Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 382/548 | < Previous Page | 378 379 380 381 382 383 384 385 386 387 388 389  | Next Page >

  • How to update Geo-Location in fireeagle

    - by Ganesh
    Hi Every One, I am developing an application on fireeagle, there i need to update the users exact location, with out asking any information from the user (i.e) lat, long e.t.c., If it is not possible using yahoo fireeagle, please let me know if there exists any other api's other than yahoo fireeagle. If they can get the exact location of web user in 'Lat' and 'Long', either from 'Pc' or from 'Mobile' browser. Thanks in advance.

    Read the article

  • Tying PyQt4 QAction triggered() to local class callable doesn't seem to work. How to debug this?

    - by Jon Watte
    I create this object when I want to create a QAction. I then add this QAction to a menu: class ActionObject(object): def __init__(self, owner, command): action = QtGui.QAction(command.name, owner) self.action = action self.command = command action.setShortcut(command.shortcut) action.setStatusTip(command.name) QtCore.QObject.connect(action, QtCore.SIGNAL('triggered()'), self.triggered) def triggered(self): print("got triggered " + self.command.id + " " + repr(checked)) Unfortunately, when the menu item is selected, the 'triggered' function is not called. QtCore.QObject.connect() returns True. Nothing is printed on the console to indicate that anything is wrong, and no exception is thrown. How can I debug this? (or, what am I doing wrong?)

    Read the article

  • How do I modify gitstats to only utilize a specified file extension for it's statistics?

    - by Fake Code Monkey Rashid
    Hello good people! The website of the statistics generator in question is: http://gitstats.sourceforge.net/ It's git repo can be cloned from: git clone git://repo.or.cz/gitstats.git What I want to do is something like: ./gitstatus --ext=".py" /input/foo /output/bar Failing being able to easily pass the above option without heavy modification, I'd just hardcore the file extentsion I want to be included. However, I'm unsure of the relevant section of code to modify and even if I did no, I'm unsure of how to start such modifications. It's seems like it'd be rather simple but alas...

    Read the article

  • Can anyone tell me why these lines are not working?

    - by user343934
    I am trying to generate tree with fasta file input and Alignment with MuscleCommandline import sys,os, subprocess from Bio import AlignIO from Bio.Align.Applications import MuscleCommandline cline = MuscleCommandline(input="c:\Python26\opuntia.fasta") child= subprocess.Popen(str(cline), stdout = subprocess.PIPE, stderr=subprocess.PIPE, shell=(sys.platform!="win32")) align=AlignIO.read(child.stdout,"fasta") outfile=open('c:\Python26\opuntia.phy','w') AlignIO.write([align],outfile,'phylip') outfile.close() I always encounter with these problems Traceback (most recent call last): File "", line 244, in run_nodebug File "C:\Python26\muscleIO.py", line 11, in align=AlignIO.read(child.stdout,"fasta") File "C:\Python26\Lib\site-packages\Bio\AlignIO_init_.py", line 423, in read raise ValueError("No records found in handle") ValueError: No records found in handle

    Read the article

  • Append to list of lists

    - by Joel
    Hello, I am trying to build a list of lists using the following code: list=3*[[]] Now I am trying to append a string to the list in position 0: list[0].append("hello") However, instead of receiving the list [ ["hello"] , [], [] ] I am receiving the list: [ ["hello"] ,["hello"] , ["hello"] ] Am I missing something? Thanks, Joel

    Read the article

  • Problem with sys.argv[1] when unittest module is in a script

    - by chrissygormley
    Hello, I have a script that does various things and access paramenters using sys.argv but when the script gets to the unittest part of the code it says there is no module for this. The script that I have is: class MyScript(): def __init__(self): self.value = sys.argv[1] def hello(self): print self.value def suite(self): modules_to_test = ('external_sanity_onvif', 'starttest') alltests = unittest.TestSuite() for module in map(__import__, modules_to_test): alltests.addTest(unittest.findTestCases(module)) return alltests if __name__ == '__main__': Run = MyScript() Run.hello() log_file = 'log_file.txt' test_file = open(log_file, "w") runner = unittest.TextTestRunner(test_file) unittest.main(defaultTest='Run.suite', testRunner=runner) Say I enter ./script.py Hello in the command line. The error I get is: AttributeError: 'module' object has no attribute 'Hello' If I remove the unittest module it works. Also if I remove the testrunner log and leave it at: unittest.main(defaultTest='Run.suite') This still doesn't work. Can anyone help. Thanks

    Read the article

  • Can some explain why this wont draw a circle? It is drawing roughly 3/4?

    - by Brandon Shockley
    If we want to use n small lines to outline our circle then we can just divide both the circumference and 360 degrees by n (i.e , (2*pi*r)/n and 360/n). Did I not do that? import turtle, math window = turtle.Screen() window.bgcolor('blue') body = turtle.Turtle() body.pencolor('black') body.fillcolor('white') body.speed(10) body.width(3) body.hideturtle() body.up() body.goto(0, 200) lines = 40 toprad = 40 top_circum = 2 * math.pi * toprad sol = top_circum / lines circle = 360 / lines for stops in range(lines): body.pendown() body.left(sol) body.forward(circle) window.exitonclick()

    Read the article

  • Django url tag multiple parameters

    - by Overdose
    I have two similar codes. The first one works as expected. urlpatterns = patterns('', (r'^(?P<n1>\d)/test/', test), (r'', test2), {% url testapp.views.test n1=5 %} But adding the second parameter makes the result return empty string. urlpatterns = patterns('', (r'^(?P<n1>\d)/test(?P<n2>\d)/', test), (r'', test2),) {% url testapp.views.test n1=5, n2=2 %} Views signature: def test(request, n1, n2=1):

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How To Run Postgres locally

    - by Rohit Rayudu
    I read the Postgres docs for Flask and they said that to run Postgres you should have the following code app = Flask(__name__) app.config['SQLALCHEMY_DATABASE_URI'] = postgresql://localhost/[YOUR_DB_NAME]' db = SQLAlchemy(app) How do I know my database name? I wrote db as the name - but I got an error sqlalchemy.exc.OperationalError: (OperationalError) FATAL: database "[db]" does not exist Running Heroku with Flask if that helps

    Read the article

  • How do I compare two complex data structures?

    - by Phil H
    I have some nested datastructures, each something like: [ ('foo', [ {'a':1, 'b':2}, {'a':3.3, 'b':7} ]), ('bar', [ {'a':4, 'd':'efg', 'e':False} ]) ] I need to compare these structures, to see if there are any differences. Short of writing a function to explicitly walk the structure, is there an existing library or method of doing this kind of recursive comparison?

    Read the article

  • Can I move beaker.SessionMiddleware to handle method somehow?

    - by Alexander A.Sosnovskiy
    It's a bit ugly that many lines of code fall into "__main__". Can someone give me a tip of how to move SessionMiddleware into handle method? I should notice that I use session in CoreXmlParser. Thanks in advance ! def handle(environ, start_response): req = webob.Request(environ) c = CoreXmlParser(req) resp = webob.Response(body=c(), charset = 'utf-8', status='200 OK', \ request=req, content_type='text/xml') resp(environ, start_response) return resp.app_iter if __name__ == '__main__': #parse config file for session options app = SessionMiddleware(handle, some_session_opts_here) from flup.server.fcgi import WSGIServer WSGIServer(app).run()

    Read the article

  • OpenCV performance in different languages

    - by h0b0
    I'm doing some prototyping with OpenCV for a hobby project involving processing of real time camera data. I wonder if it is worth the effort to reimplement this in C or C++ when I have it all figured out or if no significant performance boost can be expected. The program basically chains OpenCV functions, so the main part of the work should be done in native code anyway.

    Read the article

  • PyQt QAbstractListModel seems to ignore tristate flags

    - by mcieslak
    I've been trying for a couple days to figure out why my QAbstractLisModel won't allow a user to toggle a checkable item in three states. The model returns the Qt.IsTristate and Qt.ItemIsUserCheckable in the flags() method, but when the program runs only Qt.Checked and Qt.Unchecked are toggled on edit. class cboxModel(QtCore.QAbstractListModel): def __init__(self, parent=None): super(cboxModel, self).__init__(parent) self.cboxes = [ ['a',0], ['b',1], ['c',2], ['d',0] ] def rowCount(self,index=QtCore.QModelIndex()): return len(self.cboxes) def data(self,index,role): if not index.isValid: return QtCore.QVariant() myname,mystate = self.cboxes[index.row()] if role == QtCore.Qt.DisplayRole: return QtCore.QVariant(myname) if role == QtCore.Qt.CheckStateRole: if mystate == 0: return QtCore.QVariant(QtCore.Qt.Unchecked) elif mystate == 1: return QtCore.QVariant(QtCore.Qt.PartiallyChecked) elif mystate == 2: return QtCore.QVariant(QtCore.Qt.Checked) return QtCore.QVariant() def setData(self,index,value,role=QtCore.Qt.EditRole): if index.isValid(): self.cboxes[index.row()][1] = value.toInt()[0] self.emit(QtCore.SIGNAL("dataChanged(QModelIndex,QModelIndex)"), index, index) print self.cboxes return True return False def flags(self,index): if not index.isValid(): return QtCore.Qt.ItemIsEditable return QtCore.Qt.ItemIsEnabled | QtCore.Qt.ItemIsEditable | QtCore.Qt.ItemIsUserCheckable | QtCore.Qt.ItemIsTristate You can test it with this, class MainForm(QtGui.QMainWindow): def __init__(self, parent=None): super(MainForm, self).__init__(parent) model = cboxModel(self) self.view = QtGui.QListView() self.view.setModel(model) self.setCentralWidget(self.view) app = QtGui.QApplication(sys.argv) form = MainForm() form.show() app.exec_() and see that only 2 states are available. I'm assuming there's something simple I'm missing. Any ideas? Thanks!

    Read the article

  • Sending file over socket

    - by johannix
    I'm have a problem sending data as a file from one end of a socket to the other. What's happening is that both the server and client are trying to read the file so the file never gets sent. I was wondering how to have the client block until the server's completed reading the file sent from the client. I have this working with raw packets using send and recv, but figured this was a cleaner solution... Client: connects to server creating socket connection creates a file on socket and sends data waits for file from server Server: waits for file from client Complete interraction: client sends data to server server sends data to client

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • PyParsing: Is this correct use of setParseAction()?

    - by Rosarch
    I have strings like this: "MSE 2110, 3030, 4102" I would like to output: [("MSE", 2110), ("MSE", 3030), ("MSE", 4102)] This is my way of going about it, although I haven't quite gotten it yet: def makeCourseList(str, location, tokens): print "before: %s" % tokens for index, course_number in enumerate(tokens[1:]): tokens[index + 1] = (tokens[0][0], course_number) print "after: %s" % tokens course = Group(DEPT_CODE + COURSE_NUMBER) # .setResultsName("Course") course_data = (course + ZeroOrMore(Suppress(',') + COURSE_NUMBER)).setParseAction(makeCourseList) This outputs: >>> course.parseString("CS 2110") ([(['CS', 2110], {})], {}) >>> course_data.parseString("CS 2110, 4301, 2123, 1110") before: [['CS', 2110], 4301, 2123, 1110] after: [['CS', 2110], ('CS', 4301), ('CS', 2123), ('CS', 1110)] ([(['CS', 2110], {}), ('CS', 4301), ('CS', 2123), ('CS', 1110)], {}) Is this the right way to do it, or am I totally off? Also, the output of isn't quite correct - I want course_data to emit a list of course symbols that are in the same format as each other. Right now, the first course is different from the others. (It has a {}, whereas the others don't.)

    Read the article

  • Is there a value in using map() vs for?

    - by roder
    Does map() iterate through the list like "for" would? Is there a value in using map vs for? If so, right now my code looks like this: for item in items: item.my_func() If it makes sense, I would like to make it map(). Is that possible? What is an example like?

    Read the article

  • Updating section in ConfigParser (or an alternative)

    - by lyrae
    I am making a plugin for another program and so I am trying to make thing as lightweight as possible. What i need to do is be able to update the name of a section in the ConfigParser's config file. [project name] author:john doe email: [email protected] year: 2010 I then have text fields where user can edit project's name, author, email and year. I don't think changing [project name] is possible, so I have thought of two solutions: 1 -Have my config file like this: [0] projectname: foobar author:john doe email: [email protected] year: 2010 that way i can change project's name just like another option. But the problem is, i would need the section # to be auto incremented. And to do this i would have to get every section, sort of, and figure out what the next number should be. The other option would be to delete the entire section and its value, and re-add it with the updated values which would require a little more work as well, such as passing a variable that holds the old section name through functions, etc, but i wouldn't mind if it's faster. Which of the two is best? or is there another way? I am willing to go with the fastest/lightweight solution possible, doesn't matter if it requires more work or not.

    Read the article

  • Clean Method for a ModelForm in a ModelFormSet made by modelformset_factory

    - by Salyangoz
    I was wondering if my approach is right or not. Assuming the Restaurant model has only a name. forms.py class BaseRestaurantOpinionForm(forms.ModelForm): opinion = forms.ChoiceField(choices=(('yes', 'yes'), ('no', 'no'), ('meh', 'meh')), required=False, )) class Meta: model = Restaurant fields = ['opinion'] views.py class RestaurantVoteListView(ListView): queryset = Restaurant.objects.all() template_name = "restaurants/list.html" def dispatch(self, request, *args, **kwargs): if request.POST: queryset = self.request.POST.dict() #clean here return HttpResponse(json.dumps(queryset), content_type="application/json") def get_context_data(self, **kwargs): context = super(EligibleRestaurantsListView, self).get_context_data(**kwargs) RestaurantFormSet = modelformset_factory( Restaurant,form=BaseRestaurantOpinionForm ) extra_context = { 'eligible_restaurants' : self.get_eligible_restaurants(), 'forms' : RestaurantFormSet(), } context.update(extra_context) return context Basically I'll be getting 3 voting buttons for each restaurant and then I want to read the votes. I was wondering from where/which clean function do I need to call to get something like: { ('3' : 'yes'), ('2' : 'no') } #{ 'restaurant_id' : 'vote' } This is my second/third question so tell me if I'm being unclear. Thanks.

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 378 379 380 381 382 383 384 385 386 387 388 389  | Next Page >