Search Results

Search found 32397 results on 1296 pages for 'reference program'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 376/1296 | < Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >

  • convert flv to mp3 with Java

    - by krial
    Hi, I'm pretty new in developing programs in Java. I'm currently writing a program that converts a flv video into mp3. I have already written such a program in Visual Studio.net C#, but the Problem is, that it isn't cross platform compatible... I used the ffmpeg binary to convert the video into mp3, but I can't find ffmpeg binaries for Mac and Linux. (if so, I could start the specific binaries from java, depending on the OS) So I tried to convert the video with Xuggle, but the final mp3 has 0 bytes. My current code is the following: IMediaReader reader = ToolFactory.makeReader("video.flv"); reader.addListener(ToolFactory.makeWriter("music.mp3", reader)); while (reader.readPacket() == null) do {} while(false); Thanks in advance. p.s sorry for my bad english

    Read the article

  • how to develop php on apache server

    - by user238284
    I am trying to make php to work with Apache. . i surfed for the procedures and finally i was asked to do the below mentioned operation .. but i am unable to understand it can anyone please help me .I am using Windows XP. # Add the following 3 lines to your httpd.conf file. You can put them anywhere in the file but maybe it makes sense to put them after the other LoadModule section. LoadModule php5_module "d:/Program Files/php/php5apache2_2.dll" AddType application/x-httpd-php .php PHPIniDir "D:\Program Files\php" Is there any other link which helps to install PHP,Apache and MySql. Please help me. Thank you in advance

    Read the article

  • How To Parse String File Txt Into Array With C++

    - by Ibnu Syuhada
    I am trying to write a C++ program, but I am not familiar with C++. I have a .txt file, which contains values as follows: 0 0.0146484 0.0292969 0.0439453 0.0585938 0.0732422 0.0878906 What I have done in my C++ code is as follows: #include <iostream> #include <fstream> using namespace std; int main() { string line; ifstream myReadFile; myReadFile.open("Qi.txt"); if(myReadFile.is_open()) { while(myReadFile.good()) { getline(myReadFile,line); cout << line << endl; } myReadFile.close(); } return 0; } I would like to make the output of the program an array, i.e. line[0] = 0 line[1] = 0.0146484 line[2] = 0.0292969 line[3] = 0.0439453 line[4] = 0.0585938 line[5] = 0.0732422 line[6] = 0.0878906

    Read the article

  • What's this UI pattern called?

    - by Bears will eat you
    I'm trying to figure out what this sort of thing is called, and eventually how I can create one in a web browser. It looks like this (screenshot of the first app that came to mind): The specific component/pattern I'm looking for is the two list boxes ("Included Gear" and "Excluded Gear") that represent inclusion/exclusion of items from a set. I'm not really looking for the WPF name (if there is one) but it might be helpful. I am looking for the name of this thingy, if there is one, and if you really want to make my day, you can point me toward a jQuery or YUI way of making one of these dealies in a browser. In case you were wondering, the screenshot is a World of Warcraft gear optimization program. Go figure why it was the first program that came to mind when I was trying to think of an example.

    Read the article

  • soft stoppped working

    - by Jack Morton
    this is might be really weird, but I have no idea what kinda wizardry of this. Basically, my Visual Studio stopped responding to my changes, it stopped building solution. I can comment code, which would completely ruin the logic of program, and Visual Studio will still run program that I guess it has in memory. It's really annoying, and I have no idea what it is. I keep restarting software, but it's still does the same. It's a licensed software. I was wondering If someone knew what was going on. Thanks!

    Read the article

  • Making commercial Java software

    - by roddik
    Hi. I intend to make some software to be sold over internet. I've only created open-source before, so I have really no idea of how to protect it from being cracked and distributed as warez. Bearing in mind that I know like two programms that aren't either cracked or not really useful I decided that the only more or less reliable way may look like this: Connect to a server and provide licensing info and some sort of hardware summary info If everything is fine, the server returns some crucial missing parts of the program bound to that certain pc along with the usage limit of say 2 days That crucial stuff is not saved to hard drive, so it is downloaded every time the program starts, if the programm runs more than 2 days, data is downloaded again If the same info is used from different computers, suspend the customer account What do you think about this? It may seem a bit to restrictive, but I'd better make less sales at first then eventually see my precious killer app downloaded for free. Anyways, first I need some basic theory/tutorials/guides about how to ensure that user only uses a certain Java app if he has paid for it, so please suggest some. Thanks

    Read the article

  • Ruby on Rails: Modules vs. Classes

    - by Jack
    I'm trying to add a function that will be accessible throughout all parts of my program. I want something like: def GlobalFunctions.my_function(x,y) puts x + y end to be accessible for all models. Specifically I am trying to use a function like this in my seeds.rb file but I am most likely going to be reusing the code and don't want any redundancy. Now I know I can make a simple class, but I could also make a module. What are some reasons to go in either direction? And once I've decided on which type to use, how do I make it accessible throughout the whole program? I have tried a module, but I keep getting " Expected app/[module file] to define [ModuleName]"

    Read the article

  • Force to reimplement a static function in inherit classes

    - by pacopepe
    Hi, I have a program in C++ with plugins (dynamic libs). In the main program, I want to execute a static function to check if i can create a object of this type. An example without dynamic libs (aren't neccesary to understand the problem): #include "libs/parent.h" #include "libs/one.h" #include "libs/two.h" int main(int argc, char * argv[]) { Parent obj; if (One.match(argv[1])) { obj = new One(); else if (Two.match(argv[1])) { obj = new Two(); } Now, i have a interface class named Parent. All plugins inherit from this class. Ideally, I have a virtual static function in Parent named match, and all the plugins need to reimplement this function. The problem with this code is that i can't do a static virtual function in C++, so i don't know how to solve the problem. Sorry for mi english, i did my best

    Read the article

  • how to find which libraries to link to? or, how can I create *-config (such as sdl-config, llvm-con

    - by numeric
    Hey, I want to write a program that outputs a list of libraries that I should link to given source code (or object) files (for C or C++ programs). In *nix, there are useful tools such as sdl-config and llvm-config. But, I want my program to work on Windows, too. Usage: get-library-names -l /path/to/lib a.cpp b.cpp c.cpp d.obj Then, get-library-names would get a list of function names that are invoked from a.cpp, b.cpp, c.cpp, and d.obj. And, it'll search all library files in /path/to/lib directory and list libraries that are needed to link properly. Is there such tool already written? Is it not trivial to write a such tool? How do you find what libraries you should link to? Thanks.

    Read the article

  • Call external library from PHP. What is faster: exec or extension?

    - by robusta
    Hi, I need to make calls from webpage to external library written in C++ and display the result. Platform is Linux, Apache, PHP. My current idea is to use PHP service which will call my library/program. I found that there are two possible ways to do this: 1) use PHP 'exec' function 2) write PHP extension I am curious what works more effective? Faster? Less load the server? I will probably need to do 4 calls per second, so I want to be as optimal as possible. P.S. If you are aware of some other (more effective) way of calling C++ library or program from webpage, please let me know. Thanks a lot, Robusta

    Read the article

  • C#, working with files, "Unauthorized Access"?

    - by Rob
    Hi, I'm learning about opening and saving files with C# and it seems that vista won't let my program save to a file on the root of C:\ , unless I run it in administrator mode. Any ideas how to allow my program to play around with whatever files it wants? Thanks! string name; private void button2_Click(object sender, EventArgs e) ///// OPEN ///// { if (openFileDialog1.ShowDialog() == DialogResult.OK) { name = openFileDialog1.FileName; textBox1.Clear(); textBox1.Text = File.ReadAllText(name); textBox2.Text = name; } } private void button1_Click(object sender, EventArgs e) ///// SAVE ///// { File.WriteAllText(name, textBox1.Text); }

    Read the article

  • unittest in python: ignore an import from the code I want to test

    - by vaidab
    I have a python program that imports pythoncom (and uses pythoncom.CoCreateInstance from it). I want to create a unittest for the program logic without it importing pythoncom (so I can run the test on Linux as well). What options are there? Can I do it without modifying the system under test? What I found so far: sys.modules["pythoncom"] = "test" import module_that_imports_pythoncom My problem with it is if I have: from pythoncom.something import something I'll get: ImportError: No module named something.something And sys.modules["something.something"] or sys.modules["pythoncom.something.something"] doesn't work. Any ideas?

    Read the article

  • Getting local My Documents folder path

    - by smsrecv
    In my C++/WinAPI application I get the My Documents folder path using this code: wchar_t path[MAX_PATH]; SHGetFolderPathW(NULL,CSIDL_PERSONAL,NULL,SHGFP_TYPE_CURRENT,path); One of the users runs my program on a pc connected to his corporate network. He has the My Documents folder on a network. So my code returns something like \paq\user.name$\My Documents Though he says he has a local copy of My Documents. The problem is that when he 'swaps VPN', the online My Documents becomes unavailable and my program crashes with the system error code 64 "The specified network name is no longer available" ( it tries to write to the file opened in the online my docs folder). How can I always get the local My Documents folder path using C++/WinAPI?

    Read the article

  • C# Console Application Output to .csv file

    - by Zinn
    I am trying to make a program that will show the numbers: 1, 10 +30 2, 40 (the scale goes up in this pattern by adding 20 to the last number added) 3, 90 +50 4, 160 5, 250 +70 So far I have this code: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO;// namespace Myloop { class Program { static void Main(string[] args) /// </summary> { StreamWriter myOutputStream = new StreamWriter("loopdata.csv"); int forloop; for (forloop = 1; forloop < 21; forloop++) Console.WriteLine(forloop); Console.ReadLine(); myOutputStream.Close(); } } } This is showing the first sequence of numbers 1 - 20, but could anyone give me any guidance how to do the other sequence next to it in the console application and how I can output these to a .csv file, as the information I have so far doesn't appear in the .csv file

    Read the article

  • Count Clicks in excel

    - by rockbala
    Hi, Can some one recommend any free program which counts the number of clicks Clicked inside a cell. For Example Imagine something like Spreadsheet I click on A1 cell the value shows 1 Then I click A1 cell again the value shows 2 and so on If I click A3 cell somewhere in between the click count on Cell A3 shows 1 and so on If something like this can be achieved as a macro with in excel (2003 please) please suggest or any other free program that you might be aware about, please do let me know. I appreciate all your help and thank you in advance. rockbala

    Read the article

  • Highest value datatype can store in c#

    - by user472832
    I am writing a small program for my assignment to find the primitive roots of a prime number. So far, the program works for smaller prime numbers till 13 and gives correct number of roots. But for higher primes numbers, it is showing only fewer primitive roots. And now i got stuck for the prime number 41, shows no primitive roots for it. I used DOUBLE datatype for the calculation, and again tried with the datatype DECIMAL, but no luck. Does anyone know about this kind of problem??? Thank you.

    Read the article

  • Execute a line in a text file

    - by apophis
    Hi I have a program that reads text files filled with code designed to be executed line by line by the program, like a script file. The problem is that I don't no how to do the line executing part. Here is my code, I thought using the \r would fool the console. But it just shows me a list of lines in the file. if (tok[0] == "read" && length == 2) { try { StreamReader tr = new StreamReader(@"C:\Users\Public\"+tok[1]+".txt"); while (!tr.EndOfStream) { Console.WriteLine(tr.ReadLine()); } } catch { Console.WriteLine("No such text file.\n"); } Prompt(); If I knew what to search for to fix my problem in Google, I would have. But I've got no idea. Thanks

    Read the article

  • How do you stop Eclipse from inserting a certain class in Content-Assist?

    - by fletchgqc.mp
    I'm using SpringSource Tool Suite (Eclipse) to program with Grails, and I'm also using JFreechart in the program. In Grails you log by typing log.info("method worked"). Unfortunately JFrechart has a class called "Log" with Static methods like "info". This means that in STS I type log.info and then when I type space or ( Eclipse "assists" me by importing the JFreechart Log class and changing what I've typed to Log.info(message). Very irritating. I reckon I could turn off the Eclipse option to "insert single proposals automatically", but I like this feature. Can I instruct Eclipse not to give me content assist from this particular JFreechart class?

    Read the article

  • Python: How to quit CLI when stuck in blocking raw_input?

    - by christianschluchter
    I have a GUI program which should also be controllable via CLI (for monitoring). The CLI is implemented in a while loop using raw_input. If I quit the program via a GUI close button, it hangs in raw_input and does not quit until it gets an input. How can I immediately abort raw_input without entering an input? I run it on WinXP but I want it to be platform independent, it should also work within Eclipse since it is a developer tool. Python version is 2.6. I searched stackoverflow for hours and I know there are many answers to that topic, but is there really no platform independent solution to have a non-blocking CLI reader? If not, what would be the best way to overcome this problem? Thanks

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >