Search Results

Search found 9872 results on 395 pages for 'preg replace callback'.

Page 367/395 | < Previous Page | 363 364 365 366 367 368 369 370 371 372 373 374  | Next Page >

• vb6 ADODB TSQL procedure call quit working after database migration

  - by phill

  This code was once working on sql server 2005. Now isolated in a visual basic 6 sub routine using ADODB to connect to a sql server 2008 database it throws an error saying: "Login failed for user 'admin' " I have since verified the connection string does work if i replace the body of this sub with the alternative code below this sub. When I run the small program with the button, it stops where it is marked below the asterisk line. Any ideas? thanks in advance. Private Sub Command1_Click() Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset Dim dStartDateIn As Date dStartDateIn = "2010/05/01" cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" 'On Error GoTo GetUnconvertedInvoices_Err With cmdGetInvoices .CommandType = adCmdStoredProc .CommandText = "_sp_cwm5_GetUnCvtdInv" .Name = "_sp_cwm5_GetUnCvtdInv" Set oParm1 = .CreateParameter("@StartDate", adDate, adParamInput) .Parameters.Append oParm1 oParm1.Value = dStartDateIn .ActiveConnection = cSQLConn End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic .CursorType = adOpenKeyset '.CursorType = adOpenStatic .CacheSize = 5000 '***************************Debug stops here .Open cmdGetInvoices End With If myRs.State = adStateOpen Then Set GetUnconvertedInvoices = myRs Else Set GetUnconvertedInvoices = Nothing End If End Sub Here is the code which validates the connection string is working. Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" With cmdGetInvoices .ActiveConnection = cSQLConn .CommandText = "SELECT top 5 * FROM tarInvoice;" .CommandType = adCmdText End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic '.CursorType = adOpenKeyset .CursorType = adOpenStatic '.CacheSize = 5000 .Open cmdGetInvoices End With If myRs.EOF = False Then myRs.MoveFirst Do MsgBox "Record " & myRs.AbsolutePosition & " " & _ myRs.Fields(0).Name & "=" & myRs.Fields(0) & " " & _ myRs.Fields(1).Name & "=" & myRs.Fields(1) myRs.MoveNext Loop Until myRs.EOF = True End If

  Read the article

• Regular expression to convert ul to textindent and back, with a different attribute value for first

  - by chapmanio

  Hi, This is a related to a previous question I have asked here, see the link below for a brief description as to why I am trying to do this. Regular expression from font to span (size and colour) and back (VB.NET) Basically I need a regex replace function (or if this can be done in pure VB then that's fine) to convert all ul tags in a string to textindent tags, with a different attribute value for the first textindent tag. For example: <ul> <li>This is some text</li> <li>This is some more text</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> </ul> Will become: <textformat indent="0"> <li>This is some text</li> <li>This is some more text</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> </textformat> Basically I want the first ul tag to have no indenting, but all nested ul tags to have an indent of 20. I appreciate this is a strange request but hopefully that makes sense, please let me know if you have any questions. Thanks in advance.

  Read the article

• What to Expect in Rails 4

  - by mikhailov

  Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

  Read the article

• When is ¦ not equal to ¦?

  - by Trey Jackson

  Background. I'm working with netlists, and in general, people specify different hierarchies by using /. However, it's not illegal to actually use a / as a part of an instance name. For example, X1/X2/X3/X4 might refer to instance X4 inside another instance named X1/X2/X3. Or it might refer an instance named X3/X4 inside an instance named X2 inside an instance named X1. Got it? There's really no "regular" character that cannot be used as a part of an instance name, so you resort to a non-printable one, or ... perhaps one outside of the standard 0..127 ASCII chars. I thought I'd try (decimal) 166, because for me it shows up as the pipe: ¦. So... I've got some C++ code which constructs the path name using ¦ as the hierarchical separator, so the path above looks like X1¦X2/X3¦X4. Now the GUI is written in Tcl/Tk, and to properly translate this into human readable terms I need to do something like the following: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set humanreadable [join [split $path ¦] /] Basically, replace the ¦ with / (I could also accomplish this with [string map]). Now, the problem is, the ¦ in the string I get from C++ doesn't match the ¦ I can create in Tcl. i.e. This fails: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 string match $path [format X1%cX2/X3%cX4 166 166] Visually, the two strings look identical, but string match fails. I even tried using scan to see if I'd mixed up the bit values. But set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set path2 [format X1%cX2/X3%cX4 166 166] for {set i 0} {$i < [string length $path]} {incr i} { set p [string range $path $i $i] set p2 [string range $path2 $i $i] scan %c $p c scan %c $p2 c2 puts [list $p $c :::: $p2 $c2 equal? [string equal $c $c2]] } Produces output which looks like everything should match, except the [string equal] fails for the ¦ characters with a print line: ¦ 166 :::: ¦ 166 equal? 0 For what it's worth, the character in C++ is defined as: const char SEPARATOR = 166; Any ideas why a character outside the regular ASCII range would fail like this? When I changed the separator to (decimal) 28 (^\), things worked fine. I just don't want to get bit by a similar problem on a different platform. (I'm currently using Redhat Linux).

  Read the article

• Parallel Task Library WaitAny Design

  - by colithium

  I've just begun to explore the PTL and have a design question. My Scenario: I have a list of URLs that each refer to an image. I want each image to be downloaded in parallel. As soon as at least one image is downloaded, I want to execute a method that does something with the downloaded image. That method should NOT be parallelized -- it should be serial. I think the following will work but I'm not sure if this is the right way to do it. Because I have separate classes for collecting the images and for doing "something" with the collected images, I end up passing around an array of Tasks which seems wrong since it exposes the inner workings of how images are retrieved. But I don't know a way around it. In reality there is more to both of these methods but that's not important for this. Just know that they really shouldn't be lumped into one large method that both retrieves and does something with the image. Task<Image>[] downloadTasks = collector.RetrieveImages(listOfURLs); for (int i = 0; i < listOfURLs.Count; i++) { //Wait for any of the remaining downloads to complete int completedIndex = Task<Image>.WaitAny(downloadTasks); Image completedImage = downloadTasks[completedIndex].Result; //Now do something with the image (this "something" must happen serially) } /////////////////////////////////////////////////// public Task<Image>[] RetrieveImages(List<string> urls) { Task<Image>[] tasks = new Task<Image>[urls.Count]; int index = 0; foreach (string url in urls) { string lambdaVar = url; //Required... Bleh tasks[index] = Task<Image>.Factory.StartNew(() => { using (WebClient client = new WebClient()) { //TODO: Replace with live image locations string fileName = String.Format("{0}.png", i); client.DownloadFile(lambdaVar, Path.Combine(Application.StartupPath, fileName)); } return Image.FromFile(Path.Combine(Application.StartupPath, fileName)); }, TaskCreationOptions.LongRunning | TaskCreationOptions.AttachedToParent); index++; } return tasks; }

  Read the article

• How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

  - by dommer

  I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

  Read the article

• How to override loading a TImage from the object inspector (at run-time)?

  - by Mawg

  Further to my previous question, which did not get a useful answer despite a bounty, I will try rephrasing the question. Basically, when the user clicks the ellipsis in the object inspector, Delphi opens a file/open dialog. I want to replace this handling with my own, so that I can save the image's path. I would have expected that all I need to do is to derive a class from TImage and override the Assign() function, as in the following code. However, when I do the assign function is never called. So, it looks like I need to override something else, but what? unit my_Image; interface uses Classes, ExtCtrls, Jpeg, Graphics; type Tmy_Image = class(Timage) private FPicture : TPicture; protected procedure OnChange(Sender: TObject); public { Public declarations } Constructor Create(AOwner: TComponent); override; procedure SetPicture(picture : TPicture); procedure Assign(Source: TPersistent); override; published { Published declarations - available in the Object Inspector at design-time } property Picture : TPicture read FPicture write SetPicture; end; // of class Tmy_Image() procedure Register; implementation uses Controls, Dialogs; procedure Register; begin RegisterComponents('Standard', [Tmy_Image]); end; Constructor Tmy_Image.Create(AOwner: TComponent); begin inherited; // Call the parent Create method Hint := 'Add an image from a file|Add an image from a file'; // Tooltip | status bar text AutoSize := True; // Control resizes when contents change (new image is loaded) Height := 104; Width := 104; FPicture := TPicture.Create(); self.Picture.Bitmap.LoadFromResourceName(hInstance, 'picture_poperty_bmp'); end; procedure Tmy_Image.OnChange(Sender: TObject); begin Constraints.MaxHeight := Picture.Height; Constraints.MaxWidth := Picture.Width; Self.Height := Picture.Height; Self.Width := Picture.Width; end; procedure Tmy_Image.SetPicture(picture : TPicture); begin MessageDlg('Tmy_Image.SetPicture', mtWarning, [mbOK], 0); // never called end; procedure Tmy_Image.Assign(Source: TPersistent); begin MessageDlg('Tmy_Image.Assign', mtWarning, [mbOK], 0); // never called end; end.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• The impossible inline Javascript delay/sleep

  - by trex005

  There is a JavaScript function, of which I have zero control of the code, which calls a function that I wrote. My function uses DOM to generate an iFrame, defines it's src and then appends it to another DOM element. However, before my function returns, and thus allows continued execution of the containing function, it is imperative that the iFrame be fully loaded. Here are the things that I have tried and why they do not work : 1. The SetTimeout option : 99.999% of the time, this is THE answer. As a matter of fact, in the past decade that I have been mentoring in JavaScript, I have always insisted that code could always be refactored to use this option, and never believed a scenario existed where that was not the case. Well, I finally found one! The problem is that because my function is being called inline, if the very next line is executed before my iFrame finishes loading, it totally neuters my script, and since the moment my script completes, the external script continues. A callback of sorts will not work 2. The "Do nothing" loop :This option you use while(//iFrame is not loaded){//do nothing}. In theory this would not return until the frame is loaded. The problem is that since this hogs all the resources, the iFrame never loads. This trick, although horribly unprofessional, dirty etc. will work when you just need an inline delay, but since I require an external thread to complete, it will not.In FF, after a few seconds, it pauses the script and an alert pops up stating that there is an unresponsive script. While that alert is up, the iFrame is able to load, and then my function is able to return, but having the browser frozen for 10 seconds, and then requiring the user to correctly dismiss an error is a no go. 3. The model dialogue : I was inspired by the fact that the FF popup allowed the iFrame to load while halting the execution of the function, and thinking about it, I realized that it is because the modal dialogue, is a way of halting execution yet allowing other threads to continue! Brilliant, so I decided to try other modal options. Things like alert() work beautifully! When it pops up, even if only up for 1/10th of a second, the iFrame is able to complete, and all works great. And just in case the 1/10 of a second is not sufficient, I can put the model dialogue in the while loop from solution 2, and it would ensure that the iFrame is loaded in time. Sweet right? Except for the fact that I now have to pop up a very unprofessional dialogue for the user to dismiss in order to run my script. I fought with myself about this cost/benefit of this action, but then I encountered a scenario where my code was called 10 times on a single page! Having to dismiss 10 alerts before acessing a page?! That reminds me of the late 90s script kiddie pages, and is NOT an option. 4. A gazillion other delay script out there:There are about 10 jQuery delay or sleep functions, some of them actually quite cleverly developed, but none worked. A few prototype options, and again, none I found could do it! A dozen or so other libraries and frameworks claimed they had what I needed, but alas they all conspired to give me false hope. I am convinced that since a built in model dialogue can halt execution, while allowing other threads to continue, there must be some code accessible way to do the same thing with out user input. The Code is literally thousands upon thousands of lines and is proprietary, so I wrote this little example of the problem for you to work with. It is important to note the ONLY code you are able to change is in the onlyThingYouCanChange function Test File : <html> <head> </head> </html> <body> <div id='iFrameHolder'></div> <script type='text/javascript'> function unChangeableFunction() { new_iFrame = onlyThingYouCanChange(document.getElementById('iFrameHolder')); new_iFrame_doc = (new_iFrame.contentWindow || new_iFrame.contentDocument); if(new_iFrame_doc.document)new_iFrame_doc=new_iFrame_doc.document; new_iFrame_body = new_iFrame_doc.body; if(new_iFrame_body.innerHTML != 'Loaded?') { //The world explodes!!! alert('you just blew up the world! Way to go!'); } else { alert('wow, you did it! Way to go!'); } } var iFrameLoaded = false; function onlyThingYouCanChange(objectToAppendIFrameTo) { iFrameLoaded = false; iframe=document.createElement('iframe'); iframe.onload = new Function('iFrameLoaded = true'); iframe.src = 'blank_frame.html'; //Must use an HTML doc on the server because there is a very specific DOM structure that must be maintained. objectToAppendIFrameTo.appendChild(iframe); var it = 0; while(!iFrameLoaded) //I put the limit on here so you don't { //If I was able to put some sort of delay here that paused the exicution of the script, but did not halt all other browser threads, and did not require user interaction we'd be golden! //alert('test'); //This would work if it did not require user interaction! } return iframe; } unChangeableFunction(); </script> </body> blank_frame.html : <html> <head> </head> <body style='margin:0px'>Loaded?</body> </html>

  Read the article

• removing contents of div using Jquery "empty" doesn't work

  - by Andrew

  I'm trying to remove contents of particular div which are basically list items and a heading by using jquery empty so that I could replace with new contents. What happens when I run the code is, the whole div element blinked and flash the replaced content and then the old one reappear. Can anyone tell me what am I doing wrong? Here's an excerpt of my code - <pre> $("#msg_tab").bind("click",function(){ $("#sidebar1").remove(); var html="<ul><li><h2>test</h2><ul><li><a href='#'>Compose New Message</a></li><li><a href='#'>Inbox</a></li><li><a href='#'>Outbox</a></li><li><a href='#'>Unread</a></li><li><a href='#'>Archive</a></li></ul></li></ul>"; $("#sidebar1").append(html); }); <div id="sidebar1" class="sidebar"> <ul> <li> <h2>Messages</h2> <ul> <li><a href="#">Compose New Message</a></li> <li><a href="#">Inbox</a></li> <li><a href="#">Outbox</a></li> <li><a href="#">Unread</a></li> <li><a href="#">Archive</a></li> </ul> </li> </ul> </div> Another question is, how do I write multiple line html code string in javascript so that java would recognize as a string value? Placing forward slash at the end is ok when the string is not a html code but, in html code, I can't figure out how to escape forward slash from ending tags.I've tried escaping it with backward slash but doesn't work. I would be appreciated if anyone could shed a light on this matter as well.

  Read the article

• basic operations for modifying a source document with XSLT

  - by SpliFF

  All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

  Read the article

• jQuery UI dialog + WebKit + HTML response with script

  - by Anthony Koval'

  Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

  Read the article

• maven-ear-plugin works if jboss version is 4.2, but not 5. Why ?

  - by NSINGH

  I am using maven to configure maven-ear-plugin. I am getting following exception when I say jboss version is 5 (See below code, under tag). It works if I replace version to 4.2 <build> <finalName>tactical</finalName> <plugins> <plugin> <artifactId>maven-ear-plugin</artifactId> <configuration> <version>5</version> <defaultJavaBundleDir>lib</defaultJavaBundleDir> <jboss> <version>5</version> <loader-repository>seam.jboss.org:loader=tactical</loader-repository> </jboss> <modules> <ejbModule> <groupId>${project.groupId}</groupId> <artifactId>tactical-jar</artifactId> </ejbModule> </modules> </configuration> </plugin> </plugins> </build> Why it works fine for jboss 4.2 but not for 5. What ?? I get the following exception: [INFO] Failed to initialize JBoss configuration Embedded error: Invalid JBoss configuration, version[5] is not supported. [INFO] ------------------------------------------------------------------------ [INFO] Trace org.apache.maven.lifecycle.LifecycleExecutionException: Failed to initialize JBoss configuration at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoals(DefaultLifecycleExecutor.java:583) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoalWithLifecycle(DefaultLifecycleExecutor.java:49 9) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoal(DefaultLifecycleExecutor.java:478) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoalAndHandleFailures(DefaultLifecycleExecutor.jav a:330) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeTaskSegments(DefaultLifecycleExecutor.java:291) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.execute(DefaultLifecycleExecutor.java:142) at org.apache.maven.DefaultMaven.doExecute(DefaultMaven.java:336) at org.apache.maven.DefaultMaven.execute(DefaultMaven.java:129) at org.apache.maven.cli.MavenCli.main(MavenCli.java:287) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.codehaus.classworlds.Launcher.launchEnhanced(Launcher.java:315) at org.codehaus.classworlds.Launcher.launch(Launcher.java:255) at org.codehaus.classworlds.Launcher.mainWithExitCode(Launcher.java:430) at org.codehaus.classworlds.Launcher.main(Launcher.java:375) Caused by: org.apache.maven.plugin.MojoExecutionException: Failed to initialize JBoss configuration at org.apache.maven.plugin.ear.AbstractEarMojo.execute(AbstractEarMojo.java:159) at org.apache.maven.plugin.ear.GenerateApplicationXmlMojo.execute(GenerateApplicationXmlMojo.java:96) at org.apache.maven.plugin.DefaultPluginManager.executeMojo(DefaultPluginManager.java:451) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoals(DefaultLifecycleExecutor.java:558) ... 16 more Caused by: org.apache.maven.plugin.ear.EarPluginException: Invalid JBoss configuration, version[5] is not supported. at org.apache.maven.plugin.ear.JbossConfiguration.(JbossConfiguration.java:95) at org.apache.maven.plugin.ear.AbstractEarMojo.initializeJbossConfiguration(AbstractEarMojo.java:296) at org.apache.maven.plugin.ear.AbstractEarMojo.execute(AbstractEarMojo.java:155) ... 19 more [INFO] ------------------------------------------------------------------------ [INFO] Total time: 2 seconds Any idea. Thanks

  Read the article

• How do I make a full screen scrolling messagebox or window?

  - by chobo2

  Hi First let me start of saying I know absolutely nothing about c++ and I am really just more interested in getting this to work then learning c++(I got enough on my plate to learn). So basically I am trying to make a terms of service for my windows mobile 6 professional application but it seems I need to use c++ to do it. After hours of searching I found a solution but it developed for windows mobile standard. So they somehow used c++ to make a message box and on standard devices(ie non touch screen phones) the message box can have like scrolling. For some reason this is not the case with professional devices(touch screen devices). So my message box goes off the page and you can never accept or decline the terms. So your stuck and on the screen forever till you do some sort of soft restart. http://www.mobilepractices.com/2008/10/setupdll-sample-and-walkthrough-terms.html The above link is the tutorial but here is the actual file that seems to display the message. #include "stdafx.h" #include "ce_setup.h" // This is a variable containing the text to be displayed // in the Terms & Conditions dialog TCHAR Message[] = _T("TERMS & CONDITIONS\r\n ") _T("Selecting YES you're accepting our terms & conditions.\r\n") _T("This is just a sample application.\r\n") _T("From http://www.mobilepractices.com\r\n") _T("You can replace this text with your own.\r\n") _T("We're using a setup.dll to show this dialog.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Last line.\r\n") ; // This function will be called when the user // tries to install the cab. According to its return // value the installation continues or is cancelled. // As this could be called more than once // (i.e. if there is not enough space on the target) // we should take care about fFirstCall parameter // to show the dialog only once. codeINSTALL_INIT Install_Init( HWND hwndParent, BOOL fFirstCall, BOOL fPreviouslyInstalled, LPCTSTR pszInstallDir ) { if (!fFirstCall || ::MessageBoxW(0, Message, _T("SplashScreenSample") , MB_YESNO) == IDYES) return codeINSTALL_INIT_CONTINUE; else return codeINSTALL_INIT_CANCEL; } So I want to change this to something that can scroll. Can I use like a panel control since I know what has scroll or something else? Thanks

  Read the article

• Converting C source to C++

  - by Barry Kelly

  How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

  Read the article

• Trouble with ASP.NET MVC auto-scaffolder template

  - by DanM

  I'm trying to write an auto-scaffolder template for Index views. I'd like to be able to pass in a collection of models or view-models (e.g., IQueryable<MyViewModel>) and get back an HTML table that uses the DisplayName attribute for the headings (th elements) and Html.Display(propertyName) for the cells (td elements). Each row should correspond to one item in the collection. Here's what I have so far: <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl" %> <% var items = (IQueryable<TestProj.ViewModels.TestViewModel>)Model; // How do I make this generic? var properties = items.First().GetMetadata().Properties .Where(pm => pm.ShowForDisplay && !ViewData.TemplateInfo.Visited(pm)); %> <table> <tr> <% foreach(var property in properties) { %> <th> <%= property.DisplayName %> </th> <% } %> </tr> <% foreach(var item in items) { HtmlHelper itemHtml = ????; // What should I put in place of "????"? %> <tr> <% foreach(var property in properties) { %> <td> <%= itemHtml.Display(property.DisplayName) %> </td> <% } %> </tr> <% } %> </table> Two problems with this: I'd like it to be generic. So, I'd like to replace var items = (IQueryable<TestProj.ViewModels.TestViewModel>)Model; with var items = (IQueryable<T>)Model; or something to that effect. A property Html is automatically created for me when the view is created, but this HtmlHelper applies to the whole collection. I need to somehow create an itemHtml object that applies just to the current item in the foreach loop. I'm not sure how to do this, however, because the constructors for HtmlHelper don't take a Model object. How do I solve these two problems?

  Read the article

• ASP.Net MVC + Live validation - how come the flagged text are all over the place?

  - by melaos

  hi guys, this is an asp.net mvc project and <% using (Html.BeginForm("ProductAdded", "Home")) { % Register Your Product <%= ViewData["MainHeader"]% <p><%=ViewData["IntroText"]%></p> <div style="display: none;"> <div id="regionThreePane"> <table border="0" cellpadding="0" cellspacing="0" frame="void" style="width: 100%"> <tr> <td width='250px'><select name="ProdLBox1" id="ProdLBox1" class="ProdLBox1" size="8"></select></td> <td width='250px'><select name="ProdLBox2" id="ProdLBox2" class="ProdLBox2" size="8"></select></td> <td width='250px'><select name="ProdLBox3" id="ProdLBox3" class="ProdLBox3" size="8"></select></td> </tr> </table> </div> i'm using live validation for my client side validation. var v_fname = new LiveValidation('Customer_FirstName', { validMessage: " " }, { onlyOnSubmit: true }); v_fname.add(Validate.Presence, { failureMessage: enterfirstname}); var v_lname = new LiveValidation('Customer_LastName', { validMessage: " " }); v_lname.add(Validate.Presence, { failureMessage: enterlastname }); var v_email = new LiveValidation('Customer_Email', { validMessage: " " }); v_email.add(Validate.Presence, { failureMessage: enteremail, validMessage: " " }); v_email.add(Validate.Email, { failureMessage: entervalidemail}); and what i notice is that after doing some button call: $(".btnAddProduct").click(function() { //Check first to see if there's anything to be added if (parseFloat($(".tboAddProduct").val()) < 1) { //TO DO: to replace with localized text var selectProductError = "Please select a product first"; $("#validationSummary").text(selectProductError); //alert("Please select a product first"); return false; } $(".PanelProductReg").show(); addProductRow($(".tboAddProductId").val(), $("#tboAddProduct").val()); }); what will happen is that the validation tags will start to appear for the whole page for all the input which are tag for the live validation. instead of just appearing when the controls are being higlighted and onblur. i'm using some ajax calls to get data and a lot of jquery to dynamically do the gui stuff. could any of this be causing some sort of an internal conflict? thanks

  Read the article

• Sanitizing DB inputs with XSLT

  - by azathoth

  Hello I've been looking for a method to strip my XML content of apostrophes (') like: <name> Jim O'Connor</name> since my DBMS is complaining of receiving those. By looking at the example described here, that is supposed to replace ' with '', I constructed the following script: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes" /> <xsl:template match="node()|@*"> <xsl:copy> <xsl:apply-templates select="node()|@*" /> </xsl:copy> </xsl:template> <xsl:template name="sqlApostrophe"> <xsl:param name="string" /> <xsl:variable name="apostrophe">'</xsl:variable> <xsl:choose> <xsl:when test="contains($string,$apostrophe)"> <xsl:value-of select="concat(substring-before($string,$apostrophe), $apostrophe,$apostrophe)" disable-output-escaping="yes" /> <xsl:call-template name="sqlApostrophe"> <xsl:with-param name="string" select="substring-after($string,$apostrophe)" /> </xsl:call-template> </xsl:when> <xsl:otherwise> <xsl:value-of select="$string" disable-output-escaping="yes" /> </xsl:otherwise> </xsl:choose> </xsl:template> <xsl:template match="node()|@*"> <xsl:apply-templates name="sqlApostrophe"/> </xsl:template> </xsl:stylesheet> However, the processor isn't accepting it. What am I missing here? Is there a better way to get rid of the apostrophes? Perhaps another approach for sanitizing DB inputs by using XSLT? Thanks for your help

  Read the article

• How do I hide the text links over a toggleable horizontal list with background images.

  - by Sivakanesh

  I'm trying to create a UL/LI horizontal list with background images only, with no text link visible. The reason for this is so that when I over over a list item, the background would rollover and when I click on it the current item would toggle. basically it is a horizontal menu with background images that can be toggled; mimicking the job of a radio button. I have done it like this; <div id="options"> <ul id="list"> <li class="active"><a href="#" class="option1 active" id="link1"><span>XXXXX</span></a></li> <li><a href="#" class="option2" id="link2"><span>XXXXX</span></a></li> <li><a href="#" class="option3" id="link3"><span>XXXXX</span></a></li> </ul> </div> The CSS for option1, option2 and option3 simply define the background image. #options LI{list-style-type: none; display : inline} a.option1{ background:url('../images/option1.png') no-repeat;} a.option2{ background:url('../images/option2.png') no-repeat;} a.option3{ background:url('../images/option3.png') no-repeat;} a.option1, a.option2, a.option3{ background-position:top; display:inline; width:230px; height:40px; } And the hover & active css part simply sets the background position like so- a.option1:hover, a.option2:hover, a.option3:hover{ background-position:bottom; } a.active{ background-position:bottom !important; } This works fine, however on top of the background I get the words "XXXXX" as text links and I'm struggling to hide them. They are interfering with the hover action and preventing rollover (even if I replace XXXXX with a period or something short). I can't just remove the text from the link as it would hide the whole LI element. I have tried to use display:none; or text-indent:-999px but then the whole UI element becomes invisible. I can't understand what I'm doing wrong. Are you able to help? Thanks

  Read the article

• PHP Session Class and $_SESSION Array

  - by Gianluca Bargelli

  Hello, i've implemented this custom PHP Session Class for storing sessions into a MySQL database: class Session { private $_session; public $maxTime; private $database; public function __construct(mysqli $database) { $this->database=$database; $this->maxTime['access'] = time(); $this->maxTime['gc'] = get_cfg_var('session.gc_maxlifetime'); session_set_save_handler(array($this,'_open'), array($this,'_close'), array($this,'_read'), array($this,'_write'), array($this,'_destroy'), array($this,'_clean') ); register_shutdown_function('session_write_close'); session_start();//SESSION START } public function _open() { return true; } public function _close() { $this->_clean($this->maxTime['gc']); } public function _read($id) { $getData= $this->database->prepare("SELECT data FROM Sessions AS Session WHERE Session.id = ?"); $getData->bind_param('s',$id); $getData->execute(); $allData= $getData->fetch(); $totalData = count($allData); $hasData=(bool) $totalData >=1; return $hasData ? $allData['data'] : ''; } public function _write($id, $data) { $getData = $this->database->prepare("REPLACE INTO Sessions VALUES (?, ?, ?)"); $getData->bind_param('sss', $id, $this->maxTime['access'], $data); return $getData->execute(); } public function _destroy($id) { $getData=$this->database->prepare("DELETE FROM Sessions WHERE id = ?"); $getData->bind_param('S', $id); return $getData->execute(); } public function _clean($max) { $old=($this->maxTime['access'] - $max); $getData = $this->database->prepare("DELETE FROM Sessions WHERE access < ?"); $getData->bind_param('s', $old); return $getData->execute(); } } It works well but i don't really know how to properly access the $_SESSION array: For example: $db=new DBClass();//This is a custom database class $session=new Session($db->getConnection()); if (isset($_SESSION['user'])) { echo($_SESSION['user']);//THIS IS NEVER EXECUTED! } else { $_SESSION['user']="test"; Echo("Session created!"); } At every page refresh it seems that $_SESSION['user'] is somehow "resetted", what methods can i apply to prevent such behaviour?

  Read the article

• jQuery: Giving each matched element an unique ID

  - by AnGafraidh

  I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

  Read the article

• why i am getting popup message when I am tryiing to update user.

  - by kumar

  I am getting Popup mesage something like You have chosen to open Update which is a:application/json From : http://localhost:1234 which ok cancel buttons.. I am using this code to run.. [HttpPost] public JsonResult MEdit(ExpenseBE e) { var cache = CacheFactory.GetCacheManager(); string F_ACTION = "U"; string F_DEBUG = "Y"; var excUpdateStatus = false; for (int i = 0; i <= cache.Count; i++) { var x = (ExpenseBE)cache.GetData("a" + i); if (x != null) { string Resolutioncode = e.Exception.ResolutionCode; string reasoncode = e.Exception.ReasonCode; string actioncode = e.Exception.ActionCode; e.Exception.ExceptionID = x.Exception.ExceptionID; e.Exception.ReasonCode = reasoncode; e.Exception.ReasonCode = Resolutioncode; e.Exception.ActionCode = actioncode; e.Exception.Sequence = x.Exception.Sequence; e.Exception.FollowupDate = x.Exception.FollowupDate; e.Exception.IOL = x.Exception.IOL; e.Exception.LastUpdateUser = User.Identity.Name.ToUpper().Remove(0, 4); excUpdateStatus = common.UpdateException(e.Exception, F_ACTION, F_DEBUG); } } return Json(excUpdateStatus.ToString()); } and my view is <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl<NorthernTrust.ATP.iTool.Core.Business.Entities.Specialist.ExpenseBE>" %> <% using (Html.BeginForm("MEdit", "expense", FormMethod.Post)) { %> <%= Html.ValidationSummary(true)%> <fieldset class="clearfix" id="fieldset-exception"> <legend>Mass Edit Exception Information</legend> <div class="fiveper"> <label for="ExceptionStatus"> Status: <span> </span> </label> <label for="ResolutionCode"> Resolution: <span> <%=Html.DropDownListFor(model=>model.Exception.ResolutionCode,new SelectList(Model.LookupCodes["C_EXCPT_RESL"], "Key", "Value"))%> </span> </label> <label for="ReasonCode"> Reason: <span><%=Html.DropDownListFor(model => model.Exception.ReasonCode, new SelectList(Model.LookupCodes["C_EXCPT_RSN"], "Key", "Value"))%></span> </label> <label for="ExceptionStatus"> Action Taken: <span><%=Html.DropDownListFor(model => model.Exception.ActionCode, new SelectList(Model.LookupCodes["C_EXCPT_ACT"], "Key", "Value"))%></span> </label> </div> <div class="fiveper"> <label for="FollowupDate"> Follow-up: <span><input type="text" id="exc-flwup-" /></span> <%--<%=Html.EditorFor(model=>model.Exception.FollowupDate) %>--%> </label> <label for="IOL"> Inquiry #: <%=Html.TextBox("Inquiery", ViewData["inq"] ?? "")%> </label> <label>Comment</label> <span> <%=Html.TextArea("value") %> <%=Html.ValidationMessage("value")%> </span> </div> <br /> <br /> <div> <button id="btnSelect" class="button">Select All</button> <button id="btnCancel" class="button">Cancel</button> <input type="submit" class="button" value="Save" /> </div> </fieldset> <% } %> <script type="text/javascript"> $(document).ready(function() { $('#btnSelectAll').click(function() { function validate_excpt(formData, jqForm, options) { var form = jqForm[0]; } $('#btnSelect').click(function() { $('#input [type=checkbox]').attr('checked', 'checked'); }); // post-submit callback function showResponse(responseText, statusText, xhr, $form) { if ('success' == statusText) { $('#error-msg span:last').html('<strong>Update successful.</strong>'); } else { $('#error-msg span:last').html('<strong>Update failed.</strong> ' + responseText); } $('#error-msg').removeClass('hide'); } $('#exc').ajaxForm({ target: '#error-msg', beforeSubmit: validate_excpt, success: showResponse, dataType: 'json' }); $('.button').button(); }); $('.button').button(); $("input[id^='exc-flwup-']").datepicker({ duration: '', showTime: true, constrainInput: true, stepMinutes: 30, stepHours: 1, altTimeField: '', time24h: true, minDate: 0 }); $('#ui-timepicker-div').bgiframe(); }); </script> please correct me if i am doing somwhere wrong? thanks

  Read the article

• How do I create a safe local development environment?

  - by docgnome

  I'm currently doing web development with another developer on a centralized development server. In the past this has worked alright, as we have two separate projects we are working on and rarely conflict. Now, however, we are adding a third (possible) developer into the mix. This is clearly going to create problems with other developers changes affecting my work and vice versa. To solve this problem, I'm thinking the best solution would be to create a virtual machine to distribute between the developers for local use. The problem I have is when it comes to the database. Given that we all develop on laptops, simply keeping a local copy of the live data is plain stupid. I've considered sanitizing the data, but I can't really figure out how to replace the real data, with data that would be representative of what people actually enter with out repeating the same information over and over again, e.g. everyone's address becomes 123 Testing Lane, Test Town, WA, 99999 or something. Is this really something to be concerned about? Are there tools to help with this sort of thing? I'm using MySQL. Ideally, if I sanitized the db it should be done from a script that I can run regularly. If I do this I'd also need a way to reduce the size of the db itself. (I figure I could select all the records created after x and whack them and all the records in corresponding tables out so that isn't really a big deal.) The second solution I've thought of is to encrypt the hard drive of the vm, but I'm unsure of how practical this is in terms of speed and also in the event of a lost/stolen laptop. If I do this, should the vm hard drive file itself be encrypted or should it be encrypted in the vm? (I'm assuming the latter as it would be portable and doesn't require the devs to have any sort of encryption capability on their OS of choice.) The third is to create a copy of the database for each developer on our development server that they are then responsible to keep the schema in sync with the canonical db by means of migration scripts or what have you. This solution seems to be the simplest but doesn't really scale as more developers are added. How do you deal with this problem?

  Read the article

• Why is FF on OS X loosing jQuery-UI in click event handler?

  - by Jean-François Beauchamp

  In a web page using jQUery 1.7.1 and jQUery-UI 1.8.18, if I output $.ui in an alert box when the document is ready, I get [object Object]. However when using Firefox, if I output $.ui in a click event handler, I get 'undefined' as result. With other browsers (latest versions of IE, Chrome and Safari), the result is still [object Object] when clicking on the link. Here is my HTML Page: <!doctype html> <html> <head> <title></title> <script src="Scripts/jquery-1.7.1.js" type="text/javascript"></script> <script src="Scripts/jquery-ui-1.8.18.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function () { alert($.ui); // ALERT A $(document).on("click", ".dialogLink", function () { alert($.ui); // ALERT B return false; }); }); </script> </head> <body> <a href="#" class="dialogLink">Click me!</a> </body> </html> In this post, I reduced to its simplest form another problem I was having described here: $(this).dialog is not a function. I created a new post for the sake of clarity, since the real question is different from the original one now that pin-pointed where the problem resided. UPDATE: IF I replace my alerts with simply alert($); I get this result for alert A: function (selector, context) { return new jQuery.fn.init(selector, context, rootjQuery); } and this one for alert B: function (a, b) { return new d.fn.init(a, b, g); } This does not make sense to me, although I may not be understanding well enough what $ is... UPDATE 2: I can only reproduce this problem using Firefox on OS X. On Firefox running on Windows 7, everything is fine.

  Read the article

• How do I create/use a Fluent NHibernate convention to map UInt32 properties to an SQL Server 2008 da

  - by dommer

  I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

  Read the article

< Previous Page | 363 364 365 366 367 368 369 370 371 372 373 374  | Next Page >