Search Results

Search found 20531 results on 822 pages for 'input validation'.

Page 356/822 | < Previous Page | 352 353 354 355 356 357 358 359 360 361 362 363  | Next Page >

  • autocomplete-like feature with a python dict

    - by tipu
    In PHP, I had this line matches = preg_grep('/^for/', array_keys($hash)); What it would do is it would grab the words: fork, form etc. that are in $hash. In Python, I have a dict with 400,000 words. It's keys are words I'd like to present in an auto-complete like feature (the values in this case are meaningless). How would I be able to return the keys from my dictionary that match the input? For example (as used earlier), if I have my_dic = t{"fork" : True, "form" : True, "fold" : True, "fame" : True} and I get some input "for", It'll return a list of "fork", "form", "fold"

    Read the article

  • Couldn't match expected type - Haskell Code

    - by wvyar
    I'm trying to learn Haskell, but the small bit of sample code I tried to write is running into a fairly large amount of "Couldn't match expected type" errors. Can anyone give me some guidance as to what I'm doing wrong/how I should go about this? These are the errors, but I'm not really sure how I should be writing my code. toDoSchedulerSimple.hs:6:14: Couldn't match expected type `[t0]' with actual type `IO String' In the return type of a call of `readFile' In a stmt of a 'do' block: f <- readFile inFile In the expression: do { f <- readFile inFile; lines f } toDoSchedulerSimple.hs:27:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter task name: " In the expression: do { putStr "Enter task name: "; task <- getLine; return inFileArray : task } toDoSchedulerSimple.hs:34:9: Couldn't match expected type `IO ()' with actual type `[a0]' In a stmt of a 'do' block: putStrLn "Your task is: " ++ (inFileArray !! i) In the expression: do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } In an equation for `getTask': getTask inFileArray = do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } toDoSchedulerSimple.hs:41:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter the task you would like to end: " In the expression: do { putStr "Enter the task you would like to end: "; task <- getLine; filter (endTaskCheck task) inFileArray } toDoSchedulerSimple.hs:60:53: Couldn't match expected type `IO ()' with actual type `[String] -> IO ()' In a stmt of a 'do' block: schedulerSimpleMain In the expression: do { (getTask inFileArray); schedulerSimpleMain } In a case alternative: "get-task" -> do { (getTask inFileArray); schedulerSimpleMain } This is the code itself. I think it's fairly straightforward, but the idea is to run a loop, take input, and perform actions based off of it by calling other functions. import System.Random (randomRIO) import Data.List (lines) initializeFile :: [char] -> [String] initializeFile inFile = do f <- readFile inFile let parsedFile = lines f return parsedFile displayHelp :: IO() displayHelp = do putStrLn "Welcome to To Do Scheduler Simple, written in Haskell." putStrLn "Here are some commands you might find useful:" putStrLn " 'help' : Display this menu." putStrLn " 'quit' : Exit the program." putStrLn " 'new-task' : Create a new task." putStrLn " 'get-task' : Randomly select a task." putStrLn " 'end-task' : Mark a task as finished." putStrLn " 'view-tasks' : View all of your tasks." quit :: IO() quit = do putStrLn "We're very sad to see you go...:(" putStrLn "Come back soon!" createTask :: [String] -> [String] createTask inFileArray = do putStr "Enter task name: " task <- getLine return inFileArray:task getTask :: [String] -> IO() getTask inFileArray = do i <- randomRIO (0, (length inFileArray - 1)) putStrLn "Your task is: " ++ (inFileArray !! i) endTaskCheck :: String -> String -> Bool endTaskCheck str1 str2 = str1 /= str2 endTask :: [String] -> [String] endTask inFileArray = do putStr "Enter the task you would like to end: " task <- getLine return filter (endTaskCheck task) inFileArray viewTasks :: [String] -> IO() viewTasks inFileArray = case inFileArray of [] -> do putStrLn "\nEnd of tasks." _ -> do putStrLn (head inFileArray) viewTasks (tail inFileArray) schedulerSimpleMain :: [String] -> IO() schedulerSimpleMain inFileArray = do putStr "SchedulerSimple> " input <- getLine case input of "help" -> displayHelp "quit" -> quit "new-task" -> schedulerSimpleMain (createTask inFileArray) "get-task" -> do (getTask inFileArray); schedulerSimpleMain "end-task" -> schedulerSimpleMain (endTask inFileArray) "view-tasks" -> do (viewTasks inFileArray); schedulerSimpleMain _ -> do putStrLn "Invalid input."; schedulerSimpleMain main :: IO() main = do putStr "What is the name of the schedule? " sName <- getLine schedulerSimpleMain (initializeFile sName) Thanks, and apologies if this isn't the correct place to be asking such a question.

    Read the article

  • Changing cell class on radio button change

    - by Nick
    Huge thanks for the help in this thread - Click td, select radio button in jQuery But now I'm having trouble that it won't change the class of the cell, even though I have binded the 'change' trigger in jQuery like so: $("td input[type=radio]").bind('change click', function () { $('td').removeClass('selected'); $(this).parent('td').addClass('selected'); }); $("td").click(function () { $('input:radio', this).attr('checked', true); }); Hope that makes sense. If you click the radio button, or move between them using the keyboard, the cell's class changes just fine. However if you trigger this by clicking the cell it doesn't change the class :( Thanks

    Read the article

  • Encouraging business and team members to write more code

    - by Aliixx
    I am really interested to hear any ideas or working practices that can be adopted to encourage our team of developers to write more code. A little background here is involves a team of varying disciplines, experience and qualities and the nature of the work has a large focus on bug fixes and business logic / data validation over writing lots of new greenfield code or even refactoring. We are attempting to move to a more Agile philosophy and really what would be great is to hear any ideas that can be sold to the team and / or the business with the aim of: Writing more new code to improve experience, abilities and increase exposure to newer and emerging patterns and practices. Energizing the effort of the team and inspire. Encouraging wider input of new ideas, patterns and practices from the team as a whole. I would be very interested (and grateful) to hear any ideas or examples of ideas that can help here. Thanks!

    Read the article

  • Affiliation-France offre 10Euro de bienvenue aux Webmestres pour toute inscription à sa régie publicitaire dédiée au marché français

    Affiliation-France offre 10€ de bienvenue aux Webmestres Pour toute inscription à sa régie publicitaire dédiée au marché français Affiliation-France est une plateforme d'affiliation et régie publicitaire, dédiée au marché français, qui assure un rôle d'intermédiaire, en agrégeant des offres d'annonceurs d'un côté, et un réseau d'éditeurs de sites (Affiliés) de l'autre. Avec ses outils de diffusion, de reporting et ses technologies de ciblage, Affiliation-France affirme vouloir répondre aux besoins accrus et aux divergences entre annonceurs et diffuseurs. "Une plateforme 100% automatisée pour les webmasters" Après la validation d'un site, ...

    Read the article

  • Web Form Testing [closed]

    - by Frank G.
    I created a application for a client that is along the lines of a ticket tracking system. I wanted to know if anyone know of software that could beta test the web forms. Well I am looking for something that could automatically populate/fill whatever forms are on the web page with generic data. The purpose of this is to just randomly populate data and see if I get any errors on the page when submitted plus to also see how validation for the form functions. Does anyone know of anything that could do this?

    Read the article

  • JavaScript: Can I declare a variable by querying which function is called? (Newbie)

    - by belle3WA
    I'm working with an existing JavaScript-powered cart module that I am trying to modify. I do not know JS and for various reasons need to work with what is already in place. The text that appears for my quantity box is defined within an existing function: function writeitems() { var i; for (i=0; i<items.length; i++) { var item=items[i]; var placeholder=document.getElementById("itembuttons" + i); var s="<p>"; // options, if any if (item.options) { s=s+"<select id='options"+i+"'>"; var j; for (j=0; j<item.options.length; j++) { s=s+"<option value='"+item.options[j].name+"'>"+item.options[j].name+"</option>"; } s=s+"</select>&nbsp;&nbsp;&nbsp;"; } // add to cart s=s+method+"Quantity: <input id='quantity"+i+"' value='1' size='3'/> "; s=s+"<input type='submit' value='Add to Cart' onclick='addtocart("+i+"); return false;'/></p>"; } placeholder.innerHTML=s; } refreshcart(false); } I have two different types of quantity input boxes; one (donations) needs to be prefaced with a dollar sign, and one (items) should be blank. I've taken the existing additem function, copied it, and renamed it so that there are two identical functions, one for items and one for donations. The additem function is below: function additem(name,cost,quantityincrement) { if (!quantityincrement) quantityincrement=1; var index=items.length; items[index]=new Object; items[index].name=name; items[index].cost=cost; items[index].quantityincrement=quantityincrement; document.write("<span id='itembuttons" + index + "'></span>"); return index; } Is there a way to declare a global variable based on which function (additem or adddonation) is called so that I can add that into the writeitems function so display or hide the dollar sign as needed? Or is there a better solution? I can't use HTML in the body of the cart page because of the way it is currently coded, so I'm depending on the JS to take care of it. Any help for a newbie is welcome. Thanks!

    Read the article

  • move text from one div to another with javascript or mootools

    - by Ke
    Hi, I have two divs. I would like to move/populate the text from div id one to div id two using an onclick event. I am wondering how to do this? and also whether mootools can be used to accomplish the task or whether simple javascript is only necessary? <div id='one'> <ul> <input type="checkbox" onclick = "my_function()"/> <li>some text 1</li> <input type="checkbox" onclick = "my_function()"/> <li>some text 2</li> </ul> <div> <div id='two'> <div> Cheers in advance for any helps. Bangin my head against a brick wall here, because my javascript skillz are limited! Ke

    Read the article

  • Getting the dynamic value of a checkbox in repeating region loop with Jquery

    - by John
    How do I get the values of a check box that is in a repeating region with its values dynamically generated from a recordset from the database.I want to retrieve the value when it is checked and after I click on a link.The problem is that it is retrieving only the first value of the recordset which is 1.This is the code: //jQuery $(document).ready(function(){ $("#clickbtn").click(function(){ $("input[type=checkbox][checked]").each(function(){ var value=$("#checkid").attr('value'); $("#textfield").attr('value',value); }); return false; }); }); //html <td width="22"><form id="form1" name="form1" method="post" action=""> <input type="checkbox" name="checkid" id="checkid" value="<?php echo $row_people['NameID']; ?>" /> </form></td> I would appreciate the help.

    Read the article

  • HTML5 Video Javascript

    - by user373721
    Hi, I am not experienced in Javascript, I have the following script to play video files on Andriod phone, and it works fine. <script type="text/javascript"> function PlayMyVideo(arg) { var myVideo = document.getElementById([arg]); myVideo.play(); } </script> <video id="what" src="what.mp4" poster="" /> <input type="button" onclick="PlayMyVideo('what')" value="Play" /> I am trying to write the tag on the fly: <script type="text/javascript"> function PlayVideo() { new_video = document.createElement('video'); new_video.setAttribute('scr', 'what.mp4'); new_video.play(); } </script> <input type="button" onclick="PlayVideo()" value="Play2" /> Nothing happen, would appreciate your suggestions. Thanks in advance

    Read the article

  • Is it possible to block a certain character or group of characters from entering into text box or an

    - by Param-Ganak
    Hello friends! I have a text input field like text box or text area. I want to prevent the user from entering certain character or a group of characters. That is for example if I dont want # * @ and numbers from 0-9 these characters. So Whenever user press any of the above character key then that character should not appear in to an input field. It means directly blocking that character. Is this possible in Jquery? Please give me some guidelines to achive it. Thank You

    Read the article

  • Why is Drupal writing to root and not sites/default/files?

    - by Candland
    I'm using Drupal 6.14 on Win7. Everything seems to work except files that should be written to sites/default/files are trying to be written to /. The site was moved from a linux installation, which is writing the files correctly. I have setup a web.config w/ the rewrite rules for drupal. Not sure what or where else I should check. Thanks for any help. <rule name="Drupal Clean URLs" stopProcessing="true"> <match url="^(.*)$" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php?q={R:1}" appendQueryString="true" /> </rule>

    Read the article

  • Problem with Initializing Consts

    - by UdiM
    This code, when compiled in xlC 8.0 (on AIX 6.1), produces the wrong result. It should print 12345, but instead prints 804399880. Removing the const in front of result makes the code work correctly. Where is the bug? #include <stdio.h> #include <stdlib.h> #include <string> long int foo(std::string input) { return strtol(input.c_str(), NULL, 0); } void bar() { const long int result = foo("12345"); printf("%u\n", result); } int main() { bar(); return 0; } Compilation command: /usr/vacpp/bin/xlC example.cpp -g

    Read the article

  • Passing Values from a View to itself with parameters getting null values ?

    - by vsj
    Hi all, I am trying to get values from a view which i have the code below and I am taking the start date value from the view input text box and posting it back but I am still getting null except for the apikey and userkey.Here are the two views.. public ActionResult View1(string apiKey, string userId) { StartGoalViewModel vm = new StartGoalViewModel(); vm.ApiKey = apiKey; vm.UserId = userId; vm.GoalTypeId =1; vm.StartDate = null; return View(vm); } VIEW1.ASPX <% Html.BeginForm(); %> <%= Html.TextBox("name", Model.StartDate) %> <input type="submit" value="Start" /> <% Html.EndForm(); %> [HttpPost] public ActionResult VIEW1 (StartGoalViewModel fm) { // I get StartDate null... }

    Read the article

  • How to empty a socket in python?

    - by luc
    I need to empty the data on a socket (making sure that there is nothing to receive). Unfortunately, there is no function for this in the python socket module. I've implemented something this way: def empty_socket(sock): """remove the data present on the socket""" input = [sock] while 1: inputready, o, e = select.select(input,[],[], 0.0) if len(inputready)==0: break for s in inputready: s.recv(1) What do you think? Is there a better way to do that? Update: I don't want to change the socket timeout. What's why i prefer a select to a read. Update: The original question was using the 'flush' term. It seems that 'empty' is a better term. Update - 2010-02-27 : I've noticed a bug after when the pair has closed. The inputready is always filled with the sockets. I fixed that by adding a maximum number of loops. Is there a better fix?

    Read the article

  • login not working when changing from mysql to mysqli

    - by user1438647
    I have a code below where it logs a teacher in by matching it's username and password in the database, if correct, then log in, if incorrect, then display a message. <?php session_start(); $username="xxx"; $password="xxx"; $database="mobile_app"; $link = mysqli_connect('localhost',$username,$password); mysqli_select_db($link, $database) or die( "Unable to select database"); foreach (array('teacherusername','teacherpassword') as $varname) { $$varname = (isset($_POST[$varname])) ? $_POST[$varname] : ''; } ?> <form action="<?php echo htmlentities($_SERVER['PHP_SELF']); ?>" method="post" id="teachLoginForm"> <p>Username</p><p><input type="text" name="teacherusername" /></p> <!-- Enter Teacher Username--> <p>Password</p><p><input type="password" name="teacherpassword" /></p> <!-- Enter Teacher Password--> <p><input id="loginSubmit" type="submit" value="Login" name="submit" /></p> </form> <?php if (isset($_POST['submit'])) { $query = " SELECT * FROM Teacher t WHERE (t.TeacherUsername = '".mysqli_real_escape_string($teacherusername)."') AND (t.TeacherPassword = '".mysqli_real_escape_string($teacherpassword)."') "; $result = mysqli_query($link, $query); $num = mysqli_num_rows($result); $loged = false; while($row = mysqli_fetch_array($result)) { if ($_POST['teacherusername'] == ($row['TeacherUsername']) && $_POST['teacherpassword'] == ($row['TeacherPassword'])) { $loged = true; } $_SESSION['teacherforename'] = $row['TeacherForename']; $_SESSION['teachersurname'] = $row['TeacherSurname']; $_SESSION['teacherusername'] = $row['TeacherUsername']; } if ($loged == true){ header( 'Location: menu.php' ) ; }else{ echo "The Username or Password that you Entered is not Valid. Try Entering it Again."; } mysqli_close($link); } ?> Now the problem is that even if the teacher has entered in the correct username and password, it still doesn't let the teacher log in. When the code above was the old mysql() code, it worked fine as teacher was able to login when username and password match, but when trying to change the code into mysqli then it causes login to not work even though username and password match. What am I doing wrong?

    Read the article

  • php random image file name

    - by bush man
    Okay im using a snippet I found on google to take a users uploaded image and put it in my directory under Content But Im worried about duplicates so I was going have it upload the image as a Random number well here is my code you can probably understand what im going for through it anyways <label for="file">Profile Pic:</label> <input type="file" name="ProfilePic" id="ProfilePic" /><br /> <input type="submit" name="submit" value="Submit" /> $ProfilePicName = $_FILES["ProfilePic"]["name"]; $ProfilePicType = $_FILES["ProfilePic"]["type"]; $ProfilePicSize = $_FILES["ProfilePic"]["size"]; $ProfilePicTemp = $_FILES["ProfilePic"]["tmp_name"]; $ProfilePicError = $_FILES["ProfilePic"]["error"]; $RandomAccountNumber = mt_rand(1, 99999); echo $RandomAccountNumber; move_uploaded_file($ProfilePicTemp, "Content/".$RandomAccountNumber.$ProfilePicType); And then basicly after all this Im going try to get it to put that random number in my database

    Read the article

  • JavaScript : vérifiez votre code en ligne grâce à JSLint, mise à jour majeure de l'outil open source

    Contrôler votre code JavaScript avec ce vérificateur en ligne De la même manière que CSS Lint s'est imposé dans la validation de feuilles de style CSS, JS Lint va très certainement devenir un classique. Cet outil vous permet de vérifier votre code JavaScript en ligne. Pour se faire vous disposez de toutes une séries d'options à régler, en fonction de vos besoins. L'outil est bien évidemment écrit en JavaScript ; la boucle est bouclée ! A noter que JS Lint permet également la vérification de source HTML, CSS ou encore JSON.

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

  • Scanner class is skipping lines

    - by user2403304
    I'm new to programing and I'm having a problem with my scanner class. This code is in a loop and when the loop comes around the second, third whatever time I have it set to it skips the first title input. I need help please why is it skipping my title scanner input in the beginning? System.out.println("Title:"); list[i].title=keyboard.nextLine(); System.out.println("Author:"); list[i].author=keyboard.nextLine(); System.out.println("Album:"); list[i].album=keyboard.nextLine(); System.out.println("Filename:"); list[i].filename=keyboard.nextLine();

    Read the article

  • IIS7 URL Redirect with Regex

    - by andyjv
    I'm preparing for a major overhaul of our shopping cart, which is going to completely change how the urls are structured. For what its worth, this is for Magento 1.7. An example URL would be: {domain}/item/sub-domain/sub-sub-domain-5-16-7-16-/8083770?plpver=98&categid=1027&prodid=8090&origin=keyword and redirect it to {domain}/catalogsearch/result/?q=8083710 My web.config is: <?xml version="1.0" encoding="UTF-8"?> <configuration> <system.webServer> <rewrite> <rules> <rule name="Magento Required" stopProcessing="false"> <match url=".*" ignoreCase="false" /> <conditions> <add input="{URL}" pattern="^/(media|skin|js)/" ignoreCase="false" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Item Redirect" stopProcessing="true"> <match url="^item/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)(\?.*)" /> <action type="Redirect" url="catalogsearch/result/?q={R:3}" appendQueryString="true" redirectType="Permanent" /> <conditions trackAllCaptures="true"> </conditions> </rule> </rules> </rewrite> <httpProtocol allowKeepAlive="false" /> <caching enabled="false" /> <urlCompression doDynamicCompression="true" /> </system.webServer> </configuration> Right now it seems the redirect is completely ignored, even though in the IIS GUI the sample url passes the regex test. Is there a better way to redirect or is there something wrong with my web.config?

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • inputMismatchException Java reading doubles from plain text file

    - by user939287
    Using double variable = inputFile.nextDouble(); Gives the mismatch error and I can't figure out why... Anyone know what's up? The input file is just a bunch of doubles like 5.0... Okay here is the code snippet String fileName; Scanner scanner = new Scanner(System.in); System.out.println("\nEnter file name that contains the matrix and vector: "); fileName = scanner.nextLine(); Scanner inputFile = new Scanner(fileName); double a1 = inputFile.nextDouble(); the input file is a plain text document .txt in this format 5.0 4.0 -3.0 4.0 2.0 5.0 6.0 5.0 -2.0 -13.0 4.0 12.0 I don't understand why it wouldn't take those as doubles... As far as what its expecting the format of the file to be... I suppose binary? isn't that the default? I didn't specify in the code...

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Using php to create a password system with chinese characters

    - by WillDonohoe
    Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

    Read the article

< Previous Page | 352 353 354 355 356 357 358 359 360 361 362 363  | Next Page >