Search Results

Search found 53464 results on 2139 pages for 'find and replace'.

Page 362/2139 | < Previous Page | 358 359 360 361 362 363 364 365 366 367 368 369  | Next Page >

  • How does GMail implement Comet?

    - by Morgan Cheng
    With the help of HttpWatch, I tried to figure out how GMail implement Comet. I Login in GMail with two account, one in IE and the other in Firefox. Chatting in GTalk in GMail with some magic words like "WASSUP". Then, I logoff both GMail accounts, filter any http content without "WASSUP" string. The result shows which HTTP request is the streaming channel. (Note: I have to logoff. Otherwise, never-ending HTTP would not show content in HttpWatch.) The result is interesting. The URL for stream channel is like: https://mail/channel/bind?VER=8&at=xn3j33vcvk39lkfq..... There is no surprise that GMail do Comet in IE with IFRAME. The Http content starts with " Originally, I guessed that GMail do Comet in Firefox with multipart XmlHttpRequest. To my surprise, the response header doesn't have "multipart/x-mixed-replace" header. The response headers are as below: HTTP/1.1 200 OK Content-Type: text/plain; charset=utf-8 Cache-Control: no-cache, no-store, max-age=0, must-revalidate Pragma: no-cache Expires: Fri, 01 Jan 1990 00:00:00 GMT Date: Sat, 20 Mar 2010 01:52:39 GMT X-Frame-Options: ALLOWALL Transfer-Encoding: chunked X-Content-Type-Options: nosniff Server: GSE X-XSS-Protection: 0 Unfortunately, the HttpWatch doesn't tell whether a HTTP request is from XmlHttpRequest or not. The content is not HTML but JSON. It looks like a response for XHR, but that would not work for Comet without multipart/x-mixed-replace, right? Is there any way else to figure out how GMail implement Comet? Thanks.

    Read the article

  • rails search nested set (categories and sub categories)

    - by bob
    Hello, I am using the http://github.com/collectiveidea/awesome_nested_set awesome nested set plugin and currently, if I choose a sub category as my category_id for an item, I can not search by its parent. Category.parent Category.Child I choose Category.child as the category that my item is in. So now my item has category_id of 4 stored in it. If I go to a page in my rails application, lets say teh Category page and I am on the Category.parent's page, I want to show products that have category_id's of all the descendants as well. So ideally i want to have a find method that can take into account the descendants. You can get the descendants of a root by calling root.descendants (a built in plugin method). How would I go about making it so I can query a find that gets the descendants of a root instead of what its doing now which is binging up nothing unless the product had a specific category_id of the Category.parent. I hope I am being clear here. I either need to figure out a way to create a find method or named_scope that can query and return an array of objects that have id's corresponding tot he descendants of a root OR if I have any other options, what are they? I thought about creating a field in my products table like parent_id which can keep track of the parent so i can then create two named scopes one finding the parent stuff and one finding the child stuff and chaining them. I know I can create a named scope for each child and chain them together for multiple children but this seems a very tedious process and also, if you add more children, you would need to specify more named scopes.

    Read the article

  • Some general C questions.

    - by b-gen-jack-o-neill
    Hello. I am trying to fully understand the process pro writing code in some language to execution by OS. In my case, the language would be C and the OS would be Windows. So far, I read many different articles, but I am not sure, whether I understand the process right, and I would like to ask you if you know some good articles on some subjects I couldn´t find. So, what I think I know about C (and basically other languages): C compiler itself handles only data types, basic math operations, pointers operations, and work with functions. By work with functions I mean how to pass argument to it, and how to get output from function. During compilation, function call is replaced by passing arguments to stack, and than if function is not inline, its call is replaced by some symbol for linker. Linker than find the function definition, and replace the symbol to jump adress to that function (and of course than jump back to program). If the above is generally true and I get it right, where to final .exe file actually linker saves the functions? After the main() function? And what creates the .exe header? Compiler or Linker? Now, additional capabilities of C, today known as C standart library is set of functions and the declarations of them, that other programmers wrote to extend and simplify use of C language. But these functions like printf() were (or could be?) written in different language, or assembler. And there comes my next question, can be, for example printf() function be written in pure C without use of assembler? I know this is quite big question, but I just mostly want to know, wheather I am right or not. And trust me, I read a lots of articles on the web, and I would not ask you, If I could find these infromation together on one place, in one article. Insted I must piece by piece gather informations, so I am not sure if I am right. Thanks.

    Read the article

  • Improving Performance of Crystal Reports using Stored Procedures

    - by mjh41
    Recently I updated a Crystal Report that was doing all of its work on the client-side (Selects, formulas, etc) and changed all of the logic to be done on the server-side through Stored Procedures using an Oracle 11g database. Now the report is only being used to display the output of the stored procedures and nothing else. Everything I have read on this subject says that utilizing stored procedures should greatly reduce the running time of the report, but it still takes roughly the same amount of time to retrieve the data from the server. Is there something wrong with the stored procedure I have written, or is the issue in the Crystal Report itself? Here is the stored procedure code along with the package that defines the necessary REF CURSOR. CREATE OR REPLACE PROCEDURE SP90_INVENTORYDATA_ALL ( invdata_cur IN OUT sftnecm.inv_data_all_pkg.inv_data_all_type, dCurrentEndDate IN vw_METADATA.CASEENTRCVDDATE%type, dCurrentStartDate IN vw_METADATA.CASEENTRCVDDATE%type ) AS BEGIN OPEN invdata_cur FOR SELECT vw_METADATA.CREATIONTIME, vw_METADATA.RESRESOLUTIONDATE, vw_METADATA.CASEENTRCVDDATE, vw_METADATA.CASESTATUS, vw_METADATA.CASENUMBER, (CASE WHEN vw_METADATA.CASEENTRCVDDATE < dCurrentStartDate AND ( (vw_METADATA.CASESTATUS is null OR vw_METADATA.CASESTATUS != 'Closed') OR TO_DATE(vw_METADATA.RESRESOLUTIONDATE, 'MM/DD/YYYY') >= dCurrentStartDate) then 1 else 0 end) InventoryBegin, (CASE WHEN (to_date(vw_METADATA.RESRESOLUTIONDATE, 'MM/DD/YYYY') BETWEEN dCurrentStartDate AND dCurrentEndDate) AND vw_METADATA.RESRESOLUTIONDATE is not null AND vw_METADATA.CASESTATUS is not null then 1 else 0 end) CaseClosed, (CASE WHEN vw_METADATA.CASEENTRCVDDATE BETWEEN dCurrentStartDate AND dCurrentEndDate then 1 else 0 end) CaseCreated FROM vw_METADATA WHERE vw_METADATA.CASEENTRCVDDATE <= dCurrentEndDate ORDER BY vw_METADATA.CREATIONTIME, vw_METADATA.CASESTATUS; END SP90_INVENTORYDATA_ALL; And the package: CREATE OR REPLACE PACKAGE inv_data_all_pkg AS TYPE inv_data_all_type IS REF CURSOR RETURN inv_data_all_temp%ROWTYPE; END inv_data_all_pkg;

    Read the article

  • how to do introspection in R (stat package)

    - by Lebron James
    Hi all, I am somewhat new to R, and i have this piece of code which generates a variable that i don't know the type for. Are there any introspection facility in R which will tell me which type this variable belongs to? The following illustrates the property of this variable: I am working on linear model selection, and the resource I have is lm result from another model. Now I want to retrieve the lm call by the command summary(model)$call so that I don't need to hardcode the model structure. However, since I have to change the dataset, I need to do a bit of modification on the "string", but apparently it is not a simple string. I wonder if there is any command similar to string.replace so that I can manipulate this variable from the variable $call. Thanks > str<-summary(rdnM)$call > str lm(formula = y ~ x1, data = rdndat) > str[1] lm() > str[2] y ~ x1() > str[3] rdndat() > str[3] <- data Warning message: In str[3] <- data : number of items to replace is not a multiple of replacement length > str lm(formula = y ~ x1, data = c(10, 20, 30, 40)) > str<-summary(rdnM)$call > str lm(formula = y ~ x1, data = rdndat) > str[3] <- 'data' > str lm(formula = y ~ x1, data = "data") > str<-summary(rdnM)$call > type str Error: unexpected symbol in "type str" >

    Read the article

  • form with multiple upload but allow no upload on edit problems

    - by minus4
    hiya i have a section that when created takes in images, however when you edit this item i dont want them to re-upload none changes images just to change a description or name. i have created this that deals with uploading files: public void UploadFiles(string currentFileName, FormCollection form) { // loop through all files in form post foreach (string file in Request.Files) { HttpPostedFileBase hpf = Request.Files[file]; // if no file is uploaded, we could be editing so set to current value if (hpf.ContentLength == 0) { form[file] = currentFileName; } else { //rename the file unique so we dont clash with names var filename = hpf.FileName.Replace(" ", "_").Replace(".", DateTime.Now.Date.Ticks + "."); UploadFileName = filename; hpf.SaveAs(Server.MapPath("~/Content/custom/" + filename)); // set the name of the file in our post to the new name form[file] = UploadFileName; } } // ensure value is still sent when no files are uploaded on edit if(Request.Files.Count <= 0) { UploadFileName = currentFileName; } } all works fine when only one image is required (CurrentFileName), however there is now a new image available taking it to a total of 2 images in the database therefor currentFileName is obsolete. has anyone tackled this and how as i have hit a wall with this one. thought of string[] currentFiles but cant see how to match this into string file in Request.Files. if it helps i am also working with models for the form so i could pass over the model but i dont think your able to do model.file without some kind of reflection. help much appreciated. thanks

    Read the article

  • Optimizing code using PIL

    - by freakazo
    Firstly sorry for the long piece of code pasted below. This is my first time actually having to worry about performance of an application so I haven't really ever worried about performance. This piece of code pretty much searches for an image inside another image, it takes 30 seconds to run on my computer, converting the images to greyscale and other changes shaved of 15 seconds, I need another 15 shaved off. I did read a bunch of pages and looked at examples but I couldn't find the same problems in my code. So any help would be greatly appreciated. From the looks of it (cProfile) 25 seconds is spent within the Image module, and only 5 seconds in my code. from PIL import Image import os, ImageGrab, pdb, time, win32api, win32con import cProfile def GetImage(name): name = name + '.bmp' try: print(os.path.join(os.getcwd(),"Images",name)) image = Image.open(os.path.join(os.getcwd(),"Images",name)) except: print('error opening image;', name) return image def Find(name): image = GetImage(name) imagebbox = image.getbbox() screen = ImageGrab.grab() #screen = Image.open(os.path.join(os.getcwd(),"Images","Untitled.bmp")) YLimit = screen.getbbox()[3] - imagebbox[3] XLimit = screen.getbbox()[2] - imagebbox[2] image = image.convert("L") Screen = screen.convert("L") Screen.load() image.load() #print(XLimit, YLimit) Found = False image = image.getdata() for y in range(0,YLimit): for x in range(0,XLimit): BoxCoordinates = x, y, x+imagebbox[2], y+imagebbox[3] ScreenGrab = screen.crop(BoxCoordinates) ScreenGrab = ScreenGrab.getdata() if image == ScreenGrab: Found = True #print("woop") return x,y if Found == False: return "Not Found" cProfile.run('print(Find("Login"))')

    Read the article

  • IRC Server configuration possibilities

    - by Katai
    I need to know a couple of things, concerning IRC servers that I couldnt directly find out over google (or werent clear enough for me to be sure if it actually works) I'm working at a larger community site, and wanted to deliver an in-page chat. Since it would be a nice feature to let people access it from outside too, over their own clients, I tought implementing an IRC Server would be the best solution (probably dedicated, I'll have to teach myself a couple of things for that) I plan to include a Web-based IRC client over an APE Client / Server. The problem is, I want to strip down the user rights, to disallow many functionalities that IRC would offer: Change of nicknames: The user logs in over the Page login, and I'll automatically create an IRC auth for this user with that password. So basically, he would connect to the IRC client over a button. And after connecting, he shouldnt be able to change his nickname at all Creating channels: I want the possibility to create channels, but not from 'normal' users. Basically, I would prefer to set up basic channels that are public, and if a user really creates an own channel, that one should be private and via invitation (is that possible?) Private conversations: private conversations should be filtered out from the allaround IRC client, into separate 'in-browser-windows' that I create over JS. I guess I just have to filter the stuff coming from IRC - or is there a better solution to that? Only 'registered' users have access: Like I said, if someone registers on the page, I would like to create an IRC 'account' for him. Users that arent registered on the page, cant access the IRC server at all (or get thrown out). Mainly to avoid spammers or bots from outside. Is this stuff solvable over IRC? I've read some FAQ's and Instructions for IRC OP's and servers, but I couldnt find a clear answer - it seems that everyone can do pretty much everything - I would like to configure it in a way that user possibilities are more cut down. Basically, giving users the possibility to chat, but not more. So the Question basically is, how possible / solvable this issues are allaround, or if I have to find other solutions for this.

    Read the article

  • How can i optimize this c# code?

    - by Pandiya Chendur
    I have converted my Datatable to json string use the following method... public string GetJSONString(DataTable Dt) { string[] StrDc = new string[Dt.Columns.Count]; string HeadStr = string.Empty; for (int i = 0; i < Dt.Columns.Count; i++) { StrDc[i] = Dt.Columns[i].Caption; HeadStr += "\"" + StrDc[i] + "\" : \"" + StrDc[i] + i.ToString() + "¾" + "\","; } HeadStr = HeadStr.Substring(0, HeadStr.Length - 1); StringBuilder Sb = new StringBuilder(); Sb.Append("{\"" + Dt.TableName + "\" : ["); for (int i = 0; i < Dt.Rows.Count; i++) { string TempStr = HeadStr; Sb.Append("{"); for (int j = 0; j < Dt.Columns.Count; j++) { if (Dt.Rows[i][j].ToString().Contains("'") == true) { Dt.Rows[i][j] = Dt.Rows[i][j].ToString().Replace("'", ""); } TempStr = TempStr.Replace(Dt.Columns[j] + j.ToString() + "¾", Dt.Rows[i][j].ToString()); } Sb.Append(TempStr + "},"); } Sb = new StringBuilder(Sb.ToString().Substring(0, Sb.ToString().Length - 1)); Sb.Append("]}"); return Sb.ToString(); } Is this fair enough or still there is margin for optimization to make it execute faster.... Any suggestion...

    Read the article

  • Why won't .attr('checked','checked') set?

    - by Jason
    I have the following snippet of code (I'm using jQuery 1.4.2): $.post('/Ads/GetAdStatsRow/', { 'ad_id': id }, function(result) { $('#edit_ads_form tbody').prepend(result); $(result).find('td.select-ad input').attr('checked','checked').click(); }); Assume that the post works correctly and returns a correct pre-built <tr> with some <td>s. Here's the weirdness: the $(result).find() line finds the correct input (which is a checkbox, as it's the only input in the cell) and runs the chained click() function correctly, but it REFUSES to set the box as checked, which I need to happen. Here's a crazy twist, too... when I get super specific and change the $(result).find() line to this (the id of the checkbox): $('#ad_' + id).click(); It checks the box, but doesn't run the click() function! If I set it to $('#ad_' + id).attr('checked','checked').click(); it runs the click function as though the box were checked, but the box remains unchecked, and if I do $('#ad_' + id).click().attr('checked','checked'); it does nothing at all. What in the world could be the matter with this? I'm running out of hair.... Thanks!

    Read the article

  • Formula parsing / evaluation routine or library with generic DLookup functionality

    - by tbone
    I am writing a .Net application where I must support user-defined formulas that can perform basic mathematics, as well as accessing data from any arbitrary table in the database. I have the math part working, using JScript Eval(). What I haven't decided on is what a nice way is to do the generic table lookups. For example, I may have a formula something like: Column: BonusAmount Formula: {CurrentSalary} * 1.5 * {[SystemSettings][Value][SettingName=CorpBonus AND Year={Year}]} So, in this example I would replace {xxx} and {Year} with the value of Column xxx from the current table, and I would replace the second part with the value of (select Value from SystemSettings WHERE SettingName='CorpBonus' AND Year=2008) So, basically, I am looking for something very much like the MS Access DLookup function: DLookup ( expression, domain, [criteria] ) DLookup("[UnitPrice]", "Order Details", "OrderID = 10248") But, I also need to overall parsing routine that can tell whether to just look up in the current row, or to look into another table. Would also be nice to support aggregate functions (ie: DAvg, DMax, etc), as well as all the weird edge cases handled. So I wonder if anyone knows of any sort of an existing library, or has a nice routine that can handle this formula parsing and database lookup / aggregate function resolution requirements.

    Read the article

  • Porting Oracle Procedure to PostgreSQL

    - by Grasper
    I am porting an Oracle function into Postgres PGPLSQL.. I have been using this guide: http://www.postgresql.org/docs/8.1/static/plpgsql.html CREATE OR REPLACE PROCEDURE DATA_UPDATE (mission NUMBER, task NUMBER) AS BEGIN IF mission IS NOT NULL THEN UPDATE MISSION_OBJECTIVE MO SET (MO.MO_TKR_TOTAL_OFF_SCHEDULED, MO.MO_TKR_TOTAL_RECEIVERS) = (SELECT NVL(SUM(RR.TRQ_FUEL_OFFLOAD),0), NVL(SUM(RR.TRQ_NUMBER_RECEIVERS),0) FROM REFUELING_REQUEST RR, MISSION_REQUEST_PAIRING MRP WHERE MO.MSN_INT_ID = MRP.MSN_INT_ID AND MO.MO_INT_ID = MRP.MO_INT_ID AND MRP.REQ_INT_ID = RR.REQ_INT_ID) WHERE MO.MSN_INT_ID = mission AND MO.MO_INT_ID = task ; END IF ; COMMIT ; END ; I've got it this far: CREATE OR REPLACE FUNCTION DATA_UPDATE (NUMERIC, NUMERIC) RETURNS integer as ' DECLARE mission ALIAS for $1; task ALIAS for $2; BEGIN IF mission IS NOT NULL THEN UPDATE MISSION_OBJECTIVE MO SET (MO.MO_TKR_TOTAL_OFF_SCHEDULED, MO.MO_TKR_TOTAL_RECEIVERS) = (SELECT COALESCE(SUM(RR.TRQ_FUEL_OFFLOAD),0), COALESCE(SUM(RR.TRQ_NUMBER_RECEIVERS),0) FROM REFUELING_REQUEST RR, MISSION_REQUEST_PAIRING MRP WHERE MO.MSN_INT_ID = MRP.MSN_INT_ID AND MO.MO_INT_ID = MRP.MO_INT_ID AND MRP.REQ_INT_ID = RR.REQ_INT_ID) WHERE MO.MSN_INT_ID = mission AND MO.MO_INT_ID = task ; END IF; COMMIT; END; ' LANGUAGE plpgsql; This is the error I get: ERROR: syntax error at or near "SELECT" LINE 1: ...OTAL_OFF_SCHEDULED, MO.MO_TKR_TOTAL_RECEIVERS) = (SELECT COA... I do not know why this isn't working... any ideas?

    Read the article

  • Implementing crossover in genetic programming

    - by Name
    Hi, I'm writing a genetic programming (GP) system (in C but that's a minor detail). I've read a lot of the literature (Koza, Poli, Langdon, Banzhaf, Brameier, et al) but there are some implementation details I've never seen explained. For example: I'm using a steady state population rather than a generational approach, primarily to use all of the computer's memory rather than reserve half for the interim population. Q1. In GP, as opposed to GA, when you perform crossover you select two parents but do you create one child or two, or is that a free choice you have? Q2. In steady state GP, as opposed to a generational system, what members of the population do the children created by crossover replace? This is what I haven't seen discussed. Is it the two parents, or is it two other, randomly-selected members? I can understand if it's the latter, and that you might use negative tournament selection to choose members to replace, but would that not create premature convergence? (After a crossover event the population contains the two original parents plus two children of those parents, and two other random members get removed. Elitism is inherent.) Q3. Is there a Web forum or mailing list focused on GP? Oddly I haven't found one. Yahoo's GP group is used almost exclusively for announcements, the Poli/Langdon Field Guide forum is almost silent, and GP discussions on general/game programming sites like gamedev.net are very basic. Thanks for any help you can provide!

    Read the article

  • VPython in Eclipse - thinks it has the wrong architecture type.

    - by Duncan Tait
    Evening, So I've recently installed VPython on my MacBook (OS X, Snow Leopard) - and it works absolutely fine in IDLE and from the command line (interactive mode). However, eclipse has issues. Firstly it couldn't find it (which is a bit of an issue actually with all these 'easy install' python modules - when they don't tell you where they actually install to!) but I searched it out in the depths of Library\Frameworks... and added that to the System PYTHONPATH listbox in Eclipse. Now it can find it, but it says the following: Traceback (most recent call last): File "/Users/duncantait/dev/workspace/Network_Simulation/src/Basic/Net_Sim1.py", line 15, in <module> import visual File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/__init__.py", line 59, in <module> import cvisual ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so: mach-o, but wrong architecture I am guessing that VPython might not be built for a 64-bit architecture (Intel), but the fact remains that it works in both IDLE and command prompt... So there must be a way to configure Eclipse to run it right? (Wishful thinking). Thanks for any help! Duncan

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • What is best strategy to handle exceptions & errors in Rails?

    - by Nick Gorbikoff
    Hello. I was wondering if people would share their best practices / strategies on handling exceptions & errors. Now I'm not asking when to throw an exception ( it has been throroughly answered here: SO: When to throw and Exception) . And I'm not using this for my application flow - but there are legitimate exceptions that happen all the time. For example the most popular one would be ActiveRecordNotFound. What would be the best way to handle it? The DRY way? Right now I'm doing a lot of checking within my controller so if Post.find(5) returns Nil - I check for that and throw a flash message. However while this is very granular - it's a bit cumbersome in a sense that I need to check for exceptions like that in every controller, while most of them are essentially the same and have to do with record not found or related records not found - such as either Post.find(5) not found or if you are trying to display comments related to post that doesn't exist, that would throw an exception (something like Post.find(5).comments[0].created_at) I know you can do something like this in ApplicationController and overwrite it later in a particular controller/method to get more granular support, however would that be a proper way to do it? class ApplicationController < ActionController::Base rescue_from ActiveRecord::RecordInvalid do |exception| render :action => (exception.record.new_record? ? :new : :edit) end end

    Read the article

  • Processing a log to fix a malformed IP address ?.?.?.x

    - by skymook
    I would like to replace the first character 'x' with the number '7' on every line of a log file using a shell script. Example of the log file: 216.129.119.x [01/Mar/2010:00:25:20 +0100] "GET /etc/.... 74.131.77.x [01/Mar/2010:00:25:37 +0100] "GET /etc/.... 222.168.17.x [01/Mar/2010:00:27:10 +0100] "GET /etc/.... My humble beginnings... #!/bin/bash echo Starting script... cd /Users/me/logs/ gzip -d /Users/me/logs/access.log.gz echo Files unzipped... echo I'm totally lost here to process the log file and save it back to hd... exit 0 Why is the log file IP malformed like this? My web provider (1and1) has decide not to store IP address, so they have replaced the last number with the character 'x'. They told me it was a new requirement by 'law'. I personally think that is bs, but that would take us off topic. I want to process these log files with AWstats, so I need an IP address that is not malformed. I want to replace the x with a 7, like so: 216.129.119.7 [01/Mar/2010:00:25:20 +0100] "GET /etc/.... 74.131.77.7 [01/Mar/2010:00:25:37 +0100] "GET /etc/.... 222.168.17.7 [01/Mar/2010:00:27:10 +0100] "GET /etc/.... Not perfect I know, but least I can process the files, and I can still gain a lot of useful information like country, number of visitors, etc. The log files are 200MB each, so I thought that a shell script is the way to go because I can do that rapidly on my Macbook Pro locally. Unfortunately, I know very little about shell scripting, and my javascript skills are not going to cut it this time. I appreciate your help.

    Read the article

  • Why is Swing Parser's handleText not handling nested tags?

    - by Jim P
    I need to transform some HTML text that has nested tags to decorate 'matches' with a css attribute to highlight it (like firefox search). I can't just do a simple replace (think if user searched for "img" for example), so I'm trying to just do the replace within the body text (not on tag attributes). I have a pretty straightforward HTML parser that I think should do this: final Pattern pat = Pattern.compile(srch, Pattern.CASE_INSENSITIVE); Matcher m = pat.matcher(output); if (m.find()) { final StringBuffer ret = new StringBuffer(output.length()+100); lastPos=0; try { new ParserDelegator().parse(new StringReader(output.toString()), new HTMLEditorKit.ParserCallback () { public void handleText(char[] data, int pos) { ret.append(output.subSequence(lastPos, pos)); Matcher m = pat.matcher(new String(data)); ret.append(m.replaceAll("<span class=\"search\">$0</span>")); lastPos=pos+data.length; } }, false); ret.append(output.subSequence(lastPos, output.length())); return ret; } catch (Exception e) { return output; } } return output; My problem is, when I debug this, the handleText is getting called with text that includes tags! It's like it's only going one level deep. Anyone know why? Is there some simple thing I need to do to HTMLParser (haven't used it much) to enable 'proper' behavior of nested tags? PS - I figured it out myself - see answer below. Short answer is, it works fine if you pass it HTML, not pre-escaped HTML. Doh! Hope this helps someone else. <span>example with <a href="#">nested</a> <p>more nesting</p> </span> <!-- all this gets thrown together -->

    Read the article

  • How to bulk insert data from ref cursor to a temporary table in PL/SQL

    - by Sambath
    Could anyone tell me how to bulk insert data from a ref cursor to a temporary table in PL/SQL? I have a procedure that one of its parameters stores a result set, this result set will be inserted to a temporary table in another stored procedure. This is my sample code. CREATE OR REPLACE PROCEDURE get_account_list ( type_id in account_type.account_type_id%type, acc_list out sys_refcursor ) is begin open acc_list for select account_id, account_name, balance from account where account_type_id = type_id; end get_account_list; CREATE OR REPLACE PROCEDURE proc1 ( ... ) is accounts sys_refcursor; begin get_account_list(1, accounts); --How to bulk insert data in accounts to a temporary table? end proc1; In SQL Server, I can write as code below CREATE PROCEDURE get_account_list type_id int as select account_id, account_name, balance from account where account_type_id = type_id; CREATE PROCEDURE proc1 ( ... ) as ... insert into #tmp_data(account_id, account_name, balance) exec get_account_list 1 How can I write similar to the code in SQL Server? Thanks.

    Read the article

  • Python web scraping involving HTML tags with attributes

    - by rohanbk
    I'm trying to make a web scraper that will parse a web-page of publications and extract the authors. The skeletal structure of the web-page is the following: <html> <body> <div id="container"> <div id="contents"> <table> <tbody> <tr> <td class="author">####I want whatever is located here ###</td> </tr> </tbody> </table> </div> </div> </body> </html> I've been trying to use BeautifulSoup and lxml thus far to accomplish this task, but I'm not sure how to handle the two div tags and td tag because they have attributes. In addition to this, I'm not sure whether I should rely more on BeautifulSoup or lxml or a combination of both. What should I do? At the moment, my code looks like what is below: import re import urllib2,sys import lxml from lxml import etree from lxml.html.soupparser import fromstring from lxml.etree import tostring from lxml.cssselect import CSSSelector from BeautifulSoup import BeautifulSoup, NavigableString address='http://www.example.com/' html = urllib2.urlopen(address).read() soup = BeautifulSoup(html) html=soup.prettify() html=html.replace('&nbsp', '&#160') html=html.replace('&iacute','&#237') root=fromstring(html) I realize that a lot of the import statements may be redundant, but I just copied whatever I currently had in more source file. EDIT: I suppose that I didn't make this quite clear, but I have multiple tags in page that I want to scrape.

    Read the article

  • General N-Tier Architecture Question

    - by whatispunk
    In an N-Tier app you're supposed to have a business logic layer and a data access layer. Is it bad to simply have two assemblies: BusinessLogicLayer.dll and DataAccessLayer.dll to handle all this logic? How do you actually represent these layers. It seems silly, the way I've seen it, to have a BusinessLogic class library containing classes like: CustomerBusinessLogic.cs, OrderBusinessLogic.cs, etc. each calling their appropriately named cousin in the DataAccessLayer class library, i.e. CustomerDataAccess.cs, OrderDataAccess.cs. I want to create a web app using MVP and it doesn't seem so cut and dry as this. There are lots of opinions about where the business logic is supposed to be put in MVP and I'm not sure I've found a really great answer yet. I want this project to be easily testable, and I am trying to adhere to TDD methodologies as best I can. I intend to use MSTest and Rhino Mocks for testing. I was thinking of something like the following for my architecture: I'd use LINQ-To-SQL to talk to the database. WCF services to define data contract interfaces for the business logic layer. Then use MVP with ASP.NET Forms for the UI/BLL. Now, this isn't the start of this project, most of the LINQ stuff is already done, so its stuck. The WCF service would replace the existing DataAccessLayer assembly and the UI/BLL would replace the BusinessLogicLayer assembly etc. This sort of makes sense in my head, but its getting really late. Anyone that's traveled down this path have any guidance? Good links? Warnings? Thanks!

    Read the article

  • Replacing specific HTML tags using Regex

    - by matthewpe
    Alright, an easy one for you guys. We are using ActiveReport's RichTextBox to display some random bits of HTML code. The HTML tags supported by ActiveReport can be found here : http://www.datadynamics.com/Help/ARNET3/ar3conSupportedHtmlTagsInRichText.html An example of what I want to do is replace any match of <div style="text-align:*</div> by <p style=\"text-align:*</p> in order to use a supported tag for text-alignment. I have found the following regex expression to find the correct match in my html input: <div style=\"text-align:(.*?)</div> However, I can't find a way to keep the previous text contained in the tags after my replacement. Any clue? Is it me or Regex are generally a PITA? :) private static readonly IDictionary<string, string> _replaceMap = new Dictionary<string, string> { {"<div style=\"text-align:(.*?)</div>", "<p style=\"text-align:(.*?)</p>"} }; public static string FormatHtml(string html) { foreach(var pair in _replaceMap) { html = Regex.Replace(html, pair.Key, pair.Value); } return html; } Thanks!

    Read the article

  • Need advice on using Grails and Ajax to append to a div like in Rails

    - by Nate
    I'm just starting out in Grails and need some advice on using Ajax. I want to append some html to the bottom of a div inside a form. This is basically what I have: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields -/div- -form- -a-Add Child 4-/a- When I click on the "Add Child" I want to make an ajax call that results in a new childrow getting inserted into the "listOfchildren" div. So the document would look like this: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields childrow 4 input fields -/div- -form- -a-Add Child 5-/a- In Rails I would do something simple like this: render :update do |page| page.insert_html :bottom, "list_of_children", :partial = child_partial page.replace "add_link", :partial = 'add_link' end The previous code sends an javascript back to the browser with two commands. The first command tells the browser to append some html to the bottom of a div. The second command updates the "add link" counter. In grails I can only see how to replace an entire div (which would wipe out the user's existing input) and I don't see how I can call multiple functions from the ajax response. I can probably do this if I was to write some javascript functions in prototype or whatever, but I'd like to avoid that if there is a simpler way. Thanks! Nate

    Read the article

  • Change Data Capture or Change Tracking - Same as Traditional Audit Trail Table?

    - by HardCode
    Before I delve into the abyss of Microsoft documentation any deeper, I'd like to know if someone experienced with Change Data Capture and Change Tracking know if one or both of these can be used to replace the traditional ... "Audit trail table copy of the 'real table' (all of the fields of the original table, plus date/time, user ID, and DML action field) inserted into by Triggers" ... setup for a database table audit trail, where the trigger populates the audit trail table (which is all manual work). The MSDN overview documentation explains at a high level what Change Data Capture and Change Tracking are, but it isn't clear enough to me, and doesn't state outright, that these tools can be used to replace the traditional audit trail tables we've made so often. Can someone with any experience using Change Data Capture and Change Tracking save me a lot of time, or confirm that I am spending time looking at the right tool? The critical part of our audit trail is capturing all changes to a table's fields (on INSERT, UPDATE, DELETE), when it happened, and who did it. These changes are commonly provided to an end user chronologically via an audit trail report. Which is another question ... Change Data Capture or Change Tracking is the solution, I'd assume that this data can be queried just like data from a normal table? EDIT: I need a permanent audit trail, irregardless of time. I see that Change Data Capture has to do with the transaction logs, so this sounds finite to me.

    Read the article

  • How to test a DAO with JPA implementation ?

    - by smallufo
    Hi I came from the Spring camp , I don't want to use Spring , and am migrating to JavaEE6 , But I have problem testing DAO + JPA , here is my simplified sample : public interface PersonDao { public Person get(long id); } This is a very basic DAO , because I came from Spring , I believe DAO still have it value , so I decided to add a DAO layer . public class PersonDaoImpl implements PersonDao , Serializable { @PersistenceContext(unitName = "test", type = PersistenceContextType.EXTENDED) EntityManager entityManager ; public PersonDaoImpl() { } @Override public Person get(long id) { return entityManager .find(Person.class , id); } } This is a JPA-implemented DAO , I hope the EE container or the test container able to inject the EntityManager. public class PersonDaoImplTest extends TestCase { @Inject protected PersonDao personDao; @Override protected void setUp() throws Exception { //personDao = new PersonDaoImpl(); } public void testGet() { System.out.println("personDao = " + personDao); // NULL ! Person p = personDao.get(1L); System.out.println("p = " + p); } } This is my test file . OK , here comes the problem : Because JUnit doesn't understand @javax.inject.Inject , the PersonDao will not be able to injected , the test will fail. How do I find a test framework that able to inject the EntityManager to the PersonDaoImpl , and @Inject the PersonDaoImpl to the PersonDao of TestCase ? I tried unitils.org , but cannot find a sample like this , it just directly inject the EntityManagerFactory to the TestCast , not what I want ...

    Read the article

< Previous Page | 358 359 360 361 362 363 364 365 366 367 368 369  | Next Page >