Search Results

Search found 10161 results on 407 pages for 'task flow'.

Page 353/407 | < Previous Page | 349 350 351 352 353 354 355 356 357 358 359 360  | Next Page >

• Migrate Data and Schema from MySQL to SQL Server

  - by colithium

  Are there any free solutions for automatically migrating a database from MySQL to SQL Server Server that "just works"? I've been attempting this simple (at least I thought so) task all day now. I've tried: SQL Server Management Studio's Import Data feature Create an empty database Tasks - Import Data... .NET Framework Data Provider for Odbc Valid DSN (verified it connects) Copy data from one or more tables or views Check 1 VERY simple table Click Preview Get Error: The preview data could not be retrieved. ADDITIONAL INFORMATION: ERROR [42000] [MySQL][ODBC 5.1 Driver][mysqld-5.1.45-community]You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near '"table_name"' at line 1 (myodbc5.dll) A similar error occurs if I go through the rest of the wizard and perform the operation. The failed step is "Setting Source Connection" the error refers to retrieving column information and then lists the above error. It can retrieve column information just fine when I modify column mappings so I really don't know what the issue is. I've also tried getting various MySql tools to output ddl statements that SQL Server understand but haven't succeeded. I've tried with MySQL v5.1.11 to SQL Server 2005 and with MySQL v5.1.45 to SQL Server 2008 (with ODBC drivers 3.51.27.00 and 5.01.06.00 respectively)

  Read the article

• PHP unlink OR rewrite own/current file by itself

  - by Email

  Hi Task: Cut or erase a file after first walk-through. i have an install file called "index.php" which creates another php file. <? /* here some code*/ $fh = fopen($myFile, 'w') or die("can't open file"); $stringData = "<?php \n echo 'hallo, *very very long text*'; \n ?>"; fwrite($fh, $stringData); /*herecut"/ /*here some code */ after the creation of the new file this file is called and i intent to erase the filecreation call since it is very long and only needed on first install. i therefor add to the above code echo 'hallo, *very very long text*'; \n ***$new= file_get_contents('index.php'); \n $findme = 'habanot'; $pos = strpos($new, $findme); if ($pos === false) { $marker='herecut';\n $new=strstr($new,$marker);\n $new='<?php \n /*habanot*/\n'.$new;\n $fh = fopen('index.php', 'w') or die 'cant open file'); $stringData = $new; fwrite($fh, $stringData); fclose($fh);*** ?>"; fwrite($fh, $stringData);]} Isnt there an easier way or a function to modify the current file or even "self destroy" a file after first call? Regards

  Read the article

• How to report progress of a JavaScript function?

  - by LambyPie

  I have a JavaScript function which is quite long and performs a number of tasks, I would like to report progress to the user by updating the contents of a SPAN element with a message as I go. I tried adding document.getElementById('spnProgress').innerText = ... statements throughout the function code. However, whilst the function is executing the UI will not update and so you only ever see the last message written to the SPAN which is not very helpful. My current solution is to break the task up into a number of functions, at the end of each I set the SPAN message and then "trigger" the next one with a window.setTimeout call with a very short delay (say 10ms). This yields control and allows the browser to repaint the SPAN with the updated message before starting the next step. However I find this very messy and difficult to follow the code, I'm thinking there must be a better way. Does anyone have any suggestions? Is there any way to force the SPAN to repaint without having to leave the context of the function? Thanks

  Read the article

• PendingIntent in Widget + TaskKiller

  - by YaW

  Hi, I've developed an Application (called Instant Buttons) and the app has a widget feature. This widget uses PendingIntent for the onClick of the widget. My PendingIntent code is something like this: Intent active = new Intent(context, InstantWidget.class); active.setAction(String.valueOf(appWidgetId)); active.putExtra("blabla", blabla); //Some data PendingIntent actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); actionPendingIntent.cancel(); actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); remoteViews.setOnClickPendingIntent(R.id.button, actionPendingIntent); The onReceive gets the intent and do some stuff with the MediaPlayer class to reproduce a sound. I have reports from some users that the widgets stop working after a while and with some research i've discovered is because the Task Killers. It seems that when you kill the app in the TaskKiller, the PendingIntent is erased from memory, so when you click the widget, it doesn't know what to do. Is there any solution for this? Is my code wrong or something or it's the default behavior of the PendingIntent? Is there something I can use to avoid the TaskKiller to stop my widgets from working?? Greetings.

  Read the article

• is it possible to write a program which prints its own source code utilizing a "sequence-generating-

  - by guest

  is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

  Read the article

• Is there a recommended way to communicate scientific/engineering programming to C developers?

  - by ggkmath

  Hi, I have a lot of MATLAB code that needs to get ported to C (execution speed is critical for this work) as part of a back-end process for a web application. When I attempt to outsource this code to a C developer, I assume (correct me if I'm wrong) few C developers also understand MATLAB code (things like indexing and memory management are different, etc.). I wonder if there are any C developers out there that can recommend a procedure for me to follow to best communicate what the code does? For example, should I provide the MATLAB code and explain what it's doing line by line? Or, should I just provide the math/algorithm, explain it in plain English, and let the C developer implement it with this understanding in his/her own way (e.g. can I assume the developer understands how to work with complex math (i.e. imaginary numbers), how to generate histograms, perform an FFT, etc.)? Or, is there a better method? I expect I'm not the first to need to do this, so I wonder if any C developers out there ran into this situation and can share any conventional wisdom how they'd like this task to be transferred? Thanks in advance for any comments.

  Read the article

• do the Python libraries have a natural dependence on the global namespace?

  - by msw

  I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

  Read the article

• How can I call `update_attribute` for a list item in rails then actually update the html using jquery?

  - by Patrick Connor

  I want my users to be able to mark one or more items from an index view as "Active" or "Inactive" using a link. The text for the link should be state aware - so it might default to "Mark as Active" if the corresponding attribute was false or null, and "Mark as Inactive" if true. Once the user clicks the link and the attribute is updated in the controller, the link-text should update based on the new state. I am WAY off here, but this is a small sample of the code I have been trying... CONTROLLER ... respond_to :html, :js ... def update @item = Item.find(params[:id]) if @item.update_attributes(params[:item]) #Not sure of how to respond to .js here end end ... update.js.erb #how do I identify which element to update? $('#item[13456]').html("State aware text for link_to") VIEW - for item in @items = item.name = link_to "Mark as Active", item_path(item), :method => :put, :remote => true. :id => "item[#{item.id}]" I am happy to read any APIs, blogs, tutorials, etc. I just can't seem to get my hands/mind around this task. Any help or guidance is greatly appreciated!

  Read the article

• Oracle 10.1 and 11.2 produce different XML using the same statement

  - by MindFyer

  I am migrating a database from Oracle 10.1 to 11.2 and I have the following problem. The statement SELECT '<?xml version="1.0" encoding="utf-8" ?>' || (Xml).getClobVal() AS XmlClob FROM ( SELECT XmlElement( "Element1", ( SELECT XmlAgg(tpx.Xml) FROM ( SELECT XmlElement("Element3",XmlForest('content' as Element4)) AS Xml FROM dual ) tpx ) AS "Element2" ) AS Xml FROM dual ) On the original 10.1 database produces XML like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element2> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element2> </Element1> On the new 11.2 system it looks like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element1> Is there some environmental variable I am missing that tells Oracle how to format its XML. There are hundreds of thousands of lines of PL/SQL in the database; it would be a mammoth task to rewrite if it turned out they had changed they way Oracle formats XML between versions. Hopefully someone has come accross this before. Thanks

  Read the article

• What's the most efficient way to load data from a file to a collection on-demand?

  - by Dan

  I'm working on a java project that will allows users to parse multiple files with potentially thousands of lines. The information parsed will be stored in different objects, which then will be added to a collection. Since the GUI won't require to load ALL these objects at once and keep them in memory, I'm looking for an efficient way to load/unload data from files, so that data is only loaded into the collection when a user requests it. I'm just evaluation options right now. I've also thought of the case where, after loading a subset of the data into the collection, and presenting it on the GUI, the best way to reload the previously observed data. Re-run the parser/Populate collection/Populate GUI? or probably find a way to keep the collection into memory, or serialize/deserialize the collection itself? I know that loading/unloading subsets of data can get tricky if some sort of data filtering is performed. Let's say that I filter on ID, so my new subset will contain data from two previous analyzed subsets. This would be no problem is I keep a master copy of the whole data in memory. I've read that google-collections are good and efficient when handling big amounts of data, and offer methods that simplify lots of things so this might offer an alternative to allow me to keep the collection in memory. This is just general talking. The question on what collection to use is a separate and complex thing. Do you know what's the general recommendation on this type of task? I'd like to hear what you've done with similar scenarios. I can provide more specifics if needed.

  Read the article

• Any Alternate way for writing to a file other than ofstream

  - by Aditya

  Hi All, I am performing file operations (writeToFile) which fetches the data from a xml and writes into a output file(a1.txt). I am using MS Visual C++ 2008 and in windows XP. currently i am using this method of writing to output file.. 01.ofstreamhdr OutputFile; 02./* few other stmts / 03.hdrOutputFile.open(fileName, std::ios::out); 04. 05.hdrOutputFile << "#include \"commondata.h\""<< endl ; 06.hdrOutputFile << "#include \"Commonconfig.h\"" << endl ; 07.hdrOutputFile << "#include \"commontable.h\"" << endl << endl ; 08. hdrOutputFile << "#pragma pack(push,1)" << endl ; 09.hdrOutputFile << "typedef struct \n {" << endl ; 10./ simliar hdrOutputFiles statements... */.. I have around 250 lines to write.. Is any better way to perform this task. I want to reduce this hdrOutputFile and use a buffer to do this. Please guide me how to do that action. I mean, buff = "#include \"commontable.h\"" + "typedef struct \n {" + ....... hdrOutputFile << buff. is this way possible? Thanks Ramm

  Read the article

• SQL problem - select accross multiple tables (user groups)

  - by morpheous

  I have a db schema which looks something like this: create table user (id int, name varchar(32)); create table group (id int, name varchar(32)); create table group_member (foobar_id int, user_id int, flag int); I want to write a query that allows me to so the following: Given a valid user id (UID), fetch the ids of all users that are in the same group as the specified user id (UID) AND have group_member.flag=3. Rather than just have the SQL. I want to learn how to think like a Db programmer. As a coder, SQL is my weakest link (since I am far more comfortable with imperative languages than declarative ones) - but I want to change that. Anyway here are the steps I have identified as necessary to break down the task. I would be grateful if some SQL guru can demonstrate the simple SQL statements - i.e. atomic SQL statements, one for each of the identified subtasks below, and then finally, how I can combine those statements to make the ONE statement that implements the required functionality. Here goes (assume specified user_id [UID] = 1): //Subtask #1. Fetch list of all groups of which I am a member Select group.id from user inner join group_member where user.id=group_member.user_id and user.id=1 //Subtask #2 Fetch a list of all members who are members of the groups I am a member of (i.e. groups in subtask #1) Not sure about this ... select user.id from user, group_member gm1, group_member gm2, ... [Stuck] //Subtask #3 Get list of users that satisfy criteria group_member.flag=3 Select user.id from user inner join group_member where user.id=group_member.user_id and user.id=1 and group_member.flag=3 Once I have the SQL for subtask2, I'd then like to see how the complete SQL statement is built from these subtasks (you dont have to use the SQL in the subtask, it just a way of explaining the steps involved - also, my SQL may be incorrect/inefficient, if so, please feel free to correct it, and point out what was wrong with it). Thanks

  Read the article

• Deployment a web-site on IIS from another program

  - by slo2ols

  Hi, I developed a web-site on ASP.NET 3.5 SP1 platform. And additional I have 2 win services. My task is to build install package. I decided that Visual Studio install projects are not met my requirements. I design my own installer for this project, because I need to resolve many question and problem in install process. My problem: I need to deploy web-site into IIS, but I don't know how to do it easy. I found Microsoft tool as Web Deployment Tool, but I didn't find any documentation. And must I include this tool into my installer for deployment at destination customer? Another side I found SDC Tasks Library and it looks like a solution for me. But I saw many topics where people had problems and because the project was dead anybody couldn't help them. I know it is a long story... My question: how can I deploy the web-site from another program (I know that IIS versions have some differences and it is another headache), set a virtual directory, application pool (very important), a type of authentification and so forth ??? Thanks.

  Read the article

• What Test Environment Setup do Top Project Committers Use in the Ruby Community?

  - by viatropos

  Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

  Read the article

• Replace without the replace function

  - by Molly Potter

  Assignment: Let X and Y be two words. Find/Replace is a common word processing operation that finds each occurrence of word X and replaces it with word Y in a given document. Your task is to write a program that performs the Find/Replace operation. Your program will prompt the user for the word to be replaced (X), then the substitute word (Y ). Assume that the input document is named input.txt. You must write the result of this Find/Replace operation to a file named output.txt. Lastly, you cannot use the replace() string function built into Python (it would make the assignment much too easy). To test your code, you should modify input.txt using a text editor such as Notepad or IDLE to contain different lines of text. Again, the output of your code must look exactly like the sample output. This is my code: input_data = open('input.txt','r') #this opens the file to read it. output_data = open('output.txt','w') #this opens a file to write to. userStr= (raw_input('Enter the word to be replaced:')) #this prompts the user for a word userReplace =(raw_input('What should I replace all occurences of ' + userStr + ' with?')) #this prompts the user for the replacement word for line in input_data: words = line.split() if userStr in words: output_data.write(line + userReplace) else: output_data.write(line) print 'All occurences of '+userStr+' in input.txt have been replaced by '+userReplace+' in output.txt' #this tells the user that we have replaced the words they gave us input_data.close() #this closes the documents we opened before output_data.close() It won't replace anything in the output file. Help!

  Read the article

• How to understand existing projects

  - by John

  Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

  Read the article

• Survey statistic diagram ideas

  - by Nort

  Hey everyone, I've got some homework tasks in topic surveys and diagrams. The first task is to normalize the input of a survey, because the structure of the data is changing from time-to-time. So there are three types of surveys: static fields, where text is stored dynamic ones, where the user can select one option and multiselect fields, where the user can select multiple options So I'm not really a statistics guy, so I have really no idea what I can do with that incomming data. So the data I have is stored in an orbital XML file from there I can easily get how man times a survey was filled, and how many times a field was filled, so I can (for eg on a pie chart show the relation of filled or not filled). The second idea is to show the relation between the content of a multi option element using a bar chart or so. In case of the multi option elements I've got the idea to show data in implication of one option. But the question is, what could be shown? The other problem are the static elements (text fields and so). What data could be represented from a single field? The data in the XML field is collected from 2001 to 2005 So maybe I can work with the dates of the surveys, but as I said, i don't really know how to process the data, to collect as much data as possible.

  Read the article

• OSGI, Servlets and JPA hello world / tutorial / example

  - by Kamil

  I want to build a web application which basically is a restful web-service serving json messages. I would like it to be as simple as possible. I was thinking about using servlets (with annotations). JPA as a database layer is a must - Toplink or Hibernate. Preferably working on Tomcat. I want to have app divided into modules serving different functionality (auth service, customer service, etc..). And I would like to be able to update those modules without reinstalling whole application on the server - like eclipse plugins, user is notified (when he enters webapp's home url) that update is available, clicks it, and app is downloading and installing updated module. I think this functionality can be made with OSGI, but I can't find any example code, or tutorial with simple hello world updatable servlet providing some data from database through jpa. I'm looking for an advice: - Is OSGI the right tool for this or it can be done with something simpler? - Where can I find some examples covering topic (or topics) which I need for this project. - Which OSGI implementation would be best-simplest for this task. *My knowledge of OSGI is basic. I know how bundles are described, I understand concept of OSGI container and what it does. I have never created any OSGI app yet.

  Read the article

• Capturing output of find . -print0 into a bash array

  - by Idris

  Using find . -print0 seems to be the only safe way of obtaining a list of files in bash due to the possibility of filenames containing spaces, newlines, quotation marks etc. However, I'm having a hard time actually making find's output useful within bash or with other command line utilities. The only way I have managed to make use of the output is by piping it to perl, and changing perl's IFS to null: find . -print0 | perl -e '$/="\0"; @files=<>; print $#files;' This example prints the number of files found, avoiding the danger of newlines in filenames corrupting the count, as would occur with: find . | wc -l As most command line programs do not support null-delimited input, I figure the best thing would be to capture the output of find . -print0 in a bash array, like I have done in the perl snippet above, and then continue with the task, whatever it may be. How can I do this? This doesn't work: find . -print0 | ( IFS=$'\0' ; array=( $( cat ) ) ; echo ${#array[@]} ) A much more general question might be: How can I do useful things with lists of files in bash?

  Read the article

• What about parallelism across network using multiple PCs?

  - by MainMa

  Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

  Read the article

• How does PHP interface with Apache?

  - by Sbm007

  Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

  Read the article

• Turning a series of raw images into movie frames in Android

  - by Nicholas Killewald

  I've got an Android project I'm working on that, ultimately, will require me to create a movie file out of a series of still images taken with a phone's camera. That is to say, I want to be able to take raw image frames and string them together, one by one, into a movie. Audio is not a concern at this stage. Looking over the Android API, it looks like there are calls in it to create movie files, but it seems those are entirely geared around making a live recording from the camera on an immediate basis. While nice, I can't use that for my purposes, as I need to put annotations and other post-production things on the images as they come in before they get fed into a movie (plus, the images come way too slowly to do a live recording). Worse, looking over the Android source, it looks like a non-trivial task to rewire that to do what I want it to do (at least without touching the NDK). Is there any way I can use the API to do something like this? Or alternatively, what would be the best way to go about this, if it's even feasible on cell phone hardware (which seems to keep getting more and more powerful, strangely...)?

  Read the article

• Vim: change formatting of variables in a script

  - by sixtyfootersdude

  I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• How to make smooth transition from a WebBrowser control to an Image in Silverlight 4?

  - by Trex

  Hi, I have the following XAML on my page: `<Grid x:Name="LayoutRoot"> <Viewbox Stretch="Uniform"> <Image x:Name="myImage" /> </Viewbox> <WebBrowser x:Name="myBrowser" /> </Grid>` and then in the codebehind I'm switching the visibility between the image and the browser content: myBrowser.Visibility = Visibility.Collapsed; myImage.Source = new BitmapImage(new Uri(p)); myImage.Visibility = Visibility.Visible; and myImage.Visibility = Visibility.Collapsed; myBrowser.Source = new Uri(myPath + p, UriKind.Absolute); myBrowser.Visibility = Visibility.Visible; This works fine, but what the client now wants is a smooth transition between when the Image is shown and when the browser is shown. I tried several approaches but always ran into dead end. Do you have any ideas? I tried setting two states using the VSM and than displaying a white rectangle on top as an overlay, before the swap takes place, but that didn't work (I guess it's because nothing can be placed above the WebBroser???) I tried setting the Visibility of the image control and the webbrowser control using the VSM, but that didn't work either. I really don't know what else to try to solve this simple task. Any help is greatly appreciated. Jan

  Read the article

< Previous Page | 349 350 351 352 353 354 355 356 357 358 359 360  | Next Page >