Search Results

Search found 15449 results on 618 pages for 'python signal'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 376/618 | < Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >

  • Obtaining references to function objects on the execution stack from the frame object?

    - by Marcin
    Given the output of inspect.stack(), is it possible to get the function objects from anywhere from the stack frame and call these? If so, how? (I already know how to get the names of the functions.) Here is what I'm getting at: Let's say I'm a function and I'm trying to determine if my caller is a generator or a regular function? I need to call inspect.isgeneratorfunction() on the function object. And how do you figure out who called you? inspect.stack(), right? So if I can somehow put those together, I'll have the answer to my question. Perhaps there is an easier way to do this?

    Read the article

  • Am I mocking this helper function right in my Django test?

    - by CppLearner
    lib.py from django.core.urlresolvers import reverse def render_reverse(f, kwargs): """ kwargs is a dictionary, usually of the form {'args': [cbid]} """ return reverse(f, **kwargs) tests.py from lib import render_reverse, print_ls class LibTest(unittest.TestCase): def test_render_reverse_is_correct(self): #with patch('webclient.apps.codebundles.lib.reverse') as mock_reverse: with patch('django.core.urlresolvers.reverse') as mock_reverse: from lib import render_reverse mock_f = MagicMock(name='f', return_value='dummy_views') mock_kwargs = MagicMock(name='kwargs',return_value={'args':['123']}) mock_reverse.return_value = '/natrium/cb/details/123' response = render_reverse(mock_f(), mock_kwargs()) self.assertTrue('/natrium/cb/details/' in response) But instead, I get File "/var/lib/graphyte-webclient/graphyte-webenv/lib/python2.6/site-packages/django/core/urlresolvers.py", line 296, in reverse "arguments '%s' not found." % (lookup_view_s, args, kwargs)) NoReverseMatch: Reverse for 'dummy_readfile' with arguments '('123',)' and keyword arguments '{}' not found. Why is it calling reverse instead of my mock_reverse (it is looking up my urls.py!!) The author of Mock library Michael Foord did a video cast here (around 9:17), and in the example he passed the mock object request to the view function index. Furthermore, he patched POll and assigned an expected return value. Isn't that what I am doing here? I patched reverse? Thanks.

    Read the article

  • How to accept localized date format (e.g dd/mm/yy) in a DateField on an admin form ?

    - by tomjerry
    Is it possible to customize a django application to have accept localized date format (e.g dd/mm/yy) in a DateField on an admin form ? I have a model class : class MyModel(models.Model): date = models.DateField("Date") And associated admin class class MyModelAdmin(admin.ModelAdmin): pass On django administration interface, I would like to be able to input a date in following format : dd/mm/yyyy. However, the date field in the admin form expects yyyy-mm-dd. How can I customize things ? Nota bene : I have already specified my custom language code (fr-FR) in settings.py, but it seems to have no effect on this date input matter. Thanks in advance for your answer

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • Simple pygtk and threads example please.

    - by wtzolt
    Hello, Can someone give me a simple example involving threads in this manner, please. Problem with my code is that when I click button One, GUI freezes until its finished. I want buttons to stay responsive when def is being executed. How can i fix that? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "ui.glade" ) dic = { "on_buttonOne" : self.one, "on_buttonTwo" : self.two, } self.wTree.signal_autoconnect( dic ) gtk.main() def sone(self, widget): time.sleep(1) print "1" time.sleep(1) print "2" time.sleep(1) print "3" def stwo(self, widget): time.sleep(1) print "4" time.sleep(1) print "5" time.sleep(1) print "6" do=fun() Pretty please, help me.

    Read the article

  • unit test for proxy checking

    - by zubin71
    Proxy configuration of a machine can be easily fetched using def check_proxy(): import urllib2 http_proxy = urllib2.getproxies().get('http') I need to write a test for the above written function. In order to do that I need to:- Set the system-wide proxy to an invalid URL during the test(sounds like a bad idea). Supply an invalid URL to http_proxy. How can I achieve either of the above?

    Read the article

  • CherryPy and RESTful web api

    - by hyperboreean
    What's the best approach of creating a RESTful web api in CherryPy? I've been looking around for a few days now and nothing seems great. For Django it seems that are lots of tools to do this, but not for CherryPy or I am not aware of them

    Read the article

  • Returning Database Blobs in TurboGears 2.x / FCGI / Lighttpd extremely slow

    - by Tom
    Hey everyone, I am running a TG2 App on lighttpd via flup/fastcgi. We are reading images (~30kb each) from BlobFields in a MySQL database and return those images with a custom mime type via a controller method. Caching these images on the hard disk makes no sense because they change with every request, the only reason we cache these in the DB is that creating these images is quite expensive and the data used to create the images is also present in plain text on the website. Now to the problem itself: When returning such an image, things get extremely slow. The code runs totally fine on paster itself with no visible delay, but as soon as its running via fcgi/lighttpd the described phenomenon happens. I profiled the method of my controller that returns my blob, and the entire method runs in a few miliseconds, but when "return" executes, the entire app hangs for roughly 10 seconds. We could not reproduce the same error with PHP on FCGI. This only seems to happen with Turbogears or Pylons. Here for your consideration the concerned piece of source code: @expose(content_type=CUSTOM_CONTENT_TYPE) def return_img(self, img_id): """ Return a DB persisted image when requested """ img = model.Images.by_id(img_id) #get image from DB response.headers['content-type'] = 'image/png' return img.data # this causes the app to hang for 10 seconds

    Read the article

  • I get a 400 Bad Request error while using django-piston

    - by Cheezo
    Hello, I am trying to use Piston to provide REST support to Django. I have implemented my handlers as per the documentation provided . The problem is that i can "read" and "delete" my resource but i cannot "create" or "update". Each time i hit the relevant api i get a 400 Bad request Error. I have extended the Resource class for csrf by using this commonly available code snippet: class CsrfExemptResource(Resource): """A Custom Resource that is csrf exempt""" def init(self, handler, authentication=None): super(CsrfExemptResource, self).init(handler, authentication) self.csrf_exempt = getattr(self.handler, 'csrf_exempt', True) My class (code snippet) looks like this: user_resource = CsrfExemptResource(User) class User(BaseHandler): allowed_methods = ('GET', 'POST', 'PUT', 'DELETE') @require_extended def create(self, request): email = request.GET['email'] password = request.GET['password'] phoneNumber = request.GET['phoneNumber'] firstName = request.GET['firstName'] lastName = request.GET['lastName'] self.createNewUser(self, email,password,phoneNumber,firstName,lastName) return rc.CREATED Please let me know how can i get the create method to work using the POST operation?

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • How can I lookup an attribute in any scope by name?

    - by Wai Yip Tung
    How can I lookup an attribute in any scope by name? My first trial is to use globals() and locals(). e.g. >>> def foo(name): ... a=1 ... print globals().get(name), locals().get(name) ... >>> foo('a') None 1 >>> b=1 >>> foo('b') 1 None >>> foo('foo') <function foo at 0x014744B0> None So far so good. However it fails to lookup any built-in names. >>> range <built-in function range> >>> foo('range') None None >>> int <type 'int'> >>> foo('int') None None Any idea on how to lookup built-in attributes?

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • Django: Applying Calculations To A Query Set

    - by TheLizardKing
    I have a QuerySet that I wish to pass to a generic view for pagination: links = Link.objects.annotate(votes=Count('vote')).order_by('-created')[:300] This is my "hot" page which lists my 300 latest submissions (10 pages of 30 links each). I want to now sort this QuerySet by an algorithm that HackerNews uses: (p - 1) / (t + 2)^1.5 p = votes minus submitter's initial vote t = age of submission in hours Now because applying this algorithm over the entire database would be pretty costly I am content with just the last 300 submissions. My site is unlikely to be the next digg/reddit so while scalability is a plus it is required. My question is now how do I iterate over my QuerySet and sort it by the above algorithm? For more information, here are my applicable models: class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Notes: I don't have "downvotes" so just the presence of a Vote row is an indicator of a vote or a particular link by a particular user.

    Read the article

  • Django: Determining if a user has voted or not

    - by TheLizardKing
    I have a long list of links that I spit out using the below code, total votes, submitted by, the usual stuff but I am not 100% on how to determine if the currently logged in user has voted on a link or not. I know how to do this from within my view but do I need to alter my below view code or can I make use of the way templates work to determine it? I have read http://stackoverflow.com/questions/1528583/django-vote-up-down-method but I don't quite understand what's going on ( and don't need any ofjavascriptery). Models (snippet): class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Views (snippet): links = Link.objects.select_related().annotate(votes=Count('vote')).order_by('-created')

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • split twice in the same expression?

    - by UcanDoIt
    Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

    Read the article

  • How to classify NN/NNP/NNS obtained from POS tagged document as a product feature

    - by Shweta .......
    I'm planning to perform sentiment analysis on reviews of product features (collected from Amazon dataset). I have extracted review text from the dataset and performed POS tagging on that. I'm able to extract NN/NNP as well. But my doubt is how do I come to know that extracted words classify as features of the products? I know there are classifiers in nltk but I don't know how I should use it for my project. I'm assuming there are 2 ways of finding whether the extracted word is a product feature or not. One is to compare with a bag of words and find out if my word exists in that. Doubt: How do I create/get bag of words? Second way is to implement some kind of apriori algorithm to find out frequently occurring words as features. I would like to know which method is good and how to go about implementing it. Some pointers to available softwares or code snippets would be helpful! Thanks!

    Read the article

  • redefine __and__ operator

    - by wiso
    Why I can't redefine the __and__ operator? class Cut(object): def __init__(self, cut): self.cut = cut def __and__(self, other): return Cut("(" + self.cut + ") && (" + other.cut + ")") a = Cut("a>0") b = cut("b>0") c = a and b print c.cut() I want (a>0) && (b>0), but I got b, that the usual behaviour of and

    Read the article

  • How to make scipy.interpolate give a an extrapolated result beyond the input range?

    - by Salim Fadhley
    I'm trying to port a program which uses a hand-rolled interpolator (developed by a mathematitian colleage) over to use the interpolators provided by scipy. I'd like to use or wrap the scipy interpolator so that it has as close as possible behavior to the old interpolator. A key difference between the two functions is that in our original interpolator - if the input value is above or below the input range, our original interpolator will extrapolate the result. If you try this with the scipy interpolator it raises a ValueError. Consider this program as an example: import numpy as np from scipy import interpolate x = np.arange(0,10) y = np.exp(-x/3.0) f = interpolate.interp1d(x, y) print f(9) print f(11) # Causes ValueError, because it's greater than max(x) Is there a sensible way to make it so that instead of crashing, the final line will simply do a linear extrapolate, continuing the gradients defined by the first and last two pouints to infinity. Note, that in the real software I'm not actually using the exp function - that's here for illustration only!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >