Search Results

Search found 13534 results on 542 pages for 'python'.

Page 373/542 | < Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • pyramid traversal resource url no attribute __name__

    - by Santana
    So I have: resources.py: def _add(obj, name, parent): obj.__name__ = name obj.__parent__ = parent return obj class Root(object): __parent__ = __name__ = None def __init__(self, request): super(Root, self).__init__() self.request = request self.collection = request.db.post def __getitem__(self, key): if u'profile' in key: return Profile(self.request) class Profile(dict): def __init__(self, request): super(Profile, self).__init__() self.__name__ = u'profile' self.__parent__ = Root self.collection = request.db.posts def __getitem__(self, name): post = Dummy(self.collection.find_one(dict(username=name))) return _add(post, name, self) and I'm using MongoDB and pyramid_mongodb views.py: @view_config(context = Profile, renderer = 'templates/mytemplate.pt') def test_view(request): return {} and in mytemplate.pt: <p tal:repeat='item request.context'> ${item} </p> I can echo what's in the database (I'm using mongodb), but when I provided a URL for each item using resource_url() <p tal:repeat='item request.context'> <a href='${request.resource_url(item)}'>${item}</a> </p> I got an error: 'dict' object has no attribute '__name__', can someone help me?

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • Looping through a directory on the web and displaying its contents (files and other directories) via

    - by al jaffe
    In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • Iterate with binary structure over numpy array to get cell sums

    - by Curlew
    In the package scipy there is the function to define a binary structure (such as a taxicab (2,1) or a chessboard (2,2)). import numpy from scipy import ndimage a = numpy.zeros((6,6), dtype=numpy.int) a[1:5, 1:5] = 1;a[3,3] = 0 ; a[2,2] = 2 s = ndimage.generate_binary_structure(2,2) # Binary structure #.... Calculate Sum of result_array = numpy.zeros_like(a) What i want is to iterate over all cells of this array with the given structure s. Then i want to append a function to the current cell value indexed in a empty array (example function sum), which uses the values of all cells in the binary structure. For example: array([[0, 0, 0, 0, 0, 0], [0, 1, 1, 1, 1, 0], [0, 1, 2, 1, 1, 0], [0, 1, 1, 0, 1, 0], [0, 1, 1, 1, 1, 0], [0, 0, 0, 0, 0, 0]]) # The array a. The value in cell 1,2 is currently one. Given the structure s and an example function such as sum the value in the resulting array (result_array) becomes 7 (or 6 if the current cell value is excluded). Someone got an idea?

    Read the article

  • Efficient way to store tuples in the datastore

    - by Drew Sears
    If I have a pair of floats, is it any more efficient (computationally or storage-wise) to store them as a GeoPtProperty than it would be pickle the tuple and store it as a BlobProperty? If GeoPt is doing something more clever to keep multiple values in a single property, can it be leveraged for arbitrary data? Can I store the tuple ("Johnny", 5) in a single entity property in a similarly efficient manner?

    Read the article

  • SQLAlchemy: who is in charge of the "session"? ( and how to unit-test with sessions )

    - by Nick Perkins
    I need some guidance on how to use session objects with SQLAlchemy, and how to organize Unit Tests of my mapped objects. What I would like to able to do is something like this: thing = BigThing() # mapped object child = thing.new_child() # create and return a related object thing.save() # will also save the child object In order to achieve this, I was thinking of having the BigThing actually add itself ( and it's children ) to the database -- but maybe this not a good idea? One reason to add objects as soon as possible is Automatic id values that are assigned by the database -- the sooner they are available, the fewer problems there are ( right? ) What is the best way to manage session objects? Who is in charge of the session? Should it be created only when required? or saved for a long time? What about Unit Tests for my mapped objects?...how should the session be handled? Is it ever OK to have mapped objects just automatically add themselves to a database? or is that going to lead to trouble?

    Read the article

  • Making all variables accessible to namespace

    - by Gökhan Sever
    Hello, Say I have a simple function: def myfunc(): a = 4.2 b = 5.5 ... many similar variables ... I use this function one time only and I am wondering what is the easiest way to make all the variables inside the function accessible to my main name-space. Do I have to declare global for each item? or any other suggested methods? Thanks.

    Read the article

  • how can i set the key 'blob-key' about BlobStore?

    - by pyleaf
    I use the jquery plugin "uploadify" to upload multiple files to My App(GAE), and then save them with blobstore, but it failed. I debug the code into get_uploads, it seems field.type_options is empty and of course has 'blob-key'. Q: where does the key 'blob-key' come from? thank you!

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • Estimating the boundary of arbitrarily distributed data

    - by Dave
    I have two dimensional discrete spatial data. I would like to make an approximation of the spatial boundaries of this data so that I can produce a plot with another dataset on top of it. Ideally, this would be an ordered set of (x,y) points that matplotlib can plot with the plt.Polygon() patch. My initial attempt is very inelegant: I place a fine grid over the data, and where data is found in a cell, a square matplotlib patch is created of that cell. The resolution of the boundary thus depends on the sampling frequency of the grid. Here is an example, where the grey region are the cells containing data, black where no data exists. OK, problem solved - why am I still here? Well.... I'd like a more "elegant" solution, or at least one that is faster (ie. I don't want to get on with "real" work, I'd like to have some fun with this!). The best way I can think of is a ray-tracing approach - eg: from xmin to xmax, at y=ymin, check if data boundary crossed in intervals dx y=ymin+dy, do 1 do 1-2, but now sample in y An alternative is defining a centre, and sampling in r-theta space - ie radial spokes in dtheta increments. Both would produce a set of (x,y) points, but then how do I order/link neighbouring points them to create the boundary? A nearest neighbour approach is not appropriate as, for example (to borrow from Geography), an isthmus (think of Panama connecting N&S America) could then close off and isolate regions. This also might not deal very well with the holes seen in the data, which I would like to represent as a different plt.Polygon. The solution perhaps comes from solving an area maximisation problem. For a set of points defining the data limits, what is the maximum contiguous area contained within those points To form the enclosed area, what are the neighbouring points for the nth point? How will the holes be treated in this scheme - is this erring into topology now? Apologies, much of this is me thinking out loud. I'd be grateful for some hints, suggestions or solutions. I suspect this is an oft-studied problem with many solution techniques, but I'm looking for something simple to code and quick to run... I guess everyone is, really! Cheers, David

    Read the article

  • methods of metaclasses on class instances.

    - by Stefano Borini
    I was wondering what happens to methods declared on a metaclass. I expected that if you declare a method on a metaclass, it will end up being a classmethod, however, the behavior is different. Example >>> class A(object): ... @classmethod ... def foo(cls): ... print "foo" ... >>> a=A() >>> a.foo() foo >>> A.foo() foo However, if I try to define a metaclass and give it a method foo, it seems to work the same for the class, not for the instance. >>> class Meta(type): ... def foo(self): ... print "foo" ... >>> class A(object): ... __metaclass__=Meta ... def __init__(self): ... print "hello" ... >>> >>> a=A() hello >>> A.foo() foo >>> a.foo() Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'A' object has no attribute 'foo' What's going on here exactly ? edit: bumping the question

    Read the article

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • Union on ValuesQuerySet in django

    - by Wuxab
    I've been searching for a way to take the union of querysets in django. From what I read you can use query1 | query2 to take the union... This doesn't seem to work when using values() though. I'd skip using values until after taking the union but I need to use annotate to take the sum of a field and filter on it and since there's no way to do "group by" I have to use values(). The other suggestions I read were to use Q objects but I can't think of a way that would work. Do I pretty much need to just use straight SQL or is there a django way of doing this? What I want is: q1 = mymodel.objects.filter(date__lt = '2010-06-11').values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) q2 = mymodel.objects.values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) query = q1|q2 But this doesn't work and as far as I know I need the "values" part because there's no other way for Sum to know how to act since it's a 15 column table.

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • has any tools easy to download or uploaed data from gae ..

    - by zjm1126
    i find this: http://aralbalkan.com/1784 but it is : Gaebar is an easy-to-use, standalone Django application that you can plug in to your existing Google App Engine Django or app-engine-patch-based Django applications on Google App Engine to give them datastore backup and restore functionality. my app is not based on django,so did you know any tools esay to do this . thanks

    Read the article

  • How to separate comma separeted data from csv file?

    - by Rahul
    I have opened a csv file and I want to sort each string which is comma separeted and are in same line: ex:: file : name,sal,dept tom,10000,it o/p :: each string in string variable I have a file which is already open, so I can not use "open" API, I have to use "csv.reader" which have to read one line at a time.

    Read the article

  • beautifulsoup can't find exist href in file

    - by young001
    I have a html file like following: <form action="/2811457/follow?gsid=3_5bce9b871484d3af90c89f37" method="post"> <div> <a href="/2811457/follow?page=2&amp;gsid=3_5bce9b871484d3af90c89f37">next_page</a> &nbsp;<input name="mp" type="hidden" value="3" /> <input type="text" name="page" size="2" style='-wap-input-format: "*N"' /> <input type="submit" value="jump" />&nbsp;1/3 </div> </form> how to extract the "1/3" from the file? It is a part of html,I intend to make it clear. When I use beautifulsoup, I'm new to beautifulsoup,and I have look the document,but still confused. how to extract"1/3" from the html file? total_urls_num = soup.find(re.compile('.*/d\//d.*')) doesn't work As JBernardo said,\d should be a number,When I change to .*\d/\d.*,it doesn't work too. my code: from BeautifulSoup import BeautifulSoup import re with open("html.txt","r") as f: response = f.read() print response soup = BeautifulSoup(response) delete_urls = soup.findAll('a', href=re.compile('follow\?page')) #works print delete_urls #total_urls_num = soup.find(re.compile('.*\d/\d.*')) total_urls_num = soup.find('input',style='submit') #can't work print total_urls_num

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • Validating key/certificate pairs with M2Crypto when a certificate chain is needed

    - by Charles Duffy
    M2Crypto.X509.X509 objects have a verify(pkey) method, which provide a means of testing that a given certificate does in fact sign a specified key. This is a good and useful thing -- except that sometimes the certificate I want to verify in this way is invalid without the use of an intermediate certificate, which this API does not appear to allow a way to specify. Is there an alternate means of validating a certificate / private key pair which will work even when the certificate is unable to stand alone?

    Read the article

< Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >