Search Results

Search found 15087 results on 604 pages for 'python multithreading'.

Page 372/604 | < Previous Page | 368 369 370 371 372 373 374 375 376 377 378 379  | Next Page >

  • What category of combinatorial problems appear on the logic games section of the LSAT?

    - by Merjit
    There's a category of logic problem on the LSAT that goes like this: Seven consecutive time slots for a broadcast, numbered in chronological order I through 7, will be filled by six song tapes-G, H, L, O, P, S-and exactly one news tape. Each tape is to be assigned to a different time slot, and no tape is longer than any other tape. The broadcast is subject to the following restrictions: L must be played immediately before O. The news tape must be played at some time after L. There must be exactly two time slots between G and P, regardless of whether G comes before P or whether G comes after P. I'm interested in generating a list of permutations that satisfy the conditions as a way of studying for the test and as a programming challenge. However, I'm not sure what class of permutation problem this is. I've generalized the type problem as follows: Given an n-length array A: How many ways can a set of n unique items be arranged within A? Eg. How many ways are there to rearrange ABCDEFG? If the length of the set of unique items is less than the length of A, how many ways can the set be arranged within A if items in the set may occur more than once? Eg. ABCDEF = AABCDEF; ABBCDEF, etc. How many ways can a set of unique items be arranged within A if the items of the set are subject to "blocking conditions"? My thought is to encode the restrictions and then use something like Python's itertools to generate the permutations. Thoughts and suggestions are welcome.

    Read the article

  • Accessing data entered into multiple Django forms and generating them onto a new URL

    - by pedjk
    I have a projects page where users can start up new projects. Each project has two forms. The two forms are: class ProjectForm(forms.Form): Title = forms.CharField(max_length=100, widget=_hfill) class SsdForm(forms.Form): Status = forms.ModelChoiceField(queryset=P.ProjectStatus.objects.all()) With their respective models as follows: class Project(DeleteFlagModel): Title = models.CharField(max_length=100) class Ssd(models.Model): Status = models.ForeignKey(ProjectStatus) Now when a user fills out these two forms, the data is saved into the database. What I want to do is access this data and generate it onto a new URL. So I want to get the "Title" and the "Status" from these two forms and then show them on a new page for that one project. I don't want the "Title" and "Status" from all the projects to show up, just for one project at a time. If this makes sense, how would I do this? I'm very new to Django and Python (though I've read the Django tutorials) so I need as much help as possible. Thanks in advance Edit: The ProjectStatus code is (under models): class ProjectStatus(models.Model): Name = models.CharField(max_length=30) def __unicode__(self): return self.Name

    Read the article

  • Process xml-like log file queue

    - by Zsolt Botykai
    Hi all, first of all: I'm not a programmer, never was, although had learn a lot during my professional carreer as a support consultant. Now my task is to process - and create some statistics about a constantly written and rapidly growing XML like log file. It's not valid XML, because it does not have a proper <root> element, e.g. the log looks like this: <log itemdate="somedate"> <field id="0" /> ... </log> <log itemdate="somedate+1"> <field id="0" /> ... </log> <log itemdate="somedate+n"> <field id="0" /> ... </log> E.g. I have to count all the items with field id=0. But most of the solutions I had found (e.g. using XPath) reports an error about the garbage after the first closing </log>. Most probably I can use python (2.6, although I can compile 3.x as well), or some really old perl version (5.6.x), and recently compiled xmlstarlet which really looks promising - I was able to create the statistics for a certain period after copying the file, and pre- & appending the opening and closing root element. But this is a huge file and copying takes time as well. Isn't there a better solution? Thanks in advance!

    Read the article

  • Installing django on dreamhost (help a newb out)

    - by augustfirst
    I'm trying to get django running on my dreahost account. I've been trying to sort of use two tutorials at once: the one on the dreamhost wiki and the one in the django book. I installed django using the script on the wiki page, but I ran into trouble immediately while trying to work through the django book. It says: To start the server, change into your project directory (cd mysite), if you haven’t already, and run this command: python manage.py runserver This launches the server locally, on port 8000, accessible only to connections from your own computer. Now that it’s running, visit 127.0.0.1:8000 with your Web browser. You’ll see a “Welcome to Django” page shaded in a pleasant pastel blue. It worked! Those instructions seem to assume that you're developing locally, not on a shared server. Where the heck am I supposed to look for the "Welcome to Django" page after starting the server? In my webroot? No dice. Anyway, I tried to blunder ahead through the django book to its hello world tutorial (chapter 3). But once I've edited the view file and the URLconf, I don't get a nice clean "hello world" text. Instead (as you can see) I get an "import error". Any help would be greatly appreciated.

    Read the article

  • Forwarding keypresses in GTK

    - by dguaraglia
    I'm writing a bit of code for a Gedit plugin. I'm using Python and the interface (obviously) is GTK. So, the issue I'm having is quite simple: I have a search box (a gtk.Entry) and right below I have a results box (a gtk.TreeView). Right after you type something in the search box you are presented a bunch of results, and I would like the user to be able to press the Up/Down keys to select one, Enter to choose it, and be done. Thing is, I can't seem to find a way to forward the Up/Down keypress to the TreeView. Currently I have this piece of code: def __onSearchKeyPress(self, widget, event): """ Forward up and down keys to the tree. """ if event.keyval in [gtk.keysyms.Up, gtk.keysyms.Down]: print "pressed up or down" e = gtk.gdk.Event(gtk.gdk.KEY_PRESS) e.keyval = event.keyval e.window = self.browser.window e.send_event = True self.browser.emit("key-press-event", e) return True I can clearly see I'm receiving the right kind of event, but the event I'm sending gets ignored by the TreeView. Any ideas? Thanks in advance people.

    Read the article

  • sqlalchemy dynamic mapping

    - by adancu
    Hi, I have the following problem: I have the class: class Word(object): def __init__(self): self.id = None self.columns = {} def __str__(self): return "(%s, %s)" % (str(self.id), str(self.columns)) self.columns is a dict which will hold (columnName:columnValue) values. The name of the columns are known at runtime and they are loaded in a wordColumns list, for example wordColumns = ['english', 'korean', 'romanian'] wordTable = Table('word', metadata, Column('id', Integer, primary_key = True) ) for columnName in wordColumns: wordTable.append_column(Column(columnName, String(255), nullable = False)) I even created a explicit mapper properties to "force" the table columns to be mapped on word.columns[columnName], instead of word.columnName, I don't get any error on mapping, but it seems that doesn't work. mapperProperties = {} for column in wordColumns: mapperProperties['columns[\'%']' % column] = wordTable.columns[column] mapper(Word, wordTable, mapperProperties) When I load a word object, SQLAlchemy creates an object which has the word.columns['english'], word.columns['korean'] etc. properties instead of loading them into word.columns dict. So for each column, it creates a new property. Moreover word.columns dictionary doesn't even exists. The same way, when I try to persist a word, SQLAlchemy expects to find the column values in properties named like word.columns['english'] (string type) instead of the dictionary word.columns. I have to say that my experience with Python and SQLAlchemy is quite limited, maybe it isn't possible to do what I'm trying to do. Any help appreciated, Thanks in advance.

    Read the article

  • Is There a Better Way to Feed Different Parameters into Functions with If-Statements?

    - by FlowofSoul
    I've been teaching myself Python for a little while now, and I've never programmed before. I just wrote a basic backup program that writes out the progress of each individual file while it is copying. I wrote a function that determines buffer size so that smaller files are copied with a smaller buffer, and bigger files are copied with a bigger buffer. The way I have the code set up now doesn't seem very efficient, as there is an if loop that then leads to another if loops, creating four options, and they all just call the same function with different parameters. import os import sys def smartcopy(filestocopy, dest_path, show_progress = False): """Determines what buffer size to use with copy() Setting show_progress to True calls back display_progress()""" #filestocopy is a list of dictionaries for the files needed to be copied #dictionaries are used as the fullpath, st_mtime, and size are needed if len(filestocopy.keys()) == 0: return None #Determines average file size for which buffer to use average_size = 0 for key in filestocopy.keys(): average_size += int(filestocopy[key]['size']) average_size = average_size/len(filestocopy.keys()) #Smaller buffer for smaller files if average_size < 1024*10000: #Buffer sizes determined by informal tests on my laptop if show_progress: for key in filestocopy.keys(): #dest_path+key is the destination path, as the key is the relative path #and the dest_path is the top level folder copy(filestocopy[key]['fullpath'], dest_path+key, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, callback = None) #Bigger buffer for bigger files else: if show_progress: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600) def display_progress(pos, total, filename): percent = round(float(pos)/float(total)*100,2) if percent <= 100: sys.stdout.write(filename + ' - ' + str(percent)+'% \r') else: percent = 100 sys.stdout.write(filename + ' - Completed \n') Is there a better way to accomplish what I'm doing? Sorry if the code is commented poorly or hard to follow. I didn't want to ask someone to read through all 120 lines of my poorly written code, so I just isolated the two functions. Thanks for any help.

    Read the article

  • Design an Application That Stores and Processes Files

    - by phasetwenty
    I'm tasked with writing an application that acts as a central storage point for files (usually document formats) as provided by other applications. It also needs to take commands like "file 395 needs a copy in X format", at which point some work is offloaded to a 3rd party application. I'm having trouble coming up with a strategy for this. I'd like to keep the design as simple as possible, so I'd like to avoid big extra frameworks or techniques like threads for as long as it makes sense. The clients are expected to be web applications (for example, one is a django application that receives files from our customers; the others are not yet implemented). The platform it will be running on is likely going to be Python on Linux, unless I have a strong argument to use something else. In the beginning I thought I could fit the information I wanted to communicate in the filenames, and let my application parse the filename to figure out what it needed to do, but this is proving too inflexible with the amount of information I'm realizing I need to make available. Another idea is to pair FTP with a database used as a communication medium (client uploads a file and updates the database with a command as a row in a table) but I don't like this idea because adding commands (a known change) looks like it will require adding code as well as changing database schemas. It will also muddy up the interface my clients will have to use. I looked into Pyro to let applications communicate more directly but I don't like the idea of running an extra nameserver for this one purpose. I also don't see a good way to do file transfer within this framework. What I'm looking for is techniques and/or technologies applicable to my problem. At the simplest level, I need the ability to accept files and messages with them.

    Read the article

  • Is there a programmatic way to transform a sequence of image files into a PDF?

    - by Salim Fadhley
    I have a sequence of JPG images. Each of the scans is already cropped to the exact size of one page. They are sequential pages of a valuable and out of print book. The publishing application requires that these pages be submitted as a single PDF file. I could take each of these images and just past them into a word-processor (e.g. OpenOffice) - unfortunately the problem here is that it's a very big book and I've got quite a few of these books to get through. It would obviously be time-consuming. This is volunteer work! My second idea was to use LaTeX - I could make a very simple document that consists of nothing more than a series of in-line image includes. I'm sure that this approach could be made to work, it's just a little on the complex side for something which seems like a very simple job. It occurred to me that there must be a simpler way - so any suggestions? I'm on Ubuntu 9.10, my primary programming language is Python, but if the solution is super-simple I'd happily adopt any technology that works.

    Read the article

  • why does cx_oracle execute() not like my string now?

    - by Frank Stallone
    I've downloaded cx_oracle some time ago and wrote a script to convert data to XML. I've had to reisntall my OS and grabbed the latest version of cx_Oracle (5.0.3) and all of the sudden my code is broken. The first thing was that cx_Oracle.connect wanted unicode rather string for the username and password, that was very easy to fix. But now it keeps failing on the cursor.execute and tells me my string is not a string even when type() tells me it is a string. Here is a test script I initally used ages ago and worked fine on my old version but does not work on cx_Oracle now. import cx_Oracle ip = 'url.to.oracle' port = 1521 SID = 'mysid' dsn_tns = cx_Oracle.makedsn(ip, port, SID) connection = cx_Oracle.connect(u'name', u'pass', dsn_tns) cursor = connection.cursor() cursor.arraysize = 50 sql = "select isbn, title_code from core_isbn where rownum<=20" print type(sql) cursor.execute(sql) for isbn, title_code in cursor.fetchall(): print "Values from DB:", isbn, title_code cursor.close() connection.close() When I run that I get: Traceback (most recent call last): File "C:\NetBeansProjects\Python\src\db_temp.py", line 48, in cursor.execute(sql) TypeError: expecting None or a string Does anyone know what I may be doing wrong?

    Read the article

  • How to import a module from PyPI when I have another module with the same name

    - by kuzzooroo
    I'm trying to use the lockfile module from PyPI. I do my development within Spyder. After installing the module from PyPI, I can't import it by doing import lockfile. I end up importing anaconda/lib/python2.7/site-packages/spyderlib/utils/external/lockfile.py instead. Spyder seems to want to have the spyderlib/utils/external directory at the beginning of sys.path, or at least none of the polite ways I can find to add my other paths get me in front of spyderlib/utils/external. I'm using python2.7 but with from __future__ import absolute_import. Here's what I've already tried: Writing code that modifies sys.path before running import lockfile. This works, but it can't be the correct way of doing things. Circumventing the normal mechanics of importing in Python using the imp module (I haven't gotten this to work yet, but I'm guessing it could be made to work) Installing the package with something like pip install --install-option="--prefix=modules_with_name_collisions" package_name. I haven't gotten this to work yet either, but I'm guess it could be made to work. It looks like this option is intended to create an entirely separate lib tree, which is more than I need. Source Using pip install --target=lockfile_from_pip. The files show up in the directory where I tell them to go, but import doesn't find them. And in fact pip uninstall can't find them either. I get Cannot uninstall requirement lockfile-from-pip, not installed and I guess I will just delete the directories and hope that's clean. Source So what's the preferred way for me to get access to the PyPI lockfile module?

    Read the article

  • Ubuntu + virtualenv = a mess? virtualenv hates dist-packages, wants site-packages

    - by lostincode
    Can someone please explain to me what is going on with python in ubuntu 9.04? I'm trying to spin up virtualenv, and the --no-site-packages flag seems to do nothing with ubuntu. I installed virtualenv 1.3.3 with easy_install (which I've upgraded to setuptools 0.6c9) and everything seems to be installed to /usr/local/lib/python2.6/dist-packages I assume that when installing a package using apt-get, it's placed in /usr/lib/python2.6/dist-packages/ ? The issue is, there is a /usr/local/lib/python2.6/site-packages as well that just sits there being empty. It would seem (by looking at the path in a virtualenv) that this is the folder virtualenv uses as backup. Thus even thought I omit --no-site-packages, I cant access my local systems packages from any of my virtualenv's. So my questions are: How do I get virtualenv to point to one of the dist-packages? Which dist-packages should I point it to? /usr/lib/python2.6/dist-packages or /usr/local/lib/python2.6/dist-packages/ What is the point of /usr/lib/python2.6/site-packages? There's nothing in there! Is it first come first serve on the path? If I have a newer version of package XYZ installed in /usr/local/lib/python2.6/dist-packages/ and and older one (from ubuntu repos/apt-get) in /usr/lib/python2.6/dist-packages, which one gets imported when I import xyz? I'm assuming this is based on the path list, yes? Why the hell is this so confusing? Is there something I'm missing here? Where is it defined that easy_install should install to /usr/local/lib/python2.6/dist-packages? Will this affect pip as well? Thanks to anyone who can clear this up!

    Read the article

  • Creating collaborative whiteboard drawing application

    - by Steven Sproat
    I have my own drawing program in place, with a variety of "drawing tools" such as Pen, Eraser, Rectangle, Circle, Select, Text etc. It's made with Python and wxPython. Each tool mentioned above is a class, which all have polymorphic methods, such as left_down(), mouse_motion(), hit_test() etc. The program manages a list of all drawn shapes -- when a user has drawn a shape, it's added to the list. This is used to manage undo/redo operations too. So, I have a decent codebase that I can hook collaborative drawing into. Each shape could be changed to know its owner -- the user who drew it, and to only allow delete/move/rescale operations to be performed on shapes owned by one person. I'm just wondering the best way to develop this. One person in the "session" will have to act as the server, I have no money to offer free central servers. Somehow users will need a way to connect to servers, meaning some kind of "discover servers" browser...or something. How do I broadcast changes made to the application? Drawing in realtime and broadcasting a message on each mouse motion event would be costly in terms of performance and things get worse the more users there are at a given time. Any ideas are welcome, I'm not too sure where to begin with developing this (or even how to test it)

    Read the article

  • Approach for parsing file and creating dynamic data structure for use by another program

    - by user275633
    All, Background: I have a customer who has some build scripts for their datacenter based on python that I've inherited. I did not work on the original design so I'm sort of limited to some degree on what I can and can't change. That said, my customer has a properties file that they use in their datacenter. Some of the values are used to build their servers and unfortunately they have other applications that also use these values so I cannot change them to make it easier for me. What I want to do is make the scripts more dynamic to distribute more hosts so that I don't have to keep updating the scripts in the future and can just add more hosts to the property file. Unfortunately I can't change the current property file and have to work with it. The property file looks something like this: projectName.ClusterNameServer1.sslport=443 projectName.ClusterNameServer1.port=80 projectName.ClusterNameServer1.host=myHostA projectName.ClusterNameServer2.sslport=443 projectName.ClusterNameServer2.port=80 projectName.ClusterNameServer2.host=myHostB In their deployment scripts they basically have alot of if projectName.ClusterNameServerX where X is some number of entries defined and then do something, e.g.: if projectName.ClusterNameServer1.host != "" do X if projectName.ClusterNameServer2.host != "" do X if projectName.ClusterNameServer3.host != "" do X Then when they add another host (say Serve4) they've added another if statement. Question: What I would like to do is make the scripts more dynamic and parse the properties file and put what I need into some data structure to pass to the deployment scripts and then just iterate over the structure and do my deployment that way so I don't have to constantly add a bunch of if some host# do something. I'm just curious to feed some suggestions as to what others would do to parse the file and what sort of data structure would they use and how they would group things together by ClusterNameServer# or something else. Thanks

    Read the article

  • create a class attribute without going through __setattr__

    - by eric.frederich
    Hello, What I have below is a class I made to easily store a bunch of data as attributes. They wind up getting stored in a dictionary. I override __getattr__ and __setattr__ to store and retrieve the values back in different types of units. When I started overriding __setattr__ I was having trouble creating that initial dicionary in the 2nd line of __init__ like so... super(MyDataFile, self).__setattr__('_data', {}) My question... Is there an easier way to create a class level attribute with going through __setattr__? Also, should I be concerned about keeping a separate dictionary or should I just store everything in self.__dict__? #!/usr/bin/env python from unitconverter import convert import re special_attribute_re = re.compile(r'(.+)__(.+)') class MyDataFile(object): def __init__(self, *args, **kwargs): super(MyDataFile, self).__init__(*args, **kwargs) super(MyDataFile, self).__setattr__('_data', {}) # # For attribute type access # def __setattr__(self, name, value): self._data[name] = value def __getattr__(self, name): if name in self._data: return self._data[name] match = special_attribute_re.match(name) if match: varname, units = match.groups() if varname in self._data: return self.getvaras(varname, units) raise AttributeError # # other methods # def getvaras(self, name, units): from_val, from_units = self._data[name] if from_units == units: return from_val return convert(from_val, from_units, units), units def __str__(self): return str(self._data) d = MyDataFile() print d # set like a dictionary or an attribute d.XYZ = 12.34, 'in' d.ABC = 76.54, 'ft' # get it back like a dictionary or an attribute print d.XYZ print d.ABC # get conversions using getvaras or using a specially formed attribute print d.getvaras('ABC', 'cm') print d.XYZ__mm

    Read the article

  • Get active window title in X

    - by dutt
    I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

    Read the article

  • tk: how to invoke it just to display something, and return to the main program?

    - by max
    Sorry for the noob question but I really don't understand this. I'm using python / tkinter and I want to display something (say, a canvas with a few shapes on it), and keep it displayed until the program quits. I understand that no widgets would be displayed until I call tkinter.tk.mainloop(). However, if I call tkinter.tk.mainloop(), I won't be able to do anything else until the user closes the main window. I don't need to monitor any user input events, just display some stuff. What's a good way to do this without giving up control to mainloop? EDIT: Is this sample code reasonable: class App(tk.Tk): def __init__(self, sim): self.sim = sim # link to the simulation instance self.loop() def loop(): self.redraw() # update all the GUI to reflect new simulation state sim.next_step() # advance simulation another step self.after(0, self.loop) def redraw(): # get whatever we need from self.sim, and put it on the screen EDIT2 (added after_idle): class App(tk.Tk): def __init__(self, sim): self.sim = sim # link to the simulation instance self.after_idle(self.preloop) def preloop(): self.after(0, self.loop) def loop(): self.redraw() # update all the GUI to reflect new simulation state sim.next_step() # advance simulation another step self.after_idle(self.preloop) def redraw(): # get whatever we need from self.sim, and put it on the screen

    Read the article

  • pyOpenSSL and the WantReadError

    - by directedition
    I have a socket server that I am trying to move over to SSL on python 2.5, but I've run into a snag with pyOpenSSL. I can't find any good tutorials on using it, so I'm operating largely on guesses. Here is how my server sets up the socket: ctx = SSL.Context(SSL.SSLv23_METHOD) ctx.use_privatekey_file ("mykey.pem") ctx.use_certificate_file("mycert.pem") sock = SSL.Connection(ctx, socket.socket(socket.AF_INET, socket.SOCK_STREAM)) sock.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) addr = ('', int(8081)) sock.bind(addr) sock.listen(5) Here is how it accepts clients: sock.setblocking(0) while True: if len(select([sock], [], [], 0.25)[0]): client_sock, client_addr = sock.accept() client = ClientGen(client_sock) And here is how it sends/receives from the connected sockets: while True: (r, w, e) = select.select([sock], [sock], [], 0.25) if len(r): bytes = sock.recv(1024) if len(w): n_bytes = sock.send(self.message) It's compacted, but you get the general idea. The problem is, once the send/receive loop starts, it dies right away, before anything has been sent or received (that I can see anyway): Traceback (most recent call last): File "ClientGen.py", line 50, in networkLoop n_bytes = sock.send(self.message WantReadError The manual's description of the 'WantReadError' is very vague, saying it can come from just about anywhere. What am I doing wrong?

    Read the article

  • Problems with Getting Remote Contents using Google App Engine

    - by dade
    Here is the client side code. It is running insdide a Google Gadgets var params = {}; params[gadgets.io.RequestParameters.CONTENT_TYPE] = gadgets.io.ContentType.JSON; var url = "http://invplatformtest.appspot.com/getrecent/"; gadgets.io.makeRequest(url, response, params); The response function is: function response(obj) { var r = obj.data; alert(r['name']); } while on the server end, the python code sending the JSON is: class GetRecent(webapp.RequestHandler): def get(self): self.response.out.write({'name':'geocities'}) #i know this is where the problem is so how do i encode json in GAE? which is just supposed to send back a Json encoded string but when i run this, the javascript throws the following error: r is null alert(r['name']); If i were recieving just TEXT contents and my server send TEXT everything works fine. I only get this problem when am trying to send JSON. Where exactly is the problem? Am i encoding the JSON the wrong way on AppEngine? I tried using the JSON library but it looks as if this is not supported. Where is the problem exactly? :(

    Read the article

  • Merging similar dictionaries in a list together

    - by WonderSteve
    New to python here. I've been pulling my hair for hours and still can't figure this out. I have a list of dictionaries: [ {'FX0XST001.MID5': '195', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'} {'FX0XST001.MID13': '4929', 'Name': 'Firmicutes', 'Taxonomy ID': '1239','Type': 'phylum'}, {'FX0XST001.MID6': '826', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'}, . . . . {'FX0XST001.MID6': '125', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} {'FX0XST001.MID25': '70', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} {'FX0XST001.MID40': '40', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} ] I want to merge the dictionaries in the list based on their Type, Name, and Taxonomy ID [ {'FX0XST001.MID5': '195', 'FX0XST001.MID13': '4929', 'FX0XST001.MID6': '826', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'} . . . . {'FX0XST001.MID6': '125', 'FX0XST001.MID25': '70', 'FX0XST001.MID40': '40', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'}] I have the data structure setup like this because I need to write the data to CSV using csv.DictWriter later. Would anyone kindly point me to the right direction?

    Read the article

  • I need Selenium to open it's web browser in a larger resolution ( preferably maximized)

    - by user1854271
    I am using Selenium WebDriver and coding in Python I have looked all over the place and the best I could find were things written in different languages. I also tried to use the export tool on Selenium IDE but when I look at the data says that the function is not supported for export. EDIT: The reason I need the browser to open up with a larger resolution is because the web application that I am testing is supporting tablet resolution as so elements are different depending on the resolution of the browser window. This is the script I exported from the IDE with a couple of modifications. from selenium import webdriver from selenium.webdriver.common.by import By from selenium.webdriver.support.ui import Select from selenium.common.exceptions import NoSuchElementException import unittest, time, re from Funk_Lib import RS class CreatingEditingDeletingVault(unittest.TestCase): def setUp(self): self.driver = webdriver.Firefox() self.driver.implicitly_wait(30) self.base_url = "http://cimdev-qa40/" self.verificationErrors = [] def test_creating_editing_deleting_vault(self): driver = self.driver driver.get(self.base_url + "/Login?contoller=Home") driver.find_element_by_id("UserName").click() driver.find_element_by_id("UserName").clear() driver.find_element_by_id("UserName").send_keys("[email protected]") driver.find_element_by_name("Password").click() driver.find_element_by_name("Password").clear() driver.find_element_by_name("Password").send_keys("Codigo#123") driver.find_element_by_id("fat-btn").click() driver.get(self.base_url + "/Content/Vaults/") driver.find_element_by_link_text("Content").click() driver.find_element_by_link_text("Vaults").click() driver.find_element_by_css_selector("button.btn.dropdown-toggle").click() driver.find_element_by_link_text("New vault").click() driver.find_element_by_name("Name").clear() driver.find_element_by_name("Name").send_keys("Test Vault") driver.find_element_by_xpath("//button[@onclick=\"vault_action('createvault', null, $('#CreateVault [name=\\'Name\\']').val())\"]").click() driver.find_element_by_css_selector("button.btn.dropdown-toggle").click() driver.find_element_by_link_text("Rename vault").click() driver.find_element_by_name("Id").click() Select(driver.find_element_by_name("Id")).select_by_visible_text("Test Vault") driver.find_element_by_css_selector("option[value=\"2\"]").click() driver.find_element_by_name("Name").clear() driver.find_element_by_name("Name").send_keys("Test Change") driver.find_element_by_xpath("//button[@onclick=\"vault_action('renamevault', $('#RenameVault [name=\\'Id\\']').val(), $('#RenameVault [name=\\'Name\\']').val())\"]").click() driver.find_element_by_css_selector("button.btn.dropdown-toggle").click() driver.find_element_by_link_text("Delete vault").click() driver.find_element_by_name("Id").click() Select(driver.find_element_by_name("Id")).select_by_visible_text("Test Change") driver.find_element_by_css_selector("option[value=\"2\"]").click() driver.find_element_by_xpath("//button[@onclick=\"vault_action('deletevault', $('#DeleteVault [name=\\'Id\\']').val(), '')\"]").click() def is_element_present(self, how, what): try: self.driver.find_element(by=how, value=what) except NoSuchElementException, e: return False return True def tearDown(self): self.driver.quit() self.assertEqual([], self.verificationErrors) if __name__ == "__main__": unittest.main()

    Read the article

  • Insertion sort invariant assertion fails

    - by user1661211
    In the following code at the end of the for loop I use the assert function in order to test that a[i+1] is greater than or equal to a[i] but I get the following error (after the code below). Also in c++ the assert with the following seems to work just fine but in python (the following code) it does not seem to work...anyone know why? import random class Sorting: #Precondition: An array a with values. #Postcondition: Array a[1...n] is sorted. def insertion_sort(self,a): #First loop invariant: Array a[1...i] is sorted. for j in range(1,len(a)): key = a[j] i = j-1 #Second loop invariant: a[i] is the greatest value from a[i...j-1] while i >= 0 and a[i] > key: a[i+1] = a[i] i = i-1 a[i+1] = key assert a[i+1] >= a[i] return a def random_array(self,size): b = [] for i in range(0,size): b.append(random.randint(0,1000)) return b sort = Sorting() print sort.insertion_sort(sort.random_array(10)) The Error: Traceback (most recent call last): File "C:\Users\Albaraa\Desktop\CS253\Programming 1\Insertion_Sort.py", line 27, in <module> print sort.insertion_sort(sort.random_array(10)) File "C:\Users\Albaraa\Desktop\CS253\Programming 1\Insertion_Sort.py", line 16, in insertion_sort assert a[i+1] >= a[i] AssertionError

    Read the article

  • Faster Insertion of Records into a Table with SQLAlchemy

    - by Kyle Brandt
    I am parsing a log and inserting it into either MySQL or SQLite using SQLAlchemy and Python. Right now I open a connection to the DB, and as I loop over each line, I insert it after it is parsed (This is just one big table right now, not very experienced with SQL). I then close the connection when the loop is done. The summarized code is: log_table = schema.Table('log_table', metadata, schema.Column('id', types.Integer, primary_key=True), schema.Column('time', types.DateTime), schema.Column('ip', types.String(length=15)) .... engine = create_engine(...) metadata.bind = engine connection = engine.connect() .... for line in file_to_parse: m = line_regex.match(line) if m: fields = m.groupdict() pythonified = pythoninfy_log(fields) #Turn them into ints, datatimes, etc if use_sql: ins = log_table.insert(values=pythonified) connection.execute(ins) parsed += 1 My two questions are: Is there a way to speed up the inserts within this basic framework? Maybe have a Queue of inserts and some insertion threads, some sort of bulk inserts, etc? When I used MySQL, for about ~1.2 million records the insert time was 15 minutes. With SQLite, the insert time was a little over an hour. Does that time difference between the db engines seem about right, or does it mean I am doing something very wrong?

    Read the article

  • Problems with i18n using django translation on App-Engine with Korean and Hindi

    - by Greg
    I've got a setup based on the post here, and it works perfectly. Adding more languages to the mix, it recognises them fine, except for Korean (ko) and Hindi (hi). Chinese/Japanese/Hebrew are all fine, so nothing to do with encodings/charsets I don't think. Taking a look into the django code inside the app-engine SDK, I notice that all the languages that I'm using except for ko and hi are ones that ship with django - in the default settings.py and inside the locale folder they are missing. If I copy one of the locale folders inside the /usr/local/google_appengine/lib/django[...]/conf/locale and rename it to be 'ko', then it starts working in my app, but I won't be able to replicate this modification when I deploy to app-engine, so need a bit of help understanding what I might be doing wrong. my settings.py is definitely being taken into account, as if I remove languages from there then they stop working (as they should). If I copied the django modules into my app, under 'lib' there say, could I use those instead of the ones app-engine tries to use, maybe? I'm brand new to python/django/app-engine, and developing on a Mac with Leopard, if that makes any difference. I have the latest app-engine SDK as of tuesday.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 368 369 370 371 372 373 374 375 376 377 378 379  | Next Page >