Search Results

Search found 13430 results on 538 pages for 'easy'.

Page 362/538 | < Previous Page | 358 359 360 361 362 363 364 365 366 367 368 369  | Next Page >

• Duplicate / Copy records in the same MySQL table

  - by Digits

  I have been looking for a while now but I can not find an easy solution for my problem. I would like to duplicate a record in a table, but of course, the unique primary key needs to be updated. I have this query: INSERT INTO invoices SELECT * FROM invoices AS iv WHERE iv.ID=XXXXX ON DUPLICATE KEY UPDATE ID = (SELECT MAX(ID)+1 FROM invoices) the problem is that this just changes the ID of the row instead of copying the row. Does anybody know how to fix this ? Thank you verrry much, Digits //edit: I would like to do this without typing all the field names because the field names can change over time.

  Read the article

• Secure way to run other people code (sandbox) on my server?

  - by amikazmi

  I want to make a web service that run other people code locally... Naturally, I want to limit their code access to certain "sandbox" directory, and that they wont be able to connect to other parts of my server (DB, main webserver, etc) Whats the best way to do it? Run VMware/Virtualbox: (+) I guess it's as secure as it gets.. even if someone manage to "hack".. they only hack the guest machine (+) can limit the cpu & memory the process uses (+) easy to setup.. just create the VM (-) harder to "connect" the sandbox directory from the host to the guest (-) wasting extra memory and cpu for managing the VM Run underprivileged user: (+) doesnt waste extra resources (+) sandbox directory is just a plain directory (?) cant limit cpu and memory? (?) dont know if it's secure enough... Any other way? Server running Fedora Core 8, the "other" codes written in Java & C++

  Read the article

• HTML5 - Creating a canvas on top of an SVG(or other image)

  - by cawd

  The reason for asking this question is because I want to be able to draw an arrow between two svg images. I want to use canvas to create the arrows, so firstly I generate the svgs then place a canvas on top of them to be able to draw the arrows. I've tried using style=... but haven't had any luck as everytime I add the canvas element it just pushes my svg images to another pl If there's no easy way to do this I'll just create arrows using SVG, I figured it would be more efficient to use canvas if I had to do lots of arrows in a short amount of time.

  Read the article

• Server Side code Pushing Data to client Browser while current thread is busy Comet (programming)

  - by h_power11

  Hello Friends, I am writing one simple web page with bunch of textboxes and a button control. Now when user finished editing the values on this text boxes user has to click the button and this button invoke heavily process intensive algorithm on server side code based on the data received from client (Textboxes) And it could some time takes up to 30 to 45 minutes to complete the whole operation so the current thread is still inside the button click event handler function. That background task only provides one event, and the web page subscribes to it to get some text data after each stage of processing I was wandering if there is any way I can keep user up-to-date with what is the current progress on that background task. I have div element to print the current status information So I am looking for some sort of reverse mechanism then "get" and "post". I have read some articles on the Comet (programming) but I can't find any easy or definitive answer Thanks in advance

  Read the article

• What do you name your files when using MVC?

  - by sprugman

  When using the MVC pattern, which I'm not terribly experienced with, I find myself naming things like this: /app/views/widget.php /app/models/widget.php /app/controllers/widget.php That appeals to me because it's easy to find associated classes, and I lean towards shorter names when practical. However, when I'm looking in my IDE, I see three different files called widget.php, which is confusing. I'm tempted to add "_v", "_c", "_m" or something to each name. How do you handle this? FWIW, I'm using CodeIgniter at the moment, and I don't know if there are any special benefits to using a particular convention, or any standard practices. Regardless, I'm intersted in the best-practices from various platforms.

  Read the article

• Convert JSON data into String

  - by san6086

  Hi I am converting JSON data into String. Please find the JSON data below. I am facing an issue where in the system is unable to convert NULL values into string. Therefore, I am getting the following error: can't convert nil into String (TypeError) JSON DATA: {"success":true,"message":null,"data":null} Code Used: c = Curl::Easy.new(Configuration.fetch("<URL where we can find the above JSON DATA and nothing else>")) # c.follow_location = true # c.http_auth_types = :basic # c.username = Configuration.fetch('auth_user', false) # c.password = Configuration.fetch('auth_pass', false) # c.headers["User-Agent"] = 'Mozilla/5.0 (X11; Linux x86_64) AppleWebKit/537.17 (KHTML, like Gecko) Chrome/24.0.1312.52 Safari/537.17' # c.perform result=JSON.parse(c) puts result["Success"] Please help.

  Read the article

• WPF binding: Doing a temperature converter app

  - by Bob

  Hi there, I'm doing a little app that basically has 2 text boxes. You'll enter Fahrenheit into TextBoxA and Celsius into TextBoxB. As the text changes in TextBoxA I want the equivalent Celsius value to be displayed in TextBoxB and vice versa. I can come up with a solution pretty easy for this but i'm trying to be a little clever. Is there a way to do it all in Xaml except for a Convert class that does the maths? So basically I want the TextChanged event of one textBox to pass in it's value into a Converter class that is evaluated and sent to the other TextBox and visa versa. Anyone know how I can achieve this ... and if it's possible at all?

  Read the article

• Where do you find images and graphics for your softwares ?

  - by ereOn

  Hi, As a programmer, I'm sure some of you already experienced the same problem: You create a good software (free, open-source, or for friend-only diffusion, whatever) relying on good code and good ideas but since you're a programmer and not an image designer, your program looks just bad. While it seems pretty easy to find motivated developpers to join for free an open-source project, it seems quite hard to find a single free graphic designer. What free and good resources do you usually use for your programs/websites ? Do you have any cool tip that you're willing to share ?

  Read the article

• Hyperlinks in VS2008 Test Result Details

  - by Red XIII

  In case when resulting string in "Test Result Details" (TRD) is very long, the Visual Studio 2008 crashes. I fixed this by sending the result data into a file. There is a problem, however, because there isn't a simple way to open such file. Of course, I can manually open folder and then the file, but it isn't very efficient. Now, to the questions part. Is there a possibility to include in the "Error Message" part of TRD a hyperlink to a file? (something similar to what we can already find in the stack trace part) If not, is there any way to add such functionality (easy opening of a file) to TRD? If not, are there any ways to expand the default reporting of VS? Thanks for any help.

  Read the article

• Odd toString behavior in javascript

  - by George

  I have this small function that's behaving oddly to me. Easy enough to work around, but enough to pique my curiosity. function formatNumber(number,style) { if (typeof style == 'number') { style = style.toString(); } return (number).format(style); } The return format part is based on another function that requires the style variable to be a string to work properly, so I'm just checking if style is a number and if it is to convert it to a string. When the function above is written as is, the format function format doesn't work properly. However when I write it as simply: return (number).format(style.toString()); Everything works. Is there a difference between putting the .toString function inside the format call vs performing it before hand and setting it as the variable style?

  Read the article

• Can I distort a bitmap image in Flash?

  - by drpepper

  Hi, what I would like to do is to take a loaded GIF file as a Bitmap, and then distort it by stretching and shrinking parts of it, so it would look like it got squished up against the screen. I'm pretty sure that there's no easy way in Flash to go beyond scaling and shearing, but I wonder if there might be some simple techniques to accomplish this kind of effect. By the way, I've also thought of pre-deforming the images in GIMP and saving them there, but I can't find a simple way to do it without learning their scripting language. Thanks for your help!

  Read the article

• Filtering across two ManyToMany fields

  - by KVISH

  I have a User model and an Event model. I have the following for both: class Event(models.Model): ... timestamp = models.DateTimeField() organization_map = models.ManyToManyField(Organization) class User(AuthUser): ... subscribed_orgs = models.ManyToManyField('Organization') I want to find all events that were created in a certain timeframe and find the users who are subscribed to those organizations. I know how to write SQL for this (it's very easy), but whats the pythonic way of doing this using Django ORM? I'm trying as per below: orgs = Organization.objects.all() events = Event.objects.filter(timestamp__gt=min_time) # Min time is the time I want to start from events = events.filter(organization_map__in=orgs) But from there, how do I map to users who have that organization as a subscription? I'm trying to map it like so: users = User.objects.filter(subscribed_orgs__in=...

  Read the article

• Why does OpenGL have to completely break backwards compatablity?

  - by directx

  I'm not sure if this only applies to JOGL or the entire OpenGL project in general. But there seems to be a vast difference between versions 3.x and 2.x; Code that works on one version will not work on another. It looks to me like the library designers intentionally renamed various classes, packages, and functions just to screw up the existing code. I've never seen anything like this before. The problem is I'm not sure which library to use now, and when looking at code it's not so easy to figure out whether it's supposed to run on 2.x or 3.x.

  Read the article

• Error about TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `<top (required)>'

  - by edi susanto

  hy guys . . im new at this . . sorry for the word that's not understandable and the easy question . . i'd like to ask about an error that shown below : TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `' i want to test the result by render json in soapUI. does anyone know what's the problem so that the error will show up like above ? thanks before.regards,edy

  Read the article

• Reading in MIPS external file so another file can use it?

  - by SkyWookie

  Hey all, I'm working on this final thing for my MIPS project and it's deceptively easy. I need to get a procedure (called feed) and let its main driver program use it by reading it in. I know that I'm supposed to use the call code 14 and .globl sym (I think) in order to feed it into the file and have it read it. I just need a basic tutorial or something, as I CANNOT find it on the Internet or in my book (just lists the call code, real helpful). Here's what I know: I need to use read, but I also need a file descriptor (don't know where to get it). I need to put the buffer in $a1 and the length in $a2. Well, that's about it. If there's any decent tutorial you could whip up or if there is one online that I don't see let me know please :). I just need a push in the right direction, I'm sure it can't be too difficult, just can't find any info on it!

  Read the article

• iPhone SDK: Keep an image from scrolling with a UIScrollView

  - by Wudstock

  Hi, I've been searching all over for an easy way to do this. Right now I have a UIScrollView setup as my main view. There's an Image on the left and a column of TextFields on the right. When any TextField is tapped, the keyboard comes up and hides the bottom TextField. So I have the ScrollView move up to unhide the bottom TextField. Question #1: Is there a way to have it respond to a specific TextField instead of all of them? Question #2: Is there a way to keep the Image on the left static so it doesn't move with the TextFields? Thanks in advance for any help.

  Read the article

• CouchDB emit with lookup key that is array, such that order of array elements are ignored.

  - by MatternPatching

  When indexing a couchdb view, you can emit an array as the key such as: emit(["one", "two", "three"], doc); I appreciate the fact that when searching the view, the order is important, but sometimes I would like the view to ignore it. I have thought of a couple of options. 1. By convention, just emit the contents in alphabetical order, and ensure that looking up uses the same convention. 2. Somehow hash in a manner that disregards the order, and emit/search based on that hash. (This is fairly easy, if you simply hash each one individually, "sum" the hashes, then mod.) Note: I'm sure this may be covered somewhere in the authoritative guide, but I was unsuccessful in finding it.

  Read the article

• Best way to test class methods without running __init__

  - by KenFar

  I've got a simple class that gets most of its arguments via init, which also runs a variety of private methods that do most of the work. Output is available either through access to object variables or public methods. Here's the problem - I'd like my unittest framework to directly call the private methods called by init with different data - without going through init. What's the best way to do this? So far, I've been refactoring these classes so that init does less and data is passed in separately. This makes testing easy, but I think the usability of the class suffers a little.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• WPF-to stroke arc with two different brushes

  - by user1914725

  i am new to geometric drawing in wpf. i have a volmeter arc that needs to have alert value. The section of the arc beyond that alert value has to be done with a different color than the rest of the arc. hence the arc is brushed with 2 different colors. a path has one brush at a time.hence how i apply two different pens to the same arc? the alert value is obtained with a lot of pain by doing calculations like gemetry.getpointatfraction.it won't easy to apply triggers any suggestions /approach?

  Read the article

• Case Sensitivity of Action Names in Struts 2

  - by IK

  Is there an easy way to make Struts 2 action names case insensitive? Currently I have the following action defined: <action name="printTest" class="MyClass" > <result name="error">/WEB-INF/jsp/error.jsp</result> <result name="input">/WEB-INF/jsp/test.jsp</result> <result name="success">/WEB-INF/jsp/test.jsp</result> </action> If the user types URL "/app/printtest.do" instead of "/app/printtest.do" this action is not executed. Other then mod_rewrite on the httpd level or something like that, the only option that I know about right now is simply adding the same exact action and changing the name to "printtest". Ideally it would be a simple config change to struts.xml

  Read the article

• How do you keep the value of global variables (namely a struct variable) between postbacks?

  - by user3702304

  I'm new to this and have already searched for this with not much luck :( Lets say I have defined a struct array globally and filled the array with data on an Ajax ModalPopupExtender. I then have a ddl_SelectedIndexChanged event that does a postback and seems to recycle my array. Is there a way to fire the ddl_SelectedIndexChanged event to perform some code without doing a postback? Or is there an easy way to make the array of type struct retain it's values? (I am creating a website btw) Thanks in advance...

  Read the article

• jQuery Animation and Classes

  - by ehdv

  Assume you have a list item, <li id="foo"> which you want to fade from one color to another when moused over, and that you are using jQuery. This is fairly easy: $('li#foo').bind('mouseenter' , function(e) { $(this).animate({backgroundColor: '#F00'} , 300); }); However, what if you wanted to get the resulting color or other style rules from a class defined in CSS without also declaring them in JavaScript? It seems there's no way to learn style information from CSS rules without having an example of the rule already in the document, which would require you to animate the <li> to the target appearance, then in the animation-finished callback, set the class which leads to redundant style declarations and can foul up your CSS at "runtime". Sorry if this question's unclear: It doesn't occur in the context of any specific project, I'm just curious how you'd go about this. Also, I know CSS3 hypothetically includes support for such transitions but using CSS for dynamic behavior like this seems such an ugly hack.

  Read the article

• As a Web Developer, how complicated is your average job compared to this?

  - by Daniel S

  I'm 16 years old, and I've recently started to do freelance jobs. I've been playing with PHP since I was 12 and think that I can code reasonably well. So far, I've created a library for fetching info from LinkedIn profiles and some WordPress plugins. However, right now this client wants me to convert an HTML template into a WordPress theme for use as a website. I feel this is a tad easy. As professional web programmers, are most assignments harder than this?

  Read the article

• is there an equivalent to a "Focus Listener" in Objective-C or iPhone SDK? (Coming from Java)

  - by MarcZero

  Hello. I am a student programmer who has taken up Objective-C on my free time as my college doesn't teach it. We have only used Java and basic C so far. I am in the middle of making a program for the iPod and was wondering if there was any type of way to call a method in a class similar to the way a Focus Listener does in Java? I have a view that I would like to call a refresh method (to update the newly inputted titles of buttons from another view) when the view is put at the top and visible again. Is this too easy or is there a more methodical way of doing that? I have tried to just call the method from the other view class but it does not seem to work (says the other class is either undefined or may not accept the method call and crashes on execution). Any insight would be appreciated. Thank you for your time.

  Read the article

< Previous Page | 358 359 360 361 362 363 364 365 366 367 368 369  | Next Page >