDataModel, string, dynamic> queryContentsList = CompiledQuery.Compile<CmsConnectionStringEntityDataModel, string, dynamic> ( (ctx, TypeContent) => ctx.CmsContents.Where(c => c.TypeContent == TypeContent & c.IsPublished == true & c.IsDeleted == false) .Select(cnt => new { cnt.Title, cnt.TitleUrl, cnt.ContentId, cnt.TypeContent, cnt.Summary } ) .OrderByDescending(c => c.ContentId)); I suspect the RETURN for the FUNCTION Dynamic does not work properly and I get this error Sequence contains more than one element enter code here. I suppose I need to return for my function a Collection of Anonymous Types... Do you have any idea how to do it? What I'm doing wrong? Please post a sample of code thanks! Update: public class ConcTypeContents { public string Title { get; set; } public string TitleUrl { get; set; } public int ContentId { get; set; } public string TypeContent { get; set; } public string Summary { get; set; } } public static readonly Func<CmsConnectionStringEntityDataModel, string, ConcTypeContents> queryContentsList = CompiledQuery.Compile<CmsConnectionStringEntityDataModel, string, ConcTypeContents>( (ctx, TypeContent) => ctx.CmsContents.Where(c => c.TypeContent == TypeContent & c.IsPublished == true & c.IsDeleted == false) .Select(cnt => new ConcTypeContents { cnt.Title, cnt.TitleUrl, cnt.ContentId, cnt.TypeContent, cnt.Summary }).OrderByDescending(c => c.ContentId));

    Read the article

  • NHibernate / Fluent - Mapping multiple objects to single lookup table

    - by Al
    Hi all I am struggling a little in getting my mapping right. What I have is a single self joined table of look up values of certain types. Each lookup can have a parent, which can be of a different type. For simplicities sake lets take the Country and State example. So the lookup table would look like this: Lookups Id Key Value LookupType ParentId - self joining to Id base class public class Lookup : BaseEntity { public Lookup() {} public Lookup(string key, string value) { Key = key; Value = value; } public virtual Lookup Parent { get; set; } [DomainSignature] [NotNullNotEmpty] public virtual LookupType LookupType { get; set; } [NotNullNotEmpty] public virtual string Key { get; set; } [NotNullNotEmpty] public virtual string Value { get; set; } } The lookup map public class LookupMap : IAutoMappingOverride<DBLookup> { public void Override(AutoMapping<Lookup> map) { map.Table("Lookups"); map.References(x => x.Parent, "ParentId").ForeignKey("Id"); map.DiscriminateSubClassesOnColumn<string>("LookupType").CustomType(typeof(LookupType)); } } BASE SubClass map for subclasses public class BaseLookupMap : SubclassMap where T : DBLookup { protected BaseLookupMap() { } protected BaseLookupMap(LookupType lookupType) { DiscriminatorValue(lookupType); Table("Lookups"); } } Example subclass map public class StateMap : BaseLookupMap<State> { protected StateMap() : base(LookupType.State) { } } Now I've almost got my mappings set, however the mapping is still expecting a table-per-class setup, so is expecting a 'State' table to exist with a reference to the states Id in the Lookup table. I hope this makes sense. This doesn't seem like an uncommon approach when wanting to keep lookup-type values configurable. Thanks in advance. Al

    Read the article

  • Nhibernate Migration from 1.0.2.0 to 2.1.2 and many-to-one save problems

    - by Meska
    Hi, we have an old, big asp.net application with nhibernate, which we are extending and upgrading some parts of it. NHibernate that was used was pretty old ( 1.0.2.0), so we decided to upgrade to ( 2.1.2) for the new features. HBM files are generated through custom template with MyGeneration. Everything went quite smoothly, except for one thing. Lets say we have to objects Blog and Post. Blog can have many posts, so Post will have many-to-one relationship. Due to the way that this application operates, relationship is done not through primary keys, but through Blog.Reference column. Sample mapings and .cs files: <?xml version="1.0" encoding="utf-8" ?> <id name="Id" column="Id" type="Guid"> <generator class="assigned"/> </id> <property column="Reference" type="Int32" name="Reference" not-null="true" /> <property column="Name" type="String" name="Name" length="250" /> </class> <?xml version="1.0" encoding="utf-8" ?> <id name="Id" column="Id" type="Guid"> <generator class="assigned"/> </id> <property column="Reference" type="Int32" name="Reference" not-null="true" /> <property column="Name" type="String" name="Name" length="250" /> <many-to-one name="Blog" column="BlogId" class="SampleNamespace.BlogEntity,SampleNamespace" property-ref="Reference" /> </class> And class files class BlogEntity { public Guid Id { get; set; } public int Reference { get; set; } public string Name { get; set; } } class PostEntity { public Guid Id { get; set; } public int Reference { get; set; } public string Name { get; set; } public BlogEntity Blog { get; set; } } Now lets say that i have a Blog with Id 1D270C7B-090D-47E2-8CC5-A3D145838D9C and with Reference 1 In old nhibernate such thing was possible: //this Blog already exists in database BlogEntity blog = new BlogEntity(); blog.Id = Guid.Empty; blog.Reference = 1; //Reference is unique, so we can distinguish Blog by this field blog.Name = "My blog"; //this is new Post, that we are trying to insert PostEntity post = new PostEntity(); post.Id = Guid.NewGuid(); post.Name = "New post"; post.Reference = 1234; post.Blog = blog; session.Save(post); However, in new version, i get an exception that cannot insert NULL into Post.BlogId. As i understand, in old version, for nhibernate it was enough to have Blog.Reference field, and it could retrieve entity by that field, and attach it to PostEntity, and when saving PostEntity, everything would work correctly. And as i understand, new NHibernate tries only to retrieve by Blog.Id. How to solve this? I cannot change DB design, nor can i assign an Id to BlogEntity, as objects are out of my control (they come prefilled as generic "ojbects" like this from external source)

    Read the article

  • Generate dynamic UPDATE command from Expression<Func<T, T>>

    - by Rui Jarimba
    I'm trying to generate an UPDATE command based on Expression trees (for a batch update). Assuming the following UPDATE command: UPDATE Product SET ProductTypeId = 123, ProcessAttempts = ProcessAttempts + 1 For an expression like this: Expression<Func<Product, Product>> updateExpression = entity => new Product() { ProductTypeId = 123, ProcessAttempts = entity.ProcessAttempts + 1 }; How can I generate the SET part of the command? SET ProductTypeId = 123, ProcessAttempts = ProcessAttempts + 1

    Read the article

  • vba excel copy subtable from sheet to sheet

    - by user429400
    I realize that this is probably a duplicate, but I've been searching for an hour and I can't to get the syntax right. I have a sheet with several tables. There is at least one empty column and one empty row between one table to the other. I know the start row and start column of each table, and I know that each table has 3 columns. I don't know how many rows it has. I want to write a sub that receives: table start row table start column and copies the table into another sheet (let's say that the destination is sheet2 starting at A1). I know I can do it with a loop, but I suspect there is a better syntax right? (The main issue here is that I need to find the number of rows each table has) Thanks. Li

    Read the article

  • JQuery selector in variable

    - by nagut
    I wanted to ask about using selector from a variable first I have: function check() { $('.info input, .info select').each(function(n, element){ if ($(element).val()=='') alert('empty'); }); } and called it in $('input')change(check); and they worked fine. But now I want to pass some value to the function to make it dynamic, like $('input')change(check('.info')); and changed the function to function check(sel) { $(sel +' input, '+ sel + ' select').each(function(n, element){ if ($(element).val()=='') alert('empty'); }); } but it doesn't work. Any help please.. Thanks, nagut

    Read the article

  • UIScrollView Does not Scroll

    - by paul simmons
    I have added a long info screen to my iPhone app. The info is a long UIImageView, and it is contained inside a UIScrollView. They are both defined in .xib file. At run-time, initially I set scrollview's position outside window, and when user clicks a button, set its position inside window. This part is OK. But scrollview displays the image but does not scroll. Isn't it enough to place in MainViewContoller.xib, set the contained content, and (at code) set its contentSize equal to the content's size? BTW: I try it at simulator currently.

    Read the article

  • Internet Explorer 8 EmulateIE7 Mode not working

    - by Ryu
    I've set up IIS6 to send the following headers Custom Header Name: X-UA-Compatible Custom Header Value: IE=EmulateIE7 that supposed to force IE 8 into IE 7 Compatibility mode. You can read more about it on MSDN . I have noticed by looking in the Developer toolbar that if I have a DTD defined the document mode correctly gets set to IE 7, but the browser mode is IE 8. If the page doesn't have a DTD the document mode gets set to Quirks and Browser Mode once again IE 8. Am I doing something wrong. How do I force IE 8 to set IE 7 Browser mode. Thanks

    Read the article

  • fortran error I/O

    - by jpcgandre
    I get this error when compiling: forrtl: severe (256): unformatted I/O to unit open for formatted transfers, unit 27, file C:\Abaqus_JOBS\w.txt The error occurs in the beginning of the analysis. At the start, the file w.txt is created but is empty. The error may be related to the fact that I want to read from an empty file. My code is: OPEN(27, FILE = "C:/Abaqus_JOBS/w.txt", status = "UNKNOWN") READ(27, *, iostat=stat) w IF (stat .NE. 0) CALL del_file(27, stat) SUBROUTINE del_file(uFile, stat) IMPLICIT NONE INTEGER uFile, stat C If the unit is not open, stat will be non-zero CLOSE(unit=uFile, status='delete', iostat=stat) END SUBROUTINE Ref: Close multiple files If you agree with my opion about the cause of the error, is there a way to solve it? Thanks

    Read the article

  • Write problem - lossing the original data

    - by John
    Every time I write to the text file I will lose the original data, how can I read the file and enter the data in the empty line or the next line which is empty? public void writeToFile() { try { output = new Formatter(myFile); } catch(SecurityException securityException) { System.err.println("Error creating file"); System.exit(1); } catch(FileNotFoundException fileNotFoundException) { System.err.println("Error creating file"); System.exit(1); } Scanner scanner = new Scanner (System.in); String number = ""; String name = ""; System.out.println("Please enter number:"); number = scanner.next(); System.out.println("Please enter name:"); name = scanner.next(); output.format("%s,%s \r\n", number, name); output.close(); }

    Read the article

  • Reverse engineering a bezier curve

    - by Martin
    Given a few sample points on a bézier curve, is it possible to work out the set of possible parameters of the curve? In my specific application there is a limited set of endpoints the curve may have, so I want to generate the set of possible curves, enumerate all of them and pick out all the ones which may end on a valid end point.

    Read the article

  • ADO program to list members of a large group.

    - by AlexGomez
    Hi everyone, I'm attempting to list all the members in a Active Directory group using ADO. The problem I have is that many of these groups have over 1500 members and ADSI cannot handle more than 1500 items in a multi-valued attribute. Fortunately I came across Richard Muller's wonderful VBScript that handles more than 1500 members at http://www.rlmueller.net/DocumentLargeGroup.htm I modified his code as shown below so that I can list ALL the groups and its memberships in a certain OU. However, I'm keeping getting the exception shown below: "ADODB.Recordset: Item cannot be found in the collection corresponding to the requested name or ordinal." My program appears to get stuck at: strPath = adoRecordset.Fields("ADsPath").Value Set objGroup = GetObject(strPath) All I am doing above is issuing the query to get back a recordset consisting of the ADsPath for each group in the OU. It then walks through the recordset and grabs the ADsPath for the first group and store its in a variable named strPath; we then use the value of that variable to bind to the group account for that group. It really should work! Any idea why the code below doesn't work for me? Any pointers will be great appreciated. Thanks. Option Explicit Dim objRootDSE, strDNSDomain, adoCommand Dim adoConnection, strBase, strAttributes Dim strFilter, strQuery, adoRecordset Dim strDN, intCount, blnLast, intLowRange Dim intHighRange, intRangeStep, objField Dim objGroup, objMember, strName ' Determine DNS domain name. Set objRootDSE = GetObject("LDAP://RootDSE") 'strDNSDomain = objRootDSE.Get("DefaultNamingContext") strDNSDomain = "XXXXXXXX" ' Use ADO to search Active Directory. Set adoCommand = CreateObject("ADODB.Command") Set adoConnection = CreateObject("ADODB.Connection") adoConnection.Provider = "ADsDSOObject" adoConnection.Open = "Active Directory Provider" adoCommand.ActiveConnection = adoConnection adoCommand.Properties("Page Size") = 100 adoCommand.Properties("Timeout") = 30 adoCommand.Properties("Cache Results") = False ' Specify base of search. strBase = "<LDAP://" & strDNSDomain & ">" ' Specify the attribute values to retrieve. strAttributes = "member" ' Filter on objects of class "group" strFilter = "(&(objectClass=group)(samAccountName=*))" ' Enumerate direct group members. ' Use range limits to handle more than 1000/1500 members. ' Setup to retrieve 1000 members at a time. blnLast = False intRangeStep = 999 intLowRange = 0 IntHighRange = intLowRange + intRangeStep Do While True If (blnLast = True) Then ' If last query, retrieve remaining members. strQuery = strBase & ";" & strFilter & ";" _ & strAttributes & ";range=" & intLowRange _ & "-*;subtree" Else ' If not last query, retrieve 1000 members. strQuery = strBase & ";" & strFilter & ";" _ & strAttributes & ";range=" & intLowRange & "-" _ & intHighRange & ";subtree" End If adoCommand.CommandText = strQuery Set adoRecordset = adoCommand.Execute adoRecordset.MoveFirst intCount = 0 Do Until adoRecordset.EOF strPath = adoRecordset.Fields("ADsPath").Value Set objGroup = GetObject(strPath) For Each objField In adoRecordset.Fields If (VarType(objField) = (vbArray + vbVariant)) _ Then For Each strDN In objField.Value ' Escape any forward slash characters, "/", with the backslash ' escape character. All other characters that should be escaped are. strDN = Replace(strDN, "/", "\/") ' Check dictionary object for duplicates. 'If (objGroupList.Exists(strDN) = False) Then ' Add to dictionary object. 'objGroupList.Add strDN, True ' Bind to each group member, to find member's samAccountName Set objMember = GetObject("LDAP://" & strDN) ' Output group cn, group samaAccountName and group member's samAccountName. Wscript.Echo objMember.samAccountName intCount = intCount + 1 'End if Next End If Next adoRecordset.MoveNext Loop adoRecordset.Close ' If this is the last query, exit the Do While loop. If (blnLast = True) Then Exit Do End If ' If the previous query returned no members, then the previous ' query for the next 1000 members failed. Perform one more ' query to retrieve remaining members (less than 1000). If (intCount = 0) Then blnLast = True Else ' Setup to retrieve next 1000 members. intLowRange = intHighRange + 1 intHighRange = intLowRange + intRangeStep End If Loop

    Read the article

  • Subversion commit failed on Mac OS X with error "no such table: rep_cache"

    - by arun
    I created a subversion repository, imported an empty structure, checked out the repo, added a file to the working copy and tried commiting the working copy with the following commands: svnadmin create mysvn svn import -m "initial empty structure" test/ file:///tmp/mysvn svn co file:///tmp/mysvn mywc svn ci -m "test" The commit failed with the following error: Transmitting file data .svn: Commit failed (details follow): svn: While preparing '/tmp/mywc' for commit svn: no such table: rep_cache I am running Mac OS X 10.6.3 and subversion 1.6.5. Did I miss any steps or Mac specific commands? Thanks for your help.

    Read the article

< Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >