Search Results

Search found 10033 results on 402 pages for 'execution speed'.

Page 370/402 | < Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • which way is correct to retrive data from oracle??

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • web service filling gridview awfully slow, as is paging/sorting

    - by nat
    Hi I am making a page which calls a web service to fill a gridview this is returning alot of data, and is horribly slow. i ran the svcutil.exe on the wsdl page and it generated me the class and config so i have a load of strongly typed objects coming back from each request to the many service functions. i am then using LINQ to loop around the objects grabbing the necessary information as i go, but for each row in the grid i need to loop around an object, and grab another list of objects (from the same request) and loop around each of them.. 1 to many parent object child one.. all of this then gets dropped into a custom datatable a row at a time.. hope that makes sense.... im not sure there is any way to speed up the initial load. but surely i should be able to page/sort alot faster than it is doing. as at the moment, it appears to be taking as long to page/sort as it is to load initially. i thought if when i first loaded i put the datasource of the grid in the session, that i could whip it out of the session to deal with paging/sorting and the like. basically it is doing the below protected void Page_Load(object sender, EventArgs e) { //init the datatable //grab the filter vars (if there are any) WebServiceObj WS = WSClient.Method(args); //fill the datatable (around and around we go) foreach (ParentObject po in WS.ReturnedObj) { var COs = from ChildObject c in WS.AnotherReturnedObj where c.whatever.equals(...) ...etc foreach(ChildObject c in COs){ myDataTable.Rows.Add(tlo.this, tlo.that, c.thisthing, c.thatthing, etc......); } } grdListing.DataSource = myDataTable; Session["dt"] = myDataTable; grdListing.DataBind(); } protected void Listing_PageIndexChanging(object sender, GridViewPageEventArgs e) { grdListing.PageIndex = e.NewPageIndex; grdListing.DataSource = Session["dt"] as DataTable; grdListing.DataBind(); } protected void Listing_Sorting(object sender, GridViewSortEventArgs e) { DataTable dt = Session["dt"] as DataTable; DataView dv = new DataView(dt); string sortDirection = " ASC"; if (e.SortDirection == SortDirection.Descending) sortDirection = " DESC"; dv.Sort = e.SortExpression + sortDirection; grdListing.DataSource = dv.ToTable(); grdListing.DataBind(); } am i doing this totally wrongly? or is the slowness just coming from the amount of data being bound in/return from the Web Service.. there are maybe 15 columns(ish) and a whole load of rows.. with more being added to the data the webservice is querying from all the time any suggestions / tips happily received thanks

    Read the article

  • Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

    - by chernevik
    I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Having trouble wrapping functions in the linux kernel

    - by Corey Henderson
    I've written a LKM that implements Trusted Path Execution (TPE) into your kernel: https://github.com/cormander/tpe-lkm I run into an occasional kernel OOPS (describe at the end of this question) when I define WRAP_SYSCALLS to 1, and am at my wit's end trying to track it down. A little background: Since the LSM framework doesn't export its symbols, I had to get creative with how I insert the TPE checking into the running kernel. I wrote a find_symbol_address() function that gives me the address of any function I need, and it works very well. I can call functions like this: int (*my_printk)(const char *fmt, ...); my_printk = find_symbol_address("printk"); (*my_printk)("Hello, world!\n"); And it works fine. I use this method to locate the security_file_mmap, security_file_mprotect, and security_bprm_check functions. I then overwrite those functions with an asm jump to my function to do the TPE check. The problem is, the currently loaded LSM will no longer execute the code for it's hook to that function, because it's been totally hijacked. Here is an example of what I do: int tpe_security_bprm_check(struct linux_binprm *bprm) { int ret = 0; if (bprm->file) { ret = tpe_allow_file(bprm->file); if (IS_ERR(ret)) goto out; } #if WRAP_SYSCALLS stop_my_code(&cs_security_bprm_check); ret = cs_security_bprm_check.ptr(bprm); start_my_code(&cs_security_bprm_check); #endif out: return ret; } Notice the section between the #if WRAP_SYSCALLS section (it's defined as 0 by default). If set to 1, the LSM's hook is called because I write the original code back over the asm jump and call that function, but I run into an occasional kernel OOPS with an "invalid opcode": invalid opcode: 0000 [#1] SMP RIP: 0010:[<ffffffff8117b006>] [<ffffffff8117b006>] security_bprm_check+0x6/0x310 I don't know what the issue is. I've tried several different types of locking methods (see the inside of start/stop_my_code for details) to no avail. To trigger the kernel OOPS, write a simple bash while loop that endlessly starts a backgrounded "ls" command. After a minute or so, it'll happen. I'm testing this on a RHEL6 kernel, also works on Ubuntu 10.04 LTS (2.6.32 x86_64). While this method has been the most successful so far, I have tried another method of simply copying the kernel function to a pointer I created with kmalloc but when I try to execute it, I get: kernel tried to execute NX-protected page - exploit attempt? (uid: 0). If anyone can tell me how to kmalloc space and have it marked as executable, that would also help me solve the above problem. Any help is appreciated!

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • How would you implement this "WorkerChain" functionality in .NET?

    - by Dan Tao
    Sorry for the vague question title -- not sure how to encapsulate what I'm asking below succinctly. (If someone with editing privileges can think of a more descriptive title, feel free to change it.) The behavior I need is this. I am envisioning a worker class that accepts a single delegate task in its constructor (for simplicity, I would make it immutable -- no more tasks can be added after instantiation). I'll call this task T. The class should have a simple method, something like GetToWork, that will exhibit this behavior: If the worker is not currently running T, then it will start doing so right now. If the worker is currently running T, then once it is finished, it will start T again immediately. GetToWork can be called any number of times while the worker is running T; the simple rule is that, during any execution of T, if GetToWork was called at least once, T will run again upon completion (and then if GetToWork is called while T is running that time, it will repeat itself again, etc.). Now, this is pretty straightforward with a boolean switch. But this class needs to be thread-safe, by which I mean, steps 1 and 2 above need to comprise atomic operations (at least I think they do). There is an added layer of complexity. I have need of a "worker chain" class that will consist of many of these workers linked together. As soon as the first worker completes, it essentially calls GetToWork on the worker after it; meanwhile, if its own GetToWork has been called, it restarts itself as well. Logically calling GetToWork on the chain is essentially the same as calling GetToWork on the first worker in the chain (I would fully intend that the chain's workers not be publicly accessible). One way to imagine how this hypothetical "worker chain" would behave is by comparing it to a team in a relay race. Suppose there are four runners, W1 through W4, and let the chain be called C. If I call C.StartWork(), what should happen is this: If W1 is at his starting point (i.e., doing nothing), he will start running towards W2. If W1 is already running towards W2 (i.e., executing his task), then once he reaches W2, he will signal to W2 to get started, immediately return to his starting point and, since StartWork has been called, start running towards W2 again. When W1 reaches W2's starting point, he'll immediately return to his own starting point. If W2 is just sitting around, he'll start running immediately towards W3. If W2 is already off running towards W3, then W2 will simply go again once he's reached W3 and returned to his starting point. The above is probably a little convoluted and written out poorly. But hopefully you get the basic idea. Obviously, these workers will be running on their own threads. Also, I guess it's possible this functionality already exists somewhere? If that's the case, definitely let me know!

    Read the article

  • Modify audio pitch of recorded clip (m4v)

    - by devcube
    I'm writing an app in which I'm trying to change the pitch of the audio when I'm recording a movie (.m4v). Or by modifying the audio pitch of the movie afterwards. I want the end result to be a movie (.m4v) that has the original length (i.e. same visual as original) but with modified sound pitch, e.g. a "chipmunk voice". A realtime conversion is to prefer if possible. I've read alot about changing audio pitch in iOS but most examples focus on playback, i.e. playing the sound with a different pitch. In my app I'm recording a movie (.m4v / AVFileTypeQuickTimeMovie) and saving it using standard AVAssetWriter. When saving the movie I have access to the following elements where I've tried to manipulate the audio (e.g. modify the pitch): audio buffer (CMSampleBufferRef) audio input writer (AVAssetWriterAudioInput) audio input writer options (e.g. AVNumberOfChannelsKey, AVSampleRateKey, AVChannelLayoutKey) asset writer (AVAssetWriter) I've tried to hook into the above objects to modify the audio pitch, but without success. I've also tried with Dirac as described here: Real Time Pitch Change In iPhone Using Dirac And OpenAL with AL_PITCH as described here: Piping output from OpenAL into a buffer And the "BASS" library from un4seen: Change Pitch/Tempo In Realtime I haven't found success with any of the above libs, most likely because I don't really know how to use them, and where to hook them into the audio saving code. There seems to be alot of librarys that have similar effects but focuses on playback or custom recording code. I want to manipulate the audio stream I've already got (AVAssetWriterAudioInput) or modify the saved movie clip (.m4v). I want the video to be unmodifed visually, i.e. played at the same speed. But I want the audio to go faster (like a chipmunk) or slower (like a ... monster? :)). Do you have any suggestions how I can modify the pitch in either real time (when recording the movie) or afterwards by converting the entire movie (.m4v file)? Should I look further into Dirac, OpenAL, SoundTouch, BASS or some other library? I want to be able to share the movie to others with modified audio, that's the reason I can't rely on modifying the pitch for playback only. Any help is appreciated, thanks!

    Read the article

  • How can I improve the recursion capabilities of my ECMAScript implementation?

    - by ChaosPandion
    After some resent tests I have found my implementation cannot handle very much recursion. Although after I ran a few tests in Firefox I found that this may be more common than I originally thought. I believe the basic problem is that my implementation requires 3 calls to make a function call. The first call is made to a method named Call that makes sure the call is being made to a callable object and gets the value of any arguments that are references. The second call is made to a method named Call which is defined in the ICallable interface. This method creates the new execution context and builds the lambda expression if it has not been created. The final call is made to the lambda that the function object encapsulates. Clearly making a function call is quite heavy but I am sure that with a little bit of tweaking I can make recursion a viable tool when using this implementation. public static object Call(ExecutionContext context, object value, object[] args) { var func = Reference.GetValue(value) as ICallable; if (func == null) { throw new TypeException(); } if (args != null && args.Length > 0) { for (int i = 0; i < args.Length; i++) { args[i] = Reference.GetValue(args[i]); } } var reference = value as Reference; if (reference != null) { if (reference.IsProperty) { return func.Call(reference.Value, args); } else { return func.Call(((EnviromentRecord)reference.Value).ImplicitThisValue(), args); } } return func.Call(Undefined.Value, args); } public object Call(object thisObject, object[] arguments) { var lexicalEnviroment = Scope.NewDeclarativeEnviroment(); var variableEnviroment = Scope.NewDeclarativeEnviroment(); var thisBinding = thisObject ?? Engine.GlobalEnviroment.GlobalObject; var newContext = new ExecutionContext(Engine, lexicalEnviroment, variableEnviroment, thisBinding); Engine.EnterContext(newContext); var result = Function.Value(newContext, arguments); Engine.LeaveContext(); return result; }

    Read the article

  • php connecting to mysql server(localhost) very slow

    - by Ahmad
    actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

    Read the article

  • How can a C/C++ program put itself into background?

    - by Larry Gritz
    What's the best way for a running C or C++ program that's been launched from the command line to put itself into the background, equivalent to if the user had launched from the unix shell with '&' at the end of the command? (But the user didn't.) It's a GUI app and doesn't need any shell I/O, so there's no reason to tie up the shell after launch. But I want a shell command launch to be auto-backgrounded without the '&' (or on Windows). Ideally, I want a solution that would work on any of Linux, OS X, and Windows. (Or separate solutions that I can select with #ifdef.) It's ok to assume that this should be done right at the beginning of execution, as opposed to somewhere in the middle. One solution is to have the main program be a script that launches the real binary, carefully putting it into the background. But it seems unsatisfying to need these coupled shell/binary pairs. Another solution is to immediately launch another executed version (with 'system' or CreateProcess), with the same command line arguments, but putting the child in the background and then having the parent exit. But this seems clunky compared to the process putting itself into background. Edited after a few answers: Yes, a fork() (or system(), or CreateProcess on Windows) is one way to sort of do this, that I hinted at in my original question. But all of these solutions make a SECOND process that is backgrounded, and then terminate the original process. I was wondering if there was a way to put the EXISTING process into the background. One difference is that if the app was launched from a script that recorded its process id (perhaps for later killing or other purpose), the newly forked or created process will have a different id and so will not be controllable by any launching script, if you see what I'm getting at. Edit #2: fork() isn't a good solution for OS X, where the man page for 'fork' says that it's unsafe if certain frameworks or libraries are being used. I tried it, and my app complains loudly at runtime: "The process has forked and you cannot use this CoreFoundation functionality safely. You MUST exec()." I was intrigued by daemon(), but when I tried it on OS X, it gave the same error message, so I assume that it's just a fancy wrapper for fork() and has the same restrictions. Excuse the OS X centrism, it just happens to be the system in front of me at the moment. But I am indeed looking for a solution to all three platforms.

    Read the article

  • What common routines do you put in your Program.cs for C#

    - by Rick
    I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

    Read the article

  • small scale web site - global javascript file style/format/pattern - improving maintainability

    - by yaya3
    I frequently create (and inherit) small to medium websites where I have the following sort of code in a single file (normally named global.js or application.js or projectname.js). If functions get big, I normally put them in a seperate file, and call them at the bottom of the file below in the $(document).ready() section. If I have a few functions that are unique to certain pages, I normally have another switch statement for the body class inside the $(document).ready() section. How could I restructure this code to make it more maintainable? Note: I am less interested in the functions innards, more so the structure, and how different types of functions should be dealt with. I've also posted the code here - http://pastie.org/999932 in case it makes it any easier var ProjectNameEnvironment = {}; function someFunctionUniqueToTheHomepageNotWorthMakingConfigurable () { $('.foo').hide(); $('.bar').click(function(){ $('.foo').show(); }); } function functionThatIsWorthMakingConfigurable(config) { var foo = config.foo || 700; var bar = 200; return foo * bar; } function globallyRequiredJqueryPluginTrigger (tooltip_string) { var tooltipTrigger = $(tooltip_string); tooltipTrigger.tooltip({ showURL: false ... }); } function minorUtilityOneLiner (selector) { $(selector).find('li:even').not('li ul li').addClass('even'); } var Lightbox = {}; Lightbox.setup = function(){ $('li#foo a').attr('href','#alpha'); $('li#bar a').attr('href','#beta'); } Lightbox.init = function (config){ if (typeof $.fn.fancybox =='function') { Lightbox.setup(); var fade_in_speed = config.fade_in_speed || 1000; var frame_height = config.frame_height || 1700; $(config.selector).fancybox({ frameHeight : frame_height, callbackOnShow: function() { var content_to_load = config.content_to_load; ... }, callbackOnClose : function(){ $('body').height($('body').height()); } }); } else { if (ProjectNameEnvironment.debug) { alert('the fancybox plugin has not been loaded'); } } } // ---------- order of execution ----------- $(document).ready(function () { urls = urlConfig(); (function globalFunctions() { $('.tooltip-trigger').each(function(){ globallyRequiredJqueryPluginTrigger(this); }); minorUtilityOneLiner('ul.foo') Lightbox.init({ selector : 'a#a-lightbox-trigger-js', ... }); Lightbox.init({ selector : 'a#another-lightbox-trigger-js', ... }); })(); if ( $('body').attr('id') == 'home-page' ) { (function homeFunctions() { someFunctionUniqueToTheHomepageNotWorthMakingConfigurable (); })(); } });

    Read the article

  • What are the pros and cons of using manual list iteration vs recursion through fail

    - by magus
    I come up against this all the time, and I'm never sure which way to attack it. Below are two methods for processing some season facts. What I'm trying to work out is whether to use method 1 or 2, and what are the pros and cons of each, especially large amounts of facts. methodone seems wasteful since the facts are available, why bother building a list of them (especially a large list). This must have memory implications too if the list is large enough ? And it doesn't take advantage of Prolog's natural backtracking feature. methodtwo takes advantage of backtracking to do the recursion for me, and I would guess would be much more memory efficient, but is it good programming practice generally to do this? It's arguably uglier to follow, and might there be any other side effects? One problem I can see is that each time fail is called, we lose the ability to pass anything back to the calling predicate, eg. if it was methodtwo(SeasonResults), since we continually fail the predicate on purpose. So methodtwo would need to assert facts to store state. Presumably(?) method 2 would be faster as it has no (large) list processing to do? I could imagine that if I had a list, then methodone would be the way to go.. or is that always true? Might it make sense in any conditions to assert the list to facts using methodone then process them using method two? Complete madness? But then again, I read that asserting facts is a very 'expensive' business, so list handling might be the way to go, even for large lists? Any thoughts? Or is it sometimes better to use one and not the other, depending on (what) situation? eg. for memory optimisation, use method 2, including asserting facts and, for speed use method 1? season(spring). season(summer). season(autumn). season(winter). % Season handling showseason(Season) :- atom_length(Season, LenSeason), write('Season Length is '), write(LenSeason), nl. % ------------------------------------------------------------- % Method 1 - Findall facts/iterate through the list and process each %-------------------------------------------------------------- % Iterate manually through a season list lenseason([]). lenseason([Season|MoreSeasons]) :- showseason(Season), lenseason(MoreSeasons). % Findall to build a list then iterate until all done methodone :- findall(Season, season(Season), AllSeasons), lenseason(AllSeasons), write('Done'). % ------------------------------------------------------------- % Method 2 - Use fail to force recursion %-------------------------------------------------------------- methodtwo :- % Get one season and show it season(Season), showseason(Season), % Force prolog to backtrack to find another season fail. % No more seasons, we have finished methodtwo :- write('Done').

    Read the article

  • Android browser touch events stop display being updated inc. canvas/elements - How to work around?

    - by Ed Kirk
    On some android's native browser touching the page seems to stop the display from being updated until the finger is released. This occurs for both html element based animation (switching classes) and for canvas based animation. It does not however stop normal js execution and other events are fired as normal. On devices with this problem the dolphin browser also seems effected (not firefox though). Touchstart/move both have preventDefault() fired as well as stopPropergation(), cancelBubble = true; and e.returnValue = false;. In the CSS webkit selection has also been disabled. The page will not scroll. A similar question has been asked here: Does Android browser lock DOM on touchStart? but I'd like to find out if this behaviour can be overcome, or at least to discover what devices will be effected by the problem, is it a device or version android issue? If you cannot answer the question running the demo and reporting your experience along with your device model and useragent (displayed at bottom of demo page) as a comment might help others or myself answer the question. Here is a demo and steps to reproduce the behaviour. A QR code for the link can be found here https://s3-eu-west-1.amazonaws.com/canvas-test-pd/tmp.png. https://s3-eu-west-1.amazonaws.com/canvas-test-pd/index.html The web page has a canvas at the top and a div with a background image at the bottom. Every second the canvas is cleared and a different image displayed and the div has it's class switched (both toggle between 0 and 1 pngs). Once this has toggled a few times place your finger on the canvas (the top grey box) and hold it there. Wait to see if the animation continues (sometimes it will once or twice then stops) and if there are any visual distortions. Update It seems that the Galaxy Tab running 3.2 requires handlers for touchstart/end of document, not just required divs for the screen to continue updating the display. Thanks jimpic. I'm starting to believe it's an issue caused by manufacturers skins, although this is difficult to prove.

    Read the article

  • Jumping into argv?

    - by jth
    Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

    Read the article

  • run shell command from java

    - by Aykut
    Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

    Read the article

  • help me to choose the best soulotion for my purpose to build my software.

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • Having trouble doing an Update with a Linq to Sql object

    - by Pure.Krome
    Hi folks, i've got a simple linq to sql object. I grab it from the database and change a field then save. No rows have been updated. :( When I check the full Sql code that is sent over the wire, I notice that it does an update to the row, not via the primary key but on all the fields via the where clause. Is this normal? I would have thought that it would be easy to update the field(s) with the where clause linking on the Primary Key, instead of where'ing (is that a word :P) on each field. here's the code... using (MyDatabase db = new MyDatabase()) { var boardPost = (from bp in db.BoardPosts where bp.BoardPostId == boardPostId select bp).SingleOrDefault(); if (boardPost != null && boardPost.BoardPostId > 0) { boardPost.ListId = listId; // This changes the value from 0 to 'x' db.SubmitChanges(); } } and here's some sample sql.. exec sp_executesql N'UPDATE [dbo].[BoardPost] SET [ListId] = @p6 WHERE ([BoardPostId] = @p0) AND .... <snip the other fields>',N'@p0 int,@p1 int,@p2 nvarchar(9),@p3 nvarchar(10),@p4 int,@p5 datetime,@p6 int',@p0=1276,@p1=212787,@p2=N'ttreterte',@p3=N'ttreterte3',@p4=1,@p5='2009-09-25 12:32:12.7200000',@p6=72 Now, i know there's a datetime field in this update .. and when i checked the DB it's value was/is '2009-09-25 12:32:12.720' (less zero's, than above) .. so i'm not sure if that is messing up the where clause condition... but still! should it do a where clause on the PK's .. if anything .. for speed! Yes / no ? UPDATE After reading nitzmahone's reply, I then tried playing around with the optimistic concurrency on some values, and it still didn't work :( So then I started some new stuff ... with the optimistic concurrency happening, it includes a where clause on the field it's trying to update. When that happens, it doesn't work. so.. in the above sql, the where clause looks like this ... WHERE ([BoardPostId] = @p0) AND ([ListId] IS NULL) AND ... <rest snipped>) This doesn't sound right! the value in the DB is null, before i do the update. but when i add the ListId value to the where clause (or more to the point, when L2S add's it because of the optomistic concurrecy), it fails to find/match the row. wtf?

    Read the article

  • When transactionManager is not named "transactionManager" ...

    - by smallufo
    I am trying Spring 3(.0.2.RELEASE) and JPA2 and Hibernate 3.5.1-Final... One thing upsets me is that spring seems only accept a transaction Manager named "transactionManager" If I don't name it "transactionManager" , Spring will throws NoSuchBeanDefinitionException: No bean named 'transactionManager' is defined. Here is my config : <context:component-scan base-package="destiny.data.mining"/> <context:annotation-config/> <bean id="miningEntityManagerFactory" class="org.springframework.orm.jpa.LocalContainerEntityManagerFactoryBean"> <property name="persistenceUnitName" value="mining"/> </bean> <bean id="miningTransactionManager" class="org.springframework.orm.jpa.JpaTransactionManager" > <property name="entityManagerFactory" ref="miningEntityManagerFactory"/> </bean> <tx:advice id="txAdviceMining" transaction-manager="miningTransactionManager"> <tx:attributes> <tx:method name="get*" read-only="true"/> <tx:method name="save*" propagation="REQUIRED"/> <tx:method name="update*" propagation="REQUIRED"/> <tx:method name="delete*" propagation="REQUIRED"/> <tx:method name="*" propagation="SUPPORTS" read-only="true"/> </tx:attributes> </tx:advice> <aop:config> <aop:pointcut id="methods" expression="execution(* destiny.utils.AbstractDao+.*(..))"/> <aop:advisor advice-ref="txAdviceMining" pointcut-ref="methods"/> </aop:config> <tx:annotation-driven transaction-manager="miningTransactionManager"/> In this config , an Entity Manager Factory is not necessarily named "entityManagerFactory" , and "txAdvice" is not necessarily named "txAdvice" , either. But I don't know why on earth Spring requires a transaction manager named "transactionManager" ? Is there any way not to name a transaction manager "transactionManager" ? (I'm running multiple spring config files , so I try my best to avoid name-conflicting) test code : @RunWith(SpringJUnit4ClassRunner.class) @ContextConfiguration(locations={"classpath:mining.xml"}) public class MiningPersonDaoTest { @Inject private EntityManagerFactory miningEntityManagerFactory; @Inject private MiningPersonDao miningPersonDao; @Transactional @Test public void testUpdate() { MiningPerson p = miningPersonDao.get(42L); p.setLocationName("OOXX"); miningPersonDao.update(p); System.out.println(p); } } ii

    Read the article

< Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >