Search Results

Search found 13534 results on 542 pages for 'quacked python'.

Page 370/542 | < Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >

  • socket.accept error 24: To many open files

    - by Creotiv
    I have a problem with open files under my Ubuntu 9.10 when running server in Python2.6 And main problem is that, that i don't know why it so.. I have set ulimit -n = 999999 net.core.somaxconn = 999999 fs.file-max = 999999 and lsof gives me about 12000 open files when server is running. And also i'm using epoll. But after some time it's start giving exeption: File "/usr/lib/python2.6/socket.py", line 195, in accept error: [Errno 24] Too many open files And i don't know how it can reach file limit when it isn't reached. Thanks for help)

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • Pygame, sounds don't play

    - by terabytest
    I'm trying to play sound files (.wav) with pygame but when I start it I never hear anything. This is the code: import pygame pygame.init() pygame.mixer.init() sounda= pygame.mixer.Sound("desert_rustle.wav") sounda.play() I also tried using channels but the result is the same

    Read the article

  • What is the Simplest Possible Payment Gateway to Implement? (using Django)

    - by b14ck
    I'm developing a web application that will require users to either make one time deposits of money into their account, or allow users to sign up for recurring billing each month for a certain amount of money. I've been looking at various payment gateways, but most (if not all) of them seem complex and difficult to get working. I also see no real active Django projects which offer simple views for making payments. Ideally, I'd like to use something like Amazon FPS, so that I can see online transaction logs, refund money, etc., but I'm open to other things. I just want the EASIEST possible payment gateway to integrate with my site. I'm not looking for anything fancy, whatever does the job, and requires < 10 hours to get working from start to finish would be perfect. I'll give answer points to whoever can point out a good one. Thanks!

    Read the article

  • Is there a way to control how pytest-xdist runs tests in parallel?

    - by superselector
    I have the following directory layout: runner.py lib/ tests/ testsuite1/ testsuite1.py testsuite2/ testsuite2.py testsuite3/ testsuite3.py testsuite4/ testsuite4.py The format of testsuite*.py modules is as follows: import pytest class testsomething: def setup_class(self): ''' do some setup ''' # Do some setup stuff here def teardown_class(self): '''' do some teardown''' # Do some teardown stuff here def test1(self): # Do some test1 related stuff def test2(self): # Do some test2 related stuff .... .... .... def test40(self): # Do some test40 related stuff if __name__=='__main()__' pytest.main(args=[os.path.abspath(__file__)]) The problem I have is that I would like to execute the 'testsuites' in parallel i.e. I want testsuite1, testsuite2, testsuite3 and testsuite4 to start execution in parallel but individual tests within the testsuites need to be executed serially. When I use the 'xdist' plugin from py.test and kick off the tests using 'py.test -n 4', py.test is gathering all the tests and randomly load balancing the tests among 4 workers. This leads to the 'setup_class' method to be executed every time of each test within a 'testsuitex.py' module (which defeats my purpose. I want setup_class to be executed only once per class and tests executed serially there after). Essentially what I want the execution to look like is: worker1: executes all tests in testsuite1.py serially worker2: executes all tests in testsuite2.py serially worker3: executes all tests in testsuite3.py serially worker4: executes all tests in testsuite4.py serially while worker1, worker2, worker3 and worker4 are all executed in parallel. Is there a way to achieve this in 'pytest-xidst' framework? The only option that I can think of is to kick off different processes to execute each test suite individually within runner.py: def test_execute_func(testsuite_path): subprocess.process('py.test %s' % testsuite_path) if __name__=='__main__': #Gather all the testsuite names for each testsuite: multiprocessing.Process(test_execute_func,(testsuite_path,))

    Read the article

  • Reverse mapping from a table to a model in SQLAlchemy

    - by Jace
    To provide an activity log in my SQLAlchemy-based app, I have a model like this: class ActivityLog(Base): __tablename__ = 'activitylog' id = Column(Integer, primary_key=True) activity_by_id = Column(Integer, ForeignKey('users.id'), nullable=False) activity_by = relation(User, primaryjoin=activity_by_id == User.id) activity_at = Column(DateTime, default=datetime.utcnow, nullable=False) activity_type = Column(SmallInteger, nullable=False) target_table = Column(Unicode(20), nullable=False) target_id = Column(Integer, nullable=False) target_title = Column(Unicode(255), nullable=False) The log contains entries for multiple tables, so I can't use ForeignKey relations. Log entries are made like this: doc = Document(name=u'mydoc', title=u'My Test Document', created_by=user, edited_by=user) session.add(doc) session.flush() # See note below log = ActivityLog(activity_by=user, activity_type=ACTIVITY_ADD, target_table=Document.__table__.name, target_id=doc.id, target_title=doc.title) session.add(log) This leaves me with three problems: I have to flush the session before my doc object gets an id. If I had used a ForeignKey column and a relation mapper, I could have simply called ActivityLog(target=doc) and let SQLAlchemy do the work. Is there any way to work around needing to flush by hand? The target_table parameter is too verbose. I suppose I could solve this with a target property setter in ActivityLog that automatically retrieves the table name and id from a given instance. Biggest of all, I'm not sure how to retrieve a model instance from the database. Given an ActivityLog instance log, calling self.session.query(log.target_table).get(log.target_id) does not work, as query() expects a model as parameter. One workaround appears to be to use polymorphism and derive all my models from a base model which ActivityLog recognises. Something like this: class Entity(Base): __tablename__ = 'entities' id = Column(Integer, primary_key=True) title = Column(Unicode(255), nullable=False) edited_at = Column(DateTime, onupdate=datetime.utcnow, nullable=False) entity_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_on': entity_type} class Document(Entity): __tablename__ = 'documents' __mapper_args__ = {'polymorphic_identity': 'document'} body = Column(UnicodeText, nullable=False) class ActivityLog(Base): __tablename__ = 'activitylog' id = Column(Integer, primary_key=True) ... target_id = Column(Integer, ForeignKey('entities.id'), nullable=False) target = relation(Entity) If I do this, ActivityLog(...).target will give me a Document instance when it refers to a Document, but I'm not sure it's worth the overhead of having two tables for everything. Should I go ahead and do it this way?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Ternary operator

    - by Antoine Leclair
    In PHP, I often use the ternary operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • Problem with anchor tags in Django after using lighttpd + fastcgi

    - by Drew A
    I just started using lighttpd and fastcgi for my django site, but I've noticed my anchor links are no longer working. I used the anchor links for sorting links on the page, for example I use an anchor to sort links by the number of points (or votes) they have received. For example: the code in the html template: ... {% load sorting_tags %} ... {% ifequal sort_order "points" %} {% trans "total points" %} {% trans "or" %} {% anchor "date" "date posted" %} {% order_by_votes links request.direction %} {% else %} {% anchor "points" "total points" %} {% trans "or" %} {% trans "date posted" %} ... The anchor link on "www.mysite.com/my_app/" for total points will be directed to "my_app/?sort=points" But the correct URL should be "www.mysite.com/my_app/?sort=points" All my other links work, the problem is specific to anchor links. The {% anchor %} tag is taken from django-sorting, the code can be found at http://github.com/directeur/django-sorting Specifically in django-sorting/templatetags/sorting_tags.py Thanks in advance.

    Read the article

  • Sqlalchemy complex in_ clause

    - by lostlogic
    I'm trying to find a way to cause sqlalchemy to generate sql of the following form: select * from t where (a,b) in ((a1,b1),(a2,b2)); Is this possible? If not, any suggestions on a way to emulate it? Thanks kindly!

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • Exception Handling in google app engine

    - by Rahul99
    i am raising exception using if UserId == '' and Password == '': raise Exception.MyException , "wrong userId or password" but i want print the error message on same page class MyException(Exception): def __init__(self,msg): Exception.__init__(self,msg)

    Read the article

  • Search for a String and replace it with a variable

    - by chrissygormley
    Hello, I am trying to use regular expression to search a document fo a UUID number and replace the end of it with a new number. The code I have so far is: read_file = open('test.txt', 'r+') write_file = open('test.txt', 'w') r = re.compile(r'(self.uid\s*=\s*5EFF837F-EFC2-4c32-A3D4\s*)(\S+)') for l in read_file: m1 = r.match(l) if m1: new=(str,m1.group(2)) new?????? This where I get stuck. The file test.txt has the below UUID stored in it: self.uid = '5EFF837F-EFC2-4c32-A3D4-D15C7F9E1F22' I want to replace the part D15C7F9E1F22. I have also tried this: r = re.compile(r'(self.uid\s*=\s*)(\S+)') for l in fp: m1 = r.match(l) new=map(int,m1.group(2).split("-") new[4]='RHUI5345JO' But I cannot seem to match the string. Thanks in advance for any help.

    Read the article

  • how to login in google account with app engine webproxy

    - by user313446
    hi,a webproxy on app engine oncyberspace.appspot.com , save cookie in the database, when i try to login in the google with my account, it redirect to google.com . how to solve these problem ? and another problem , when i this the above web to login in twitter,it works !but i can not use it to update my tweet. i don't know why, may be i can't pass oauth . how to solve this ?

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • How to generate lots of redundant ajax elements like checkboxes and pulldowns in Django?

    - by iJames
    Hello folks. I've been getting lots of answers from stackoverflow now that I'm in Django just be searching. Now I hope my question will also create some value for everybody. In choosing Django, I was hoping there was some similar mechanism to the way you can do partials in ROR. This was going to help me in two ways. One was in generating repeating indexed forms or form elements, and also in rendering only a piece of the page on the round trip. I've done a little bit of that by using taconite with a simple URL click but now I'm trying to get more advanced. This will focus on the form issue which boils down to how to iterate over a secondary object. If I have a list of photo instances, each of which has a couple of parameters, let's say a size and a quantity. I want to generate form elements for each photo instance separately. But then I have two lists I want to iterate on at the same time. Context: photos : Photo.objects.all() and forms = {} for photo in photos: forms[photo.id] = PhotoForm() In other words we've got a list of photo objects and a dict of forms based on the photo.id. Here's an abstraction of the template: {% for photo in photos %} {% include "photoview.html" %} {% comment %} So here I want to use the photo.id as an index to get the correct form. So that each photo has its own form. I would want to have a different action and each form field would be unique. Is that possible? How can I iterate on that? Thanks! {% endcomment %} Quantity: {{ oi.quantity }} {{ form.quantity }} Dimensions: {{ oi.size }} {{ form.size }} {% endfor %} What can I do about this simple case. And how can I make it where every control is automatically updating the server instead of using a form at all? Thanks! James

    Read the article

  • Help calling class from a class above.

    - by wtzolt
    Hello, How to call from class oneThread: back to class fun:? As in, address a class written below. Is it possible? class oneThread(threading.Thread): def __init__(self): threading.Thread.__init__(self) self.start() def run(self): print "1" time.sleep(1) print "2" time.sleep(1) print "3" self.wTree.get_widget("entryResult").set_text("Done with One.") # How to call from here back to class fun, which of course is below...? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "main.glade" ) self.wTree.signal_autoconnect( {"on_buttonOne" : self.one} ) gtk.main() def one(self, widget): oneThread(); gtk.gdk.threads_init() do=fun()

    Read the article

  • Getting unpredictable data into a tabular format

    - by Acorn
    The situation: Each page I scrape has <input> elements with a title= and a value= I don't know what is going to be on the page. I want to have all my collected data in a single table at the end, with a column for each title. So basically, I need each row of data to line up with all the others, and if a row doesn't have a certain element, then it should be blank (but there must be something there to keep the alignment). eg. First page has: {animal: cat, colour: blue, fruit: lemon, day: monday} Second page has: {animal: fish, colour: green, day: saturday} Third page has: {animal: dog, number: 10, colour: yellow, fruit: mango, day: tuesday} Then my resulting table should be: animal | number | colour | fruit | day cat | none | blue | lemon | monday fish | none | green | none | saturday dog | 10 | yellow | mango | tuesday Although it would be good to keep the order of the title value pairs, which I know dictionaries wont do. So basically, I need to generate columns from all the titles (kept in order but somehow merged together) What would be the best way of going about this without knowing all the possible titles and explicitly specifying an order for the values to be put in?

    Read the article

< Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >