Search Results

Search found 37183 results on 1488 pages for 'string conversion'.

Page 370/1488 | < Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >

• Optional Argument: compile time constant issue

  - by Jack

  Why is this working: public int DoesEmailAddressExistsExcludingEmailAddressID( string emailAddress, string invitationCode, int emailAddressID = 0, int For = (int) Enums.FOR.AC) whereas this doesn't public int DoesEmailAddressExistsExcludingEmailAddressID( string emailAddress, string invitationCode, int emailAddressID = 0, int For = Enums.FOR.AC.GetHashCode()) where AC is enum. Can enums's hashcode change at runtime?

  Read the article

• C# and com for vb6

  - by Jim

  Hi all I have an issue with C# and COM. :( [Guid("f7d936ba-d816-48d2-9bfc-c18be6873b4d")] [ComVisible(true)] [ClassInterface(ClassInterfaceType.None)] public class Process : IProcess { public Process() { } public int UpdateBalance(string accountNumber, string adminEventDescription, decimal curAmount) { return 10; } } [ComVisible(true)] [Guid("5c640a0f-0dce-47d4-87df-07cee3b9a1f9")] [InterfaceType(ComInterfaceType.InterfaceIsIUnknown)] public interface IProcess { int UpdateBalance(string accountNumber, string adminEventDescription, decimal curAmount); } And the VB code Private Sub Command1_Click() Dim test As Object Set test = New Forwardslash_PlayerTrackingSystem_Api.Process End Sub I get the following ActiveX component can't create object?

  Read the article

• Exploding by Array of Delimiters

  - by JoeC

  Is there any way to explode() using an array of delimiters? PHP Manual: array explode ( string $delimiter , string $string [, int $limit ] ) Instead of using string $delimiter is there any way to use array $delimiter without affecting performance too much?

  Read the article

• java filenames filter pattern

  - by Sergey

  Hello, I need to implement File[] files = getFiles( String folderName, String ptrn ); Where ptrn is a command prompt style pattern like "*2010*.txt" I'm familar with FilenameFilter class, but can't implement public boolean accept(File dir, String filename) because String.matches() doesn't accept such patterns. Thanks!

  Read the article

• What am I missing in this ASP.NET XSS Security Helper class?

  - by smartcaveman

  I need a generic method for preventing XSS attacks in ASP.NET. The approach I came up with is a ValidateRequest method that evaluates the HttpRequest for any potential issues, and if issues are found, redirect the user to the same page, but in a away that is not threatening to the application. (Source code below) While I know this method will prevent most XSS attacks, I am not certain that I am adequately preventing all possible attacks while also minimizing false positives. So, what is the most effective way to adequately prevent all possible attacks, while minimizing false positives? Are there changes I should make to the helper class below, or is there an alternative approach or third party library that offers something more convincing? public static class XssSecurity { public const string PotentialXssAttackExpression = "(http(s)*(%3a|:))|(ftp(s)*(%3a|:))|(javascript)|(alert)|(((\\%3C) <)[^\n]+((\\%3E) >))"; private static readonly Regex PotentialXssAttackRegex = new Regex(PotentialXssAttackExpression, RegexOptions.IgnoreCase); public static bool IsPotentialXssAttack(this HttpRequest request) { if(request != null) { string query = request.QueryString.ToString(); if(!string.IsNullOrEmpty(query) && PotentialXssAttackRegex.IsMatch(query)) return true; if(request.HttpMethod.Equals("post", StringComparison.InvariantCultureIgnoreCase)) { string form = request.Form.ToString(); if (!string.IsNullOrEmpty(form) && PotentialXssAttackRegex.IsMatch(form)) return true; } if(request.Cookies.Count > 0) { foreach(HttpCookie cookie in request.Cookies) { if(PotentialXssAttackRegex.IsMatch(cookie.Value)) { return true; } } } } return false; } public static void ValidateRequest(this HttpContext context, string redirectToPath = null) { if(context == null || !context.Request.IsPotentialXssAttack()) return; // expire all cookies foreach(HttpCookie cookie in context.Request.Cookies) { cookie.Expires = DateTime.Now.Subtract(TimeSpan.FromDays(1)); context.Response.Cookies.Set(cookie); } // redirect to safe path bool redirected = false; if(redirectToPath != null) { try { context.Response.Redirect(redirectToPath,true); redirected = true; } catch { redirected = false; } } if (redirected) return; string safeUrl = context.Request.Url.AbsolutePath.Replace(context.Request.Url.Query, string.Empty); context.Response.Redirect(safeUrl,true); } }

  Read the article

• Matching strings

  - by Joy

  Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

  Read the article

• vim: How do I line up ruby options?

  - by TheDeeno

  With vim how do I to turn this: t.string :crypted_password :null => false t.string :password_salt, :null => false into this: t.string :crypted_password, :null => false t.string :password_salt, :null => false without manually adding the spaces to each line?

  Read the article

• char array to LPCTSTR

  - by Yan Cheng CHEOK

  May I know how I can perform the following conversion? // el.strCap is char[50] // InsertItem is expecting TCHAR pointer (LPCTSTR) // How I can perform conversion? // I do not have access in both "list" and "el" source code // Hence, there is no way for me to modify their signature. list.InsertItem(i, el.strCap); And No. I do not want to use WideCharToMultiByte They are too cumbersome to be used.

  Read the article

• Java: How can a constructor return a value?

  - by HH

  $ cat Const.java public class Const { String Const(String hello) { return hello; } public static void main(String[] args) { System.out.println(new Const("Hello!")); } } $ javac Const.java Const.java:7: cannot find symbol symbol : constructor Const(java.lang.String) location: class Const System.out.println(new Const("Hello!")); ^ 1 error

  Read the article

• Print XML file and download it

  - by Pankaj

  I am create xml using serialization and trying to print them using this code string xmlDate = xml.GetXML(); string name = string.Format("{0}_HighEST", ProjectName); Response.AddHeader("Content-disposition", "attachment; filename=\"" + name + "_HighEST.xml\""); Response.ContentType = string.Format("application/.xml", name); how can assign my xmldata to Response so that data will write on downloaded xml?

  Read the article

• Using \b in C# regular expressions doesn't work?

  - by Nikhil

  I am wondering why the following regex does not match. string query = "\"1 2\" 3"; string pattern = string.Format(@"\b{0}\b", Regex.Escape("\"1 2\"")); string repl = Regex.Replace(query, pattern, "", RegexOptions.CultureInvariant); Note that if I remove the word boundary characters (\b) from pattern, it matches fine. Is there something about '\b' that might be tripping this up?

  Read the article

• C# Working with Linq binding

  - by Isuru

  I have designed Types as follow: class Cricket { string type; Team tm; public Team Team { get { return tm; } set { tm = value; } } public string Type { get { return type; } set { type = value; } } } class Team { string country; Players plr; public Players Players { get {return plr; } set { plr = value; } } public string Country { get { return country; } set { country = value; } } } class Players { string name; DateTime dob; int run; public string Name { get { return name; } set { name = value; } } public DateTime DOB { get { return dob; } set { dob = value; } } public int Run { get { return run; } set { run = value; } } } I have to get the following using LINQ techniques. 1) Youngest all data of the youngest player among all teams 2) Oldest Player of each team 3) The highest run scorer will receive Gold Medal,rest of the players of all team will receive Silver medal. (Please look at the GetPlayer() i have declared var Medal=new String[] {"Gold","Silver"} to associate the Medal ) public void GetPlayer() { var TeamMatrix = new Cricket[] { new Cricket{ Type="Twenty20", Team=new Team{ Country="England", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1989"), Name="Russel", Run=45}}}, new Cricket{ Type="Twenty20", Team=new Team{ Country="England", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1991"), Name="Joel", Run=56}}}, new Cricket{ Type="Twenty20", Team=new Team{ Country="Australia", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1990"), Name="Clark", Run=145}}}, new Cricket{ Type="Twenty20", Team=new Team{ Country="Australia", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1971"), Name="Bevan", Run=156}}} }; var Medal = new string[] { "Gold", "Silver" }; var tm = (from mat in TeamMatrix select new { mat.Team.Players.DOB }).Max(); Console.WriteLine("Youngest Age={0}",tm); } When I declare var tm = (from mat in TeamMatrix select new { mat.Team.Players.DOB }).Max(); I receive error atleast one object must implement IComparable. What is the actual way to complete the above three tasks? ( Tasks 1 ,2 ,3 are explained above). Thanks to all.

  Read the article

• Is a good practice to initialize private data members from within ctor by calling the associated pro

  - by yuko.aihara

  interface IAnimal { string Name { get; set; } } class Dog : IAnimal { private string name; public Dog(string name) { Name = name; } public string Name { get { return name; } set { name = value; } } }

  Read the article

• Serialization of non-required fields in protobuf-net

  - by David Hedlund

  I have a working java client that is communicating with Google, through ProtoBuf serialized messages. I am currently trying to translate that client into C#. I have a .proto file where the parameter appId is an optional string. Its default value in the C# representation as generated by the protobuf-net library is an empty string, just as it is in the java representation of the same file. message AppsRequest { optional AppType appType = 1; optional string query = 2; optional string categoryId = 3; optional string appId = 4; optional bool withExtendedInfo = 6; } I find that when I explicitly set appId to "" in the java client, the client stops working (403 Bad Request from Google). When I explicitly set appId to null in the java client, everything works, but only because hasAppId is being set to false (I'm uncertain as to how that affects the serialization). In the C# client, I always get 403 responses. I don't see any logic behind the distinction between not setting a value, and setting the default value, that seems to make all the difference in the java client. Since the output is always a binary stream, I am not sure if the successful java messages are being serialized with an empty string, or not serialized at all. In the C# client, I've tried setting IsRequired to true on the ProtoMember attribute, to force them to serialize, and I've tried setting the default value to null, and explicitly set "", so I'm quite sure I've tried some configuration where the value is being serialized. I've also played around with ProtoBuf.ProtoIgnore and at some point, removing the appId parameter altogether, but I haven't been able to avoid the 403 errors in C#. I've tried manually copying the serialized string from java, and that resolved my issues, so I'm certain that the rest of the HTTP Request is working, and the error can be traced to the serialized object. My serialization is simply this: var clone = ProtoBuf.Serializer.DeepClone(request); MemoryStream ms = new MemoryStream(2000); ProtoBuf.Serializer.Serialize(ms, clone); var bytearr = ms.ToArray(); string encodedData = Convert.ToBase64String(bytearr); I'll admit to not being quite sure about what DeepClone does. I've tried both with and without it...

  Read the article

• CSV File Content Display Issue

  - by Pankaj Khurana

  Hi, I want to retrieve contents from a csv file for that i am using following code: <?php $fo = fopen("record.csv", "rb+"); while(!feof($fo)) { $contents[] = fgetcsv($fo,0,';'); } print_r($contents); fclose($fo); ?> But my records are displayed in the following format: ????††???????†††??†††††????"Search Transactions Results" ††††??†???????††††?††††††??? ???????????? ?????????????? ?????????? My csv file format: "Search Transactions Results" "Transaction ID","Reference Transaction ID","Date","Type","Subject","Item Number","Item Name","Invoice ID","Name","Email","Shipping Name","Shipping Address Line 1","Shipping Address Line 2","Shipping Address City","Shipping State/Province","Shipping Zip/Postal Code","Shipping Address Country","Shipping Method","Address Status","Contact Phone Number","Gross Amount","Receipt ID","Custom Field","Option 1 Name","Option 1 Value","Option 2 Name","Option 2 Value","Note","Auction Site","Auction User ID","Item URL","Auction Closing Date","Insurance Amount","Currency","Fees","Net Amount","Shipping & Handling Amount","Sales Tax Amount","To Email","Time","Time Zone" "1T","",5/5/2010 2:10:44 PM,"Payment Processed","CFP Self Study Kit","1","CFP Self Study Kit","","User1","[email protected]","","","","","","","","","N","","68.18","R1","","","","","","","","","",,"","USD","-2.62","65.56","0","0","[email protected]","01:40","Asia/Calcutta" "2T","",5/19/2010 4:04:08 PM,"Payment Processed","CFP Self Study Kit","1","CFP Self Study Kit","","User2","[email protected]","","","","","","","","","N","","68.18","R2","","","","","","","","","",,"","USD","-2.62","65.56","0","0","[email protected]","03:34","Asia/Calcutta" "3T","1RT",5/19/2010 5:28:45 PM,"Currency Conversion Completed","","","",""," ","","","","","","","","","","N","","17492.6","","","","","","","","","","",,"","INR","0","17492.6","0","0","","04:58","Asia/Calcutta" "4T","2RT",5/19/2010 5:28:45 PM,"Currency Conversion Completed","","","",""," ","","","","","","","","","","N","","-393.36","","","","","","","","","","",,"","USD","0","-393.36","0","0","","04:58","Asia/Calcutta" "5T","",5/19/2010 5:28:45 PM,"Transfer to Bank Initiated","P1006","","P1006",""," ","","","","","","","","","","N","","-17492.6","","","","","","","","","","",,"","INR","0","-17492.6","0","0","","04:58","Asia/Calcutta" "6T","",5/20/2010 5:38:02 PM,"Transfer to Bank Completed","P1006","","P1006",""," ","","","","","","","","","","N","","-17492.6","","","","","","","","","","",,"","INR","0","-17492.6","0","0","","05:08","Asia/Calcutta" "7T","",5/21/2010 12:32:37 PM,"Payment Processed","FP - LVC Plus","","FP - LVC Plus","","User3","[email protected]","User3","NEW DELHI","BEHIND KARNATAKA BANK LD","SOUTH","NEW DELHI","110023","IN","","N","","283.96","","","","","","","","","","",,"","USD","-9.95","274.01","0","0","[email protected]","00:02","Asia/Calcutta" "8T","",5/25/2010 4:40:48 PM,"Transfer to Bank Initiated","P1006","","P1006",""," ","","","","","","","","","","N","","-12569.85","","","","","","","","","","",,"","INR","0","-12569.85","0","0","","04:10","Asia/Calcutta" "9T","3RT",5/25/2010 4:40:48 PM,"Currency Conversion Completed","","","",""," ","","","","","","","","","","N","","-274.01","","","","","","","","","","",,"","USD","0","-274.01","0","0","","04:10","Asia/Calcutta" "10T","4RT",5/25/2010 4:40:48 PM,"Currency Conversion Completed","","","",""," ","","","","","","","","","","N","","12569.85","","","","","","","","","","",,"","INR","0","12569.85","0","0","","04:10","Asia/Calcutta" "11T","",5/26/2010 4:57:39 PM,"Transfer to Bank Completed","P1006","","P1006",""," ","","","","","","","","","","N","","-12569.85","","","","","","","","","","",,"","INR","0","-12569.85","0","0","","04:27","Asia/Calcutta" "Total","-247.05 USD","-15.19","-262.24" "Total","0.00 INR","0.00","0.00" I want to retrieve the records where "Type"="Payment Processed". I want to retrieve content in a key value format that is for e.g. Transaction ID-1T as i have to store this values in a database but display is not proper. I am unable to find out the reason for the same please help me on this. Thanks

  Read the article

• Is it possible to swap lines of xml code in soap

  - by John

  I wish to send a request like <v:Envelope xmlns:i="xxx"> <v:Header /> <v:Body> <sendTwoWaySmsMessage xmlns="xxx" id="o0" c:root="1"> <connectionId i:type="d:string">connectionId</connectionId> <twoWaySmsMessage> <message i:type="d:string">love it. It seems to work</message> <mobiles i:type="d:string">345</mobiles> <messageId i:type="d:string">123</messageId> </twoWaySmsMessage> </sendTwoWaySmsMessage> </v:Body> </v:Envelope> what i get is <v:Envelope xmlns:i="xxx"> <v:Header /> <v:Body> <sendTwoWaySmsMessage xmlns="xxx" id="o0" c:root="1"> <twoWaySmsMessage> <message i:type="d:string">love it. It seems to work</message> <mobiles i:type="d:string">345</mobiles> <messageId i:type="d:string">123</messageId> </twoWaySmsMessage> <connectionId i:type="d:string">connectionId</connectionId> </sendTwoWaySmsMessage> </v:Body> </v:Envelope> code is SoapObject request = new SoapObject(WSDL_TARGET_NAMESPACE, url); SoapObject message = new SoapObject("", "twoWaySmsMessage"); request.addProperty("connectionId", did); message.addProperty("message", "love it. It seems to work"); message.addProperty("mobiles", "435"); message.addProperty("messageId", "123"); request.addSoapObject(message); request.setProperty(0, "connectionId"); when i use SoapUI with the second with the "connectionId" swaped it seem to work can anyone help. of have ideas. I have looked at just about every ksoap question out there and cant seem to find an answer?

  Read the article

• Type problem with Observable.Create from Boo

  - by Tristan

  I'm trying to use Reactive Extensions from Boo and am running into type problems. Here's the basic example: def OnSubscribe(observer as IObservable[of string]) as callable: print "subscribing" def Dispose(): print "disposing" return Dispose observable = System.Linq.Observable.Create[of string](OnSubscribe) observer = System.Linq.Observer.Create[of string]({x as string | print x}) observable.Subscribe(observer) The Subscribe here gives a System.InvalidCastException: Cannot cast from source type to destination type. The issue appears to be with how I'm creating the observable, but I've struggled to see where the type problem arises from. Ideas?

  Read the article

• Recursion problem; completely lost

  - by timeNomad

  So I've been trying to solve this assignment whole day, just can't get it. The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static & global variables. Can use local variables & method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" --- true 1: TheExamIsEasy; 2: "Th*mIsEasy*" --- true 1: TheExamIsEasy; 2: "*" --- true 1: TheExamIsEasy; 2: "TheExamIsEasy" --- true 1: TheExamIsEasy; 2: "The*IsHard" --- FALSE I tried comparing the the chars one by one using charAt until an asterisk is encountered, then check if the asterisk is an empty one by comparing is successive char (i+1) with the char of s1 at position i, if true -- continue recursion with i+1 as counter for s2 & i as counter for s1; if false -- continue recursion with i+1 as counters for both. Continue this until another asterisk is found or end of string. I dunno, my brain loses track of things, can't concentrate, any pointers / hints? Am I in the right direction? Also, it's been told that a backtracking technique is to be used to solve this. My code so far (doesn't do the job, even theoretically): public static boolean samePattern(String s1, String s2) { if (s1.equals(s2) || s2 == "*") { return true; } return samePattern(s1, s2, 1); } public static boolean samePattern(String s1, String s2, int i) { if (s1.equals(s2)) return true; if (i == s2.length() - 1) // No *'s found -- not same pattern. return false; if (s1.substring(0, i).equals(s2.substring(0, i))) samePattern(s1, s2, i+1); else if (s2.charAt(i-1) == '*') samePattern(s1.substring(0, i-1), s2.substring(0, i), 1); // new smaller strings. else samePattern(s1.substring(1), s2, i); }

  Read the article

• Changing backgroundcolor in listview (expandable listview)

  - by Stofke

  I'm trying to dynamically change a backgroundcolor in a part of a listview, I have on example that works fine in a listview when I try to replicate it in another part with an expandable listview it fails This piece of code works and displays a different color if a student is online or not ... map.put(KEY_FIRSTNAME, temp.firstName); map.put(KEY_NAME, temp.name); map.put(KEY_EMAIL, temp.email); map.put(KEY_ISONLINE, temp.isOnLine); // change image if student is online or not Log.d("demo", "is on line= " + temp.isOnLine); if (temp.isOnLine.equalsIgnoreCase("1")) { map.put(KEY_IMAGE_ISONLINE, R.color.greenColor); } else { map.put(KEY_IMAGE_ISONLINE, R.color.greyColor); } listItem.add(map); } myListView = (ListView) findViewById(R.id.listViewTabLeerlingen); SimpleAdapter adapter = new SimpleAdapter(StudentTab.this, listItem, R.layout.list_item_student, new String[] { KEY_FIRSTNAME, KEY_NAME, KEY_IMAGE_ISONLINE }, new int[] { R.id.firstNameTextView, R.id.lastNameTextView, R.id.logo }); myListView.setAdapter(adapter); the xml that goes along with it <ImageView android:id="@+id/logo" android:layout_width="85dp" android:layout_height="match_parent" android:background="@color/greenColor" android:contentDescription="Image if student is online or not" android:src="@drawable/transparent_pixel" /> The above works fine however the following code (just part of the code) ... ArrayList<Map<String, Object>> children = new ArrayList<Map<String, Object>>(); for (int i = 0; i < _data.length(); i++) { try { JSONArray tmp = _data.getJSONArray(i); HashMap<String, Object> map = new HashMap<String, Object>(); // change image if student is online or not if (tmp.getString(3).equalsIgnoreCase("0")) { map.put(KEY_POINTS,R.color.redColor); }else{ map.put(KEY_POINTS,R.color.greenColor); } map.put(KEY_QUESTIONTEXT, tmp.getString(1)); map.put(KEY_ANSWER, tmp.getString(2)); children.add(map); } catch (JSONException e) { e.printStackTrace(); } childData.add(children); ... ... ArrayList<ArrayList<Map<String, Object>>> childData) { SimpleExpandableListAdapter listAdapter = new SimpleExpandableListAdapter( this, groupData, R.layout.list_item_results_students, new String[] { KEY_FIRSTNAME, KEY_NAME, KEY_ISJUIST }, new int[] { R.id.firstnameResults, R.id.nameResults, R.id.resultsTextView }, childData, R.layout.list_item_results_results, new String[] { KEY_QUESTIONTEXT, KEY_ANSWER, KEY_POINTS }, new int[] { R.id.questionTextView, R.id.answerTextTextView, R.id.score }); ExpandableListView myListView = (ExpandableListView) findViewById(R.id.listViewTabResultaten); myListView.setAdapter(listAdapter); with xml: <ImageView android:id="@+id/score" android:layout_width="16dp" android:layout_height="match_parent" android:background="@color/greenColor" android:contentDescription="Image if student has correct answer" android:src="@drawable/transparent_pixel" /> I will get this error: 06-09 10:35:21.490: E/AndroidRuntime(4406): java.lang.ClassCastException: android.widget.ImageView cannot be cast to android.widget.TextView

  Read the article

• asp.net mvc HttpPostedFileBase getting file extension

  - by mazhar kaunain baig

  public string ContructOrganizationNameLogo(HttpPostedFileBase upload, string OrganizationName, int OrganizationID,string LangName) { var UploadedfileName = Path.GetFileName(upload.FileName); string type = upload.ContentType; } I want to get the extension of the file to dynamically generate the name of the file.One way i will use to split the type. but can i use HttpPostedFileBase object to get the extension in the clean way?

  Read the article

• convert 0.5 to 0.50 in C#

  - by Rohit

  I have a string which holds 0.5. I have to convert in to 0.50. I have tried following ways but nothing works.Please help hdnSliderValue.Value is 0.5,I want workFlow.QualityThresholdScore to be 0.50 workFlow.QualityThresholdScore = Convert.ToDecimal(String.format("{0:d}",hdnSliderValue.Value)); workFlow.QualityThresholdScore = Convert.ToDecimal(String.format("{0:0.00}",hdnSliderValue.Value)); IS there any built in function or will i have to do string handling to accomplish this.

  Read the article

• How does Java pick which method to call?

  - by Gaurav

  Given the following code: public class Test { public void method(Object o){ System.out.println("object"); } public void method(String s) { System.out.println("String"); } public void method() { System.out.println("blank"); } /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Test test=new Test(); test.method(null); } } Java prints "String". Why is this the case?

  Read the article

• dynamic class property $$value in php

  - by cellis

  How can i reference a class property knowing only a string? class Foo { public $bar; public function TestFoobar() { $this->foobar('bar'); } public function foobar($string) { echo $this->$$string; //doesn't work } } what is the correct way to eval the string?

  Read the article

• Can't figure out where race condition is occuring

  - by Nik

  I'm using Valgrind --tool=drd to check my application that uses Boost::thread. Basically, the application populates a set of "Book" values with "Kehai" values based on inputs through a socket connection. On a seperate thread, a user can connect and get the books send to them. Its fairly simple, so i figured using a boost::mutex::scoped_lock on the location that serializes the book and the location that clears out the book data should be suffice to prevent any race conditions. Here is the code: void Book::clear() { boost::mutex::scoped_lock lock(dataMutex); for(int i =NUM_KEHAI-1; i >= 0; --i) { bid[i].clear(); ask[i].clear(); } } int Book::copyChangedKehaiToString(char* dst) const { boost::mutex::scoped_lock lock(dataMutex); sprintf(dst, "%-4s%-13s",market.c_str(),meigara.c_str()); int loc = 17; for(int i = 0; i < Book::NUM_KEHAI; ++i) { if(ask[i].changed > 0) { sprintf(dst+loc,"A%i%-21s%-21s%-21s%-8s%-4s",i,ask[i].price.c_str(),ask[i].volume.c_str(),ask[i].number.c_str(),ask[i].postTime.c_str(),ask[i].status.c_str()); loc += 77; } } for(int i = 0; i < Book::NUM_KEHAI; ++i) { if(bid[i].changed > 0) { sprintf(dst+loc,"B%i%-21s%-21s%-21s%-8s%-4s",i,bid[i].price.c_str(),bid[i].volume.c_str(),bid[i].number.c_str(),bid[i].postTime.c_str(),bid[i].status.c_str()); loc += 77; } } return loc; } The clear() function and the copyChangedKehaiToString() function are called in the datagetting thread and data sending thread,respectively. Also, as a note, the class Book: struct Book { private: Book(const Book&); Book& operator=(const Book&); public: static const int NUM_KEHAI=10; struct Kehai; friend struct Book::Kehai; struct Kehai { private: Kehai& operator=(const Kehai&); public: std::string price; std::string volume; std::string number; std::string postTime; std::string status; int changed; Kehai(); void copyFrom(const Kehai& other); Kehai(const Kehai& other); inline void clear() { price.assign(""); volume.assign(""); number.assign(""); postTime.assign(""); status.assign(""); changed = -1; } }; std::vector<Kehai> bid; std::vector<Kehai> ask; tm recTime; mutable boost::mutex dataMutex; Book(); void clear(); int copyChangedKehaiToString(char * dst) const; }; When using valgrind --tool=drd, i get race condition errors such as the one below: ==26330== Conflicting store by thread 1 at 0x0658fbb0 size 4 ==26330== at 0x653AE68: std::string::_M_mutate(unsigned int, unsigned int, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653AFC9: std::string::_M_replace_safe(unsigned int, unsigned int, char const*, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653B064: std::string::assign(char const*, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653B134: std::string::assign(char const*) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x8055D64: Book::Kehai::clear() (Book.h:50) ==26330== by 0x8094A29: Book::clear() (Book.cpp:78) ==26330== by 0x808537E: RealKernel::start() (RealKernel.cpp:86) ==26330== by 0x804D15A: main (main.cpp:164) ==26330== Allocation context: BSS section of /usr/lib/libstdc++.so.6.0.8 ==26330== Other segment start (thread 2) ==26330== at 0x400BB59: pthread_mutex_unlock (drd_pthread_intercepts.c:633) ==26330== by 0xC59565: pthread_mutex_unlock (in /lib/libc-2.5.so) ==26330== by 0x805477C: boost::mutex::unlock() (mutex.hpp:56) ==26330== by 0x80547C9: boost::unique_lock<boost::mutex>::~unique_lock() (locks.hpp:340) ==26330== by 0x80949BA: Book::copyChangedKehaiToString(char*) const (Book.cpp:134) ==26330== by 0x80937EE: BookSerializer::serializeBook(Book const&, std::string const&) (BookSerializer.cpp:41) ==26330== by 0x8092D05: BookSnapshotManager::getSnaphotDataList() (BookSnapshotManager.cpp:72) ==26330== by 0x8088179: SnapshotServer::getDataList() (SnapshotServer.cpp:246) ==26330== by 0x808870F: SnapshotServer::run() (SnapshotServer.cpp:183) ==26330== by 0x808BAF5: boost::_mfi::mf0<void, RealThread>::operator()(RealThread*) const (mem_fn_template.hpp:49) ==26330== by 0x808BB4D: void boost::_bi::list1<boost::_bi::value<RealThread*> >::operator()<boost::_mfi::mf0<void, RealThread>, boost::_bi::list0>(boost::_bi::type<void>, boost::_mfi::mf0<void, RealThread>&, boost::_bi::list0&, int) (bind.hpp:253) ==26330== by 0x808BB90: boost::_bi::bind_t<void, boost::_mfi::mf0<void, RealThread>, boost::_bi::list1<boost::_bi::value<RealThread*> > >::operator()() (bind_template.hpp:20) ==26330== Other segment end (thread 2) ==26330== at 0x400B62A: pthread_mutex_lock (drd_pthread_intercepts.c:580) ==26330== by 0xC59535: pthread_mutex_lock (in /lib/libc-2.5.so) ==26330== by 0x80546B8: boost::mutex::lock() (mutex.hpp:51) ==26330== by 0x805473B: boost::unique_lock<boost::mutex>::lock() (locks.hpp:349) ==26330== by 0x8054769: boost::unique_lock<boost::mutex>::unique_lock(boost::mutex&) (locks.hpp:227) ==26330== by 0x8094711: Book::copyChangedKehaiToString(char*) const (Book.cpp:113) ==26330== by 0x80937EE: BookSerializer::serializeBook(Book const&, std::string const&) (BookSerializer.cpp:41) ==26330== by 0x808870F: SnapshotServer::run() (SnapshotServer.cpp:183) ==26330== by 0x808BAF5: boost::_mfi::mf0<void, RealThread>::operator()(RealThread*) const (mem_fn_template.hpp:49) ==26330== by 0x808BB4D: void boost::_bi::list1<boost::_bi::value<RealThread*> >::operator()<boost::_mfi::mf0<void, RealThread>, boost::_bi::list0>(boost::_bi::type<void>, boost::_mfi::mf0<void, RealThread>&, boost::_bi::list0&, int) (bind.hpp:253) For the life of me, i can't figure out where the race condition is. As far as I can tell, clearing the kehai is done only after having taken the mutex, and the same holds true with copying it to a string. Does anyone have any ideas what could be causing this, or where I should look? Thank you kindly.

  Read the article

• polymorphism, inheritance in c# - base class calling overridden method?

  - by Andrew Johns

  This code doesn't work, but hopefully you'll get what I'm trying to achieve here. I've got a Money class, which I've taken from http://www.noticeablydifferent.com/CodeSamples/Money.aspx, and extended it a little to include currency conversion. The implementation for the actual conversion rate could be different in each project, so I decided to move the actual method for retrieving a conversion rate (GetCurrencyConversionRate) into a derived class, but the ConvertTo method contains code that would work for any implementation assuming the derived class has overriden GetCurrencyConversionRate so it made sense to me to keep it in the parent class? So what I'm trying to do is get an instance of SubMoney, and be able to call the .ConvertTo() method, which would in turn use the overriden GetCurrencyConversionRate, and return a new instance of SubMoney. The problem is, I'm not really understanding some concepts of polymorphism and inheritance yet, so not quite sure what I'm trying to do is even possible in the way I think it is, as what is currently happening is that I end up with an Exception where it has used the base GetCurrencyConversionRate method instead of the derived one. Something tells me I need to move the ConvertTo method down to the derived class, but this seems like I'll be duplicating code in multiple implementations, so surely there's a better way? public class Money { public CurrencyConversionRate { get { return GetCurrencyConversionRate(_regionInfo.ISOCurrencySymbol); } } public static decimal GetCurrencyConversionRate(string isoCurrencySymbol) { throw new Exception("Must override this method if you wish to use it."); } public Money ConvertTo(string cultureName) { // convert to base USD first by dividing current amount by it's exchange rate. Money someMoney = this; decimal conversionRate = this.CurrencyConversionRate; decimal convertedUSDAmount = Money.Divide(someMoney, conversionRate).Amount; // now convert to new currency CultureInfo cultureInfo = new CultureInfo(cultureName); RegionInfo regionInfo = new RegionInfo(cultureInfo.LCID); conversionRate = GetCurrencyConversionRate(regionInfo.ISOCurrencySymbol); decimal convertedAmount = convertedUSDAmount * conversionRate; Money convertedMoney = new Money(convertedAmount, cultureName); return convertedMoney; } } public class SubMoney { public SubMoney(decimal amount, string cultureName) : base(amount, cultureName) {} public static new decimal GetCurrencyConversionRate(string isoCurrencySymbol) { // This would get the conversion rate from some web or database source decimal result = new Decimal(2); return result; } }

  Read the article

< Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >