Search Results

Search found 17448 results on 698 pages for 'regular expressions info'.

Page 383/698 | < Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >

  • Drupal Imagecache Actions with ImageField and Node variables

    - by HS2323
    I am able to add text to onto a imagefield using the imagecache textrender preset action (for a content type). I pull the node title using the following in the imagecache preset text: global $node; return $node->title; However this only works when an image is uploaded when creating new content. If I have an image set as a default for the content type (and none are added when creating the new page) then it won't overlay the node title. I tried just regular text in the preset action field on the default image and it worked. Can anyone help me with this?

    Read the article

  • Using a database/index sequential file independently of the Unix distribution

    - by Helper Method
    What I'm planning to do is a) parse a file for some lines matching a regular expression b) store the match in some sort of database / file so I don't have to do the parsing again and again c) call another program passing the matches as arguments While I can imagine how to do a) and c), I'm a little bit unsure about b). The matches are of the form key:attribute1:attribute2:attribute3 where attribute 2 may be optional. I'm thinking of storing the results in a simple database but the problem is the database needs to available on a number of Unix platform for the program to work. Are there any (simple) databases which can be found on any Unix platforms? Or should I use some sort of index-sequential file?

    Read the article

  • C# Type comparison

    - by Sean.C
    This has me pooped, is there any reason the following: public abstract class aExtension { public abstract bool LoadExtension(Constants c); // method required in inherit public abstract string AppliesToModule // property required in inherit { get; } public abstract string ExtensionName // property required in inherit { get; } public abstract string ExtensionDescription // property required in inherit { get; } } public class UK : aExtension { public override bool LoadExtension(Constants c) { return true; } public override string AppliesToModule { get { return "string"; } } public override string ExtensionName { get { return "string"; } } public override string ExtensionDescription { get { return "string"; } } } would return false for the following expressions: bool a = t.IsAssignableFrom(aExtension)); bool b = t.BaseType.IsAssignableFrom(aExtension)); bool c = typeof(aExtension).IsAssignableFrom(t); bool d = typeof(aExtension).IsAssignableFrom(t.BaseType); bool e = typeof(aExtension).IsSubclassOf(t); bool f = typeof(aExtension).IsSubclassOf(t.BaseType); bool g = t.IsSubclassOf(typeof(aExtension)); bool h = t.BaseType.IsSubclassOf(typeof(LBT.AdMeter.aExtension)); bool i = t.BaseType.Equals(typeof(aExtension)); bool j = typeof(aExtension).Equals(t.BaseType); T is the reflected Type from the calss UK. Stange thing is i do the exact same thing just on an external assembly in the same application and it works as expected...

    Read the article

  • richtextbox font

    - by habbo95
    hi.... I want to change the font color and size for 1 line in richTextBox enter code here String [] Words = {"hi","hello","11111","he","she"}; richTextBox1.SelectionFont = new Font("Verdana", 10, FontStyle.Regular); richTextBox1.SelectionColor = Color.Blue; richTextBox1.SelectedText += Environment.NewLine + wo[0]; richTextBox1.SelectedText += Environment.NewLine + wo[1]; richTextBox1.SelectedText += Environment.NewLine + wo[2]; richTextBox1.SelectedText += Environment.NewLine + wo[3]; richTextBox1.SelectedText += Environment.NewLine + wo[4]; I want to change just the string "11111" and keep the rest lines as default any help

    Read the article

  • Why is Scala's type inferencer not able to resolve this?

    - by Levi Greenspan
    In the code snippet below - why do I have to give a type annotation for Nil? Welcome to Scala version 2.8.0.RC2 (OpenJDK Server VM, Java 1.6.0_18). Type in expressions to have them evaluated. Type :help for more information. scala> List(Some(1), Some(2), Some(3), None).foldLeft(Nil)((lst, o) => o match { case Some(i) => i::lst; case None => lst }) <console>:6: error: type mismatch; found : List[Int] required: object Nil List(Some(1), Some(2), Some(3), None).foldLeft(Nil)((lst, o) => o match { case Some(i) => i::lst; case None => lst }) ^ scala> List(Some(1), Some(2), Some(3), None).foldLeft(Nil:List[Int])((lst, o) => o match { case Some(i) => i::lst; case None => lst }) res1: List[Int] = List(3, 2, 1)

    Read the article

  • PHP editors for Ubuntu

    - by mepo
    What are the Light weight PHP editors available for ubuntu? And is there a ubuntu version of the Notepad++ editor. For those who haven't used Notepad++, do not confuse it with Notepad.exe. Notepad.exe is the lightweight Windows editor by Microsoft. Notepad++ is an Open Source programmer's text editor for Windows based on SciTE. It has syntax highlighting, code collapsing, language recognition, macro recording, regular expression search and replace across line breaks and in files on disk, copy filenames and paths to clipboard, and many other advance text editing tools. Only the more full-featured editors for Linux would be likely to be suitable replacements for Notepad++. Thanks

    Read the article

  • actionscript find and convert text to url

    - by gravesit
    I have this script that grabs a twitter feed and displays in a little widget. What I want to do is look at the text for a url and convert that url to a link. public class Main extends MovieClip { private var twitterXML:XML; // This holds the xml data public function Main() { // This is Untold Entertainment's Twitter id. Did you grab yours? var myTwitterID= "username"; // Fire the loadTwitterXML method, passing it the url to your Twitter info: loadTwitterXML("http://twitter.com/statuses/user_timeline/" + myTwitterID + ".xml"); } private function loadTwitterXML(URL:String):void { var urlLoader:URLLoader = new URLLoader(); // When all the junk has been pulled in from the url, we'll fire finishedLoadingXML: urlLoader.addEventListener(Event.COMPLETE, finishLoadingXML); urlLoader.load(new URLRequest(URL)); } private function finishLoadingXML(e:Event = null):void { // All the junk has been pulled in from the xml! Hooray! // Remove the eventListener as a bit of housecleaning: e.target.removeEventListener(Event.COMPLETE, finishLoadingXML); // Populate the xml object with the xml data: twitterXML = new XML(e.target.data); showTwitterStatus(); } private function addTextToField(text:String,field:TextField):void{ /*Regular expressions for replacement, g: replace all, i: no lower/upper case difference Finds all strings starting with "http://", followed by any number of characters niether space nor new line.*/ var reg:RegExp=/(\b(https?|ftp|file):\/\/[-A-Z0-9+&@#\/%?=~_|!:,.;]*[-A-Z0-9+&@#\/%=~_|])/ig; //Replaces Note: "$&" stands for the replaced string. text.replace(reg,"<a href=\"$&\">$&</a>"); field.htmlText=text; } private function showTwitterStatus():void { // Uncomment this line if you want to see all the fun stuff Twitter sends you: //trace(twitterXML); // Prep the text field to hold our latest Twitter update: twitter_txt.wordWrap = true; twitter_txt.autoSize = TextFieldAutoSize.LEFT; // Populate the text field with the first element in the status.text nodes: addTextToField(twitterXML.status.text[0], twitter_txt); }

    Read the article

  • Are there design-time watch windows for Visual Studio 2008/2010?

    - by Jeff
    There are many times when I need to test a little snippet of .net code but rebuilding and publishing the entire project or writing a suite of unit tests just seems like overkill. For example, I am writing a regular expression right now and I want to see if it the pattern is matching on the right parts. I could go and find a million other utilities that do that sort of thing, but that is not exactly my point. FireBug has an exact analogue to what I want - the FireBug console. There is a text box where the user can enter some JavaScript and FireBug will execute it on the spot and display the return value. I would love to be able to enter something like (new Regex("b+")).Replace("abc", "x") and see the results without having to do all the overhead. Does VS have anything like this?

    Read the article

  • open window with dynamic content

    - by julio
    Is it possible to open a window from PHP that has predefined content? It's obvious how you can open a window from a javascript link that frames an existing page, or just do a target=_blank from a regular a tag that references an existing page. But I am generating a bit of content, and want that content to be opened in a new link (or streamed to the viewer)-- something like (clearly psuedo code!): $content = "Hello World. <br />Nice to meet you!"; <a href="#" target="_blank" content=$content>Open up!</a> Is this possible? Thanks!

    Read the article

  • boost test case for function taking user input

    - by oadams
    I have a function that takes in user input via std::cin: std::getline(std::cin, in); and creates a corresponding data structure by matching it with a regular expression. The function then returns this data structure. I'm using boost.test and I want to create a unit test to check that the output data type is correct given some inputs. However I don't know how to go about it since the input isn't passed as an argument to the function. EDIT: Is there a simple way to create a boost test case that feeds the function a string via standard input?

    Read the article

  • How to publish to Facebook fan/business pages (not user profiles)

    - by Jeff Putz
    I'm trying to figure out if fan/business pages are conceptually similar to regular user pages. My end goal is to publish events from a third-party Web site (new content, announcements, etc.) into the FB page that promotes the third-party site. I'm not sure where to start exactly. Been looking at the .NET Facebook SDK, and it seems focused on FB apps and authentication. Not sure where I should be looking. Help is appreciated!

    Read the article

  • How can I test if an input field contains foreign characters?

    - by zeckdude
    I have an input field in a form. Upon pushing submit, I want to validate to make sure the user entered non-latin characters only, so any foreign language characters, like Chinese among many others. Or at the very least test to make sure it does not contain any latin characters. Could I use a regular expression for this? What would be the best approach for this? I am validating in both javaScript and in PHP. What solutions can I use to check for foreign characters in the input field in both programming languages?

    Read the article

  • Prevent RegEx Hang on Large Matches...

    - by developerjay
    This is a great regular expression for dates... However it hangs indefinitely on this one page I tried... I wanted to try this page ( http://pleac.sourceforge.net/pleac%5Fpython/datesandtimes.html ) for the fact that it does have lots of dates on it and I want to grab all of them. I don't understand why it is hanging when it doesn't on other pages... Why is my regexp hanging and/or how could I clean it up to make it better/efficient ? Python Code: monthnames = "(?:Jan\w*|Feb\w*|Mar\w*|Apr\w*|May|Jun\w?|Jul\w?|Aug\w*|Sep\w*|Oct\w*|Nov(?:ember)?|Dec\w*)" pattern1 = re.compile(r"(\d{1,4}[\/\\\-]+\d{1,2}[\/\\\-]+\d{2,4})") pattern4 = re.compile(r"(?:[\d]*[\,\.\ \-]+)*%s(?:[\,\.\ \-]+[\d]+[stndrh]*)+[:\d]*[\ ]?(PM)?(AM)?([\ \-\+\d]{4,7}|[UTCESTGMT\ ]{2,4})*"%monthnames, re.I) patterns = [pattern4, pattern1] for pattern in patterns: print re.findall(pattern, s) btw... when i say im trying it against this site.. I'm trying it against the webpage source.

    Read the article

  • PHP reg expr. replace ALL URLs except img src URLs

    - by zilveer
    Hi, I have searched but havent been able to find my answer. It follows like: I would like to replace all URL in a string to links except the URLs within img src tag. I have a regular expression for replacing all the URLs to links, but would like it to NOT replace the URLs within img src="" attribute. How can i do this? Here is the code for replacing all URLs: /*** make sure there is an http:// on all URLs ***/ $str = preg_replace("/([^\w\/])(www\.[a-z0-9\-]+\.[a-z0-9\-]+)/i", "$1http://$2",$str); /*** make all URLs links ***/ $str = preg_replace("/([\w]+:\/\/[\w-?&;#~=\.\/\@]+[\w\/])/i","<a target=\"_blank\" href=\"$1\">$1</a>",$str); /Regards

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • boost::function & boost::lambda - call site invocation & accessing _1 and _2 as the type

    - by John Dibling
    Sorry for the confusing title. Let me explain via code: #include <string> #include <boost\function.hpp> #include <boost\lambda\lambda.hpp> #include <iostream> int main() { using namespace boost::lambda; boost::function<std::string(std::string, std::string)> f = _1.append(_2); std::string s = f("Hello", "There"); std::cout << s; return 0; } I'm trying to use function to create a function that uses the labda expressions to create a new return value, and invoke that function at the call site, s = f("Hello", "There"); When I compile this, I get: 1>------ Build started: Project: hacks, Configuration: Debug x64 ------ 1>Compiling... 1>main.cpp 1>.\main.cpp(11) : error C2039: 'append' : is not a member of 'boost::lambda::lambda_functor<T>' 1> with 1> [ 1> T=boost::lambda::placeholder<1> 1> ] Using MSVC 9. My fundamental understanding of function and lambdas may be lacking. The tutorials and docs did not help so far this morning. How do I do what I'm trying to do?

    Read the article

  • byte and short data types in Java can accept the value outside the range by explicit cast. The higher data types however can not. Why?

    - by Lion
    Let's consider the following expressions in Java. byte a = 32; byte b = (byte) 250; int i = a + b; This is valid in Java even though the expression byte b = (byte) 250; is forced to assign the value 250 to b which is outside the range of the type byte. Therefore, b is assigned -6 and consequently i is assigned the value 26 through the statement int i = a + b;. The same thing is possible with short as follows. short s1=(short) 567889999; Although the specified value is outside the range of short, this statement is legal. The same thing is however wrong with higher data types such int, double, folat etc and hence, the following case is invalid and causes a compile-time error. int z=2147483648; This is illegal, since the range of int in Java is from -2,147,483,648 to 2147483647 which the above statement exceeds and issues a compile-time error. Why is such not wrong with byte and short data types in Java?

    Read the article

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • Regex doesn't work properly

    - by oneofthelions
    I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

    Read the article

  • XAMPP on windows 7 not working properly

    - by 404Error
    Hey there, I just installed XAMPP lite on Windows 7. I have two drives - C: for the OS and regular files, and an external drive E:. I installed XAMPP lite on E: (on the root), and its been giving me problems. Apache works well enough, but MySQL doesn't work. When I go to http://localhost/phpmyadmin/, it gives me the following error: Error MySQL said: #2003 - Can't connect to MySQL server on 'localhost' (10061) Connection for controluser as defined in your configuration failed. Any ideas as to what could be the problem? I used the zip file for XAMPP lite, the 32 bit version. This is on Windows 7 Home premium. Thanks!

    Read the article

  • JQuery create new select option

    - by nav
    Hi I have the below functions in regular javascript creating select options. Is there a way I can do this with JQuery without having to use the form object? function populate(form) { form.options.length = 0; form.options[0] = new Option("Select a city / town in Sweden",""); form.options[1] = new Option("Melbourne","Melbourne"); } Below is how I call the function above: populate(document.form.county); //county is the id of the dropdownlist to populate. Many Thanks,

    Read the article

  • Zend Framework: How to handle exceptions in Ajax requests?

    - by understack
    Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

    Read the article

  • Question in Flex (parser)

    - by shkk
    Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

    Read the article

  • Magento - how to create different prices for different sizes of a products?

    - by Lisa Li
    Hi, I am trying to set different prices for different sizes of a few products I have in my store. I am not really sure how to do that propely. The problem is that I already have the regular size defined as a simple product. Now, I want to add a smaller size as well, that can be chosen from the same product page, and I need to set the weight of the smaller size, so postage is calculated properly. Any suggestions? Many thanks!

    Read the article

  • HandsOnTable - using date functions with methods

    - by briansol
    I have a function used on the datepicker to limit dates selected to the first of the month... I invoke it by setting a class and listener, such as: $( ".datepickfom" ).datepicker( { beforeShowDay: fom, showOn: "both", buttonImage: "/images/calendar.png", buttonImageOnly: true, changeMonth: true, changeYear: true, dateFormat: "m/d/yy", yearRange: "-25:+100", constrainInput: true } ); the fom call: function fom(date){ if (date.getDate() != 1) { return [false, "", "Specify 1st of Month"]; } return [true, ""]; } This works great for regular forms. I'm looking to extend this functionality to the HandsOnTable 'date' cell data types. var $container_1 = $("#datatable_1"); var handsontable_1 = $container_1.data('handsontable'); $("#datatable_1").handsontable( { columns: [ {}, {}, { type: 'date', dateFormat: 'm/d/yy' }, {}, { type: 'dropdown', source: ["","Y","N"] }, {}, {} ] }); This also works as it should, but the date lets me pick other dates besides the first. Is there a way to attach the beforeShowDay option to the HOT cell call as well?

    Read the article

< Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >