Search Results

Search found 13539 results on 542 pages for 'python gtkmozembed'.

Page 373/542 | < Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >

  • how can i set the key 'blob-key' about BlobStore?

    - by pyleaf
    I use the jquery plugin "uploadify" to upload multiple files to My App(GAE), and then save them with blobstore, but it failed. I debug the code into get_uploads, it seems field.type_options is empty and of course has 'blob-key'. Q: where does the key 'blob-key' come from? thank you!

    Read the article

  • How to convert string "0671" or "0x45" into integer form with 0 and 0x in the beginning.

    - by Harshit Sharma
    I wanted to make my own encryption algorithm and decryption algorithm , encryption algorithm works fine and converts ascii value of the characters into alternate hexadecimal and octal representations. But when I tried decryption, problem occured as it return int('0671') = 671, as 0671 is string type in the following code. Is there a method to convert "ox56" into integer form?????? NOTE: Following string is alternate octal and hexa of ascii value of char. ///////////////DECRYPTION/////// l="01630x7401620x6901560x67" f=len(l) k=0 d=0 x=[] for i in range(0,f,4): g=l[i:i+4] print g k=k+1 if(k%2==0): p=g print p else: p=int(g) print p

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Looping through a directory on the web and displaying its contents (files and other directories) via

    - by al jaffe
    In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

    Read the article

  • How to set a __str__ method for all ctype Structure classes?

    - by Reuben Thomas
    [Since asking this question, I've found: http://www.cs.unc.edu/~gb/blog/2007/02/11/ctypes-tricks/ which gives a good answer.] I just wrote a __str__ method for a ctype-generated Structure class 'foo' thus: def foo_to_str(self): s = [] for i in foo._fields_: s.append('{}: {}'.format(i[0], foo.\_\_getattribute__(self, i[0]))) return '\n'.join(s) foo.\_\_str__ = foo_to_str But this is a fairly natural way to produce a __str__ method for any Structure class. How can I add this method directly to the Structure class, so that all Structure classes generated by ctypes get it? (I am using the h2xml and xml2py scripts to auto-generate ctypes code, and this offers no obvious way to change the names of the classes output, so simply subclassing Structure, Union &c. and adding my __str__ method there would involve post-processing the output of xml2py.)

    Read the article

  • Union on ValuesQuerySet in django

    - by Wuxab
    I've been searching for a way to take the union of querysets in django. From what I read you can use query1 | query2 to take the union... This doesn't seem to work when using values() though. I'd skip using values until after taking the union but I need to use annotate to take the sum of a field and filter on it and since there's no way to do "group by" I have to use values(). The other suggestions I read were to use Q objects but I can't think of a way that would work. Do I pretty much need to just use straight SQL or is there a django way of doing this? What I want is: q1 = mymodel.objects.filter(date__lt = '2010-06-11').values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) q2 = mymodel.objects.values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) query = q1|q2 But this doesn't work and as far as I know I need the "values" part because there's no other way for Sum to know how to act since it's a 15 column table.

    Read the article

  • SQLAlchemy: who is in charge of the "session"? ( and how to unit-test with sessions )

    - by Nick Perkins
    I need some guidance on how to use session objects with SQLAlchemy, and how to organize Unit Tests of my mapped objects. What I would like to able to do is something like this: thing = BigThing() # mapped object child = thing.new_child() # create and return a related object thing.save() # will also save the child object In order to achieve this, I was thinking of having the BigThing actually add itself ( and it's children ) to the database -- but maybe this not a good idea? One reason to add objects as soon as possible is Automatic id values that are assigned by the database -- the sooner they are available, the fewer problems there are ( right? ) What is the best way to manage session objects? Who is in charge of the session? Should it be created only when required? or saved for a long time? What about Unit Tests for my mapped objects?...how should the session be handled? Is it ever OK to have mapped objects just automatically add themselves to a database? or is that going to lead to trouble?

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • How to separate comma separeted data from csv file?

    - by Rahul
    I have opened a csv file and I want to sort each string which is comma separeted and are in same line: ex:: file : name,sal,dept tom,10000,it o/p :: each string in string variable I have a file which is already open, so I can not use "open" API, I have to use "csv.reader" which have to read one line at a time.

    Read the article

  • Iterate with binary structure over numpy array to get cell sums

    - by Curlew
    In the package scipy there is the function to define a binary structure (such as a taxicab (2,1) or a chessboard (2,2)). import numpy from scipy import ndimage a = numpy.zeros((6,6), dtype=numpy.int) a[1:5, 1:5] = 1;a[3,3] = 0 ; a[2,2] = 2 s = ndimage.generate_binary_structure(2,2) # Binary structure #.... Calculate Sum of result_array = numpy.zeros_like(a) What i want is to iterate over all cells of this array with the given structure s. Then i want to append a function to the current cell value indexed in a empty array (example function sum), which uses the values of all cells in the binary structure. For example: array([[0, 0, 0, 0, 0, 0], [0, 1, 1, 1, 1, 0], [0, 1, 2, 1, 1, 0], [0, 1, 1, 0, 1, 0], [0, 1, 1, 1, 1, 0], [0, 0, 0, 0, 0, 0]]) # The array a. The value in cell 1,2 is currently one. Given the structure s and an example function such as sum the value in the resulting array (result_array) becomes 7 (or 6 if the current cell value is excluded). Someone got an idea?

    Read the article

  • Creating a custom widget using django for use on external sites

    - by ajt
    I have a new site that I am putting together and part of it has statistics for the site's users. I would like to create a widget that others can use on another website by invoking javascript that reads data from my server and shows that statistics for a given user, but I am having a hard time finding specific tutorials that covers this in django. I have seen the link at Alex Maradon's site [0], but it looks to me like that is passing html back to the widget and I am having a hard time figuring out how to do this using something like xml. Are there any django apps for doing this or does anyone know of good how-tos? [0] http://alexmarandon.com/articles/web_widget_jquery/

    Read the article

  • Getting unpredictable data into a tabular format

    - by Acorn
    The situation: Each page I scrape has <input> elements with a title= and a value= I don't know what is going to be on the page. I want to have all my collected data in a single table at the end, with a column for each title. So basically, I need each row of data to line up with all the others, and if a row doesn't have a certain element, then it should be blank (but there must be something there to keep the alignment). eg. First page has: {animal: cat, colour: blue, fruit: lemon, day: monday} Second page has: {animal: fish, colour: green, day: saturday} Third page has: {animal: dog, number: 10, colour: yellow, fruit: mango, day: tuesday} Then my resulting table should be: animal | number | colour | fruit | day cat | none | blue | lemon | monday fish | none | green | none | saturday dog | 10 | yellow | mango | tuesday Although it would be good to keep the order of the title value pairs, which I know dictionaries wont do. So basically, I need to generate columns from all the titles (kept in order but somehow merged together) What would be the best way of going about this without knowing all the possible titles and explicitly specifying an order for the values to be put in?

    Read the article

  • Clean Method for a ModelForm in a ModelFormSet made by modelformset_factory

    - by Salyangoz
    I was wondering if my approach is right or not. Assuming the Restaurant model has only a name. forms.py class BaseRestaurantOpinionForm(forms.ModelForm): opinion = forms.ChoiceField(choices=(('yes', 'yes'), ('no', 'no'), ('meh', 'meh')), required=False, )) class Meta: model = Restaurant fields = ['opinion'] views.py class RestaurantVoteListView(ListView): queryset = Restaurant.objects.all() template_name = "restaurants/list.html" def dispatch(self, request, *args, **kwargs): if request.POST: queryset = self.request.POST.dict() #clean here return HttpResponse(json.dumps(queryset), content_type="application/json") def get_context_data(self, **kwargs): context = super(EligibleRestaurantsListView, self).get_context_data(**kwargs) RestaurantFormSet = modelformset_factory( Restaurant,form=BaseRestaurantOpinionForm ) extra_context = { 'eligible_restaurants' : self.get_eligible_restaurants(), 'forms' : RestaurantFormSet(), } context.update(extra_context) return context Basically I'll be getting 3 voting buttons for each restaurant and then I want to read the votes. I was wondering from where/which clean function do I need to call to get something like: { ('3' : 'yes'), ('2' : 'no') } #{ 'restaurant_id' : 'vote' } This is my second/third question so tell me if I'm being unclear. Thanks.

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • Parsing html for domain links

    - by Hallik
    I have a script that parses an html page for all the links within it. I am getting all of them fine, but I have a list of domains I want to compare it against. So a sample list contains list=['www.domain.com', 'sub.domain.com'] But I may have a list of links that look like http://domain.com http://sub.domain.com/some/other/page I can strip off the http:// just fine, but in the two example links I just posted, they both should match. The first I would like to match against the www.domain.com, and the second, I would like to match against the subdomain in the list. Right now I am using url2lib for parsing the html. What are my options in completely this task?

    Read the article

  • sqlite3 'database is locked' won't go away with retries

    - by Azarias
    I have a sqlite3 database that is accessed by a few threads (3-4). I am aware of the general limitations of sqlite3 with regards to concurrency as stated http://www.sqlite.org/faq.html#q6 , but I am convinced that is not the problem. All of the threads both read and write from this database. Whenever I do a write, I have the following construct: try: Cursor.execute(q, params) Connection.commit() except sqlite3.IntegrityError: Notify except sqlite3.OperationalError: print sys.exc_info() print("DATABASE LOCKED; sleeping for 3 seconds and trying again") time.sleep(3) Retry On some runs, I won't even hit this block, but when I do, it never comes out of it (keeps retrying, but I keep getting the 'database is locked' error from exc_info. If I understand the reader/writer lock usage correctly, some amount of waiting should help with the contention. What this sounds like is deadlock, but I do not use any transactions in my code, and every SELECT or INSERT is simply a one off. Some threads, however, keep the same connection when they do their operation (which includes a mix of SELECTS and INSERTS and other modifiers). I would appericiate it if you could shade a light on this, and also ways around fixing it (besides using a different database engine.)

    Read the article

  • How do I relate two models/tables in Django based on non primary non unique keys?

    - by wizard
    I've got two tables that I need to relate on a single field po_num. The data is imported from another source so while I have a little bit of control over what the tables look like but I can't change them too much. What I want to do is relate these two models so I can look up one from the other based on the po_num fields. What I really need to do is join the two tables so I can do a where on a count of the related table. I would like to do filter for all Order objects that have 0 related EDI856 objects. I tried adding a foreign key to the Order model and specified the db_column and to_fields as po_num but django didn't like that the fact that Edi856.po_num wasn't unique. Here are the important fields of my current models that let me display but not filter for the data that I want. class Edi856(models.Model): po_num = models.CharField(max_length=90, db_index=True ) class Order(models.Model): po_num = models.CharField(max_length=90, db_index=True) def in_edi(self): '''Has the edi been processed?''' return Edi856.objects.filter(po_num = self.po_num).count() Thanks for taking the time to read about my problem. I'm not sure what to do from here.

    Read the article

< Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >