Search Results

Search found 80596 results on 3224 pages for 'simplexml load file'.

Page 383/3224 | < Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >

  • How to change icons of specific file types on Ubuntu 11.10?

    - by Curious Apprentice
    I want to change file icons of some specific file types like- .html, .css etc. I have tried using "File Type Editor (assogiate)" which is not working. I have also tried using "Gnome Tweak Tool" using icon themes. But that also does not worked properly (Though I can change folder icons , dash menu icons but not file icons). Please suggest me a way so that I can change file icons properly. I have read some of the articles saying about some mime type changes. I could not get proper guide from any of those articles. If there is such a way then please write in detail. Many Many Thanks in Advance :)

    Read the article

  • php download file slows

    - by hobbywebsite
    OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

    Read the article

  • Is it possible to mod_rewrite BASED on the existence of a file/directory and uniqueID?

    - by JM4
    My site currently forces all non www. pages to use www. Ultimately, I am able to handle all unique subdomains and parse correctly but I am trying to achieve the following: (ideally with mod_rewrite): when a consumer visits www.site.com/john4, the server processes that request as: www.site.com?Agent=john4 Our requirements are: The URL should continue to show www.site.com/john4 even though it was redirected to www.site.com?index.php?Agent=john4 If a file (of any extension OR a directory) exists with the name, the entire process stops an it tries to pull that file instead: for example: www.site.com/file would pull up (www.site.com/file.php if file.php existed on the server. www.site.com/pages would go to www.site.com/pages/index.php if the pages directory exists). Thank you ahead of time. I am completely at a crapshot right now.

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • Is there a way to recover a file that I have deleted but is still open somewhere?

    - by George Edison
    This question is related to How to recover deleted files? but it is slightly different in nature. Suppose I have a file named ~/something open in a text editor. Further suppose that I open a terminal and run the following command while the file is still open in the text editor: rm ~/something This will delete the file. Now suppose that I changed my mind and wanted to get the file back. The file is still open in the text editor, so it hasn't been removed from the disk or filesystem yet. Is there any way to recover it?

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • Can I copy large files faster without using the file cache?

    - by Veazer
    After adding the preload package, my applications seem to speed up but if I copy a large file, the file cache grows by more than double the size of the file. By transferring a single 3-4 GB virtualbox image or video file to an external drive, this huge cache seems to remove all the preloaded applications from memory, leading to increased load times and general performance drops. Is there a way to copy large, multi-gigabyte files without caching them (i.e. bypassing the file cache)? Or a way to whitelist or blacklist specific folders from being cached?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • could not save the file /usr/... permission denied (13.04)

    - by plaguedoctor
    I am running Ubuntu 13.04 and am trying to create an .sh file for conky in /usr/bin using gedit. When trying to save I get the error dialogue: Could not save the file /usr/bin/conky-start.sh You do not have the permissions necessary to save the file. Please check that you typed the location correctly and try again." From searching, I think I have to run a command in terminal to allow permission, but I couldn't find out what that is. Edit: I'm trying to create the file conky-start.sh, not change or run it. Thus far, I've opened gedit, copied and pasted some required info from the net, and I'm trying to save-as /usr/bin/conky-start.sh Perhaps I need to create the file first in terminal, then edit it? How would I do that?

    Read the article

  • jQuery prepend a auto fetch php file database

    - by newinjs
    Hello, Currently i have a php file which fetch data from mysql to display in website. I'm using input value to send as $_GET parameter to php file to determine the data to show. mysql_query("SELECT * FROM messages WHERE msg_id>'$refID' ORDER BY msg_id DESC"); //$refID is input value So once it load, i'm using this jquery code to display it on website setInterval( function () { $.get('load.php?id='+refID, function(html) { $("ol#update").prepend(html); $("ol#update li:first").slideDown("slow"); }); }, 10000); My question is how do i stop it from keep on repeating the same message? i want it to display if there is new data.

    Read the article

  • Save file in a different location in iPhone App

    - by zp26
    Hi, I have a problem. My proget create a xml file. In the iPhone this file was store in the NSDocumentDirectory. I wanna save this file in another directory like Desktop(where there are the apps) or another visible folder. Thanks. This is my code: -(void)saveInXML:(NSString*)name:(float)x:(float)y:(float)z{ //NSDocumentDirectory put the file in the app directory NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectoryPath = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectoryPath stringByAppendingPathComponent:@"filePosizioni.xml"]; NSFileHandle *myHandle; NSFileManager *fileManager = [NSFileManager defaultManager]; NSString *titoloXML = [NSString stringWithFormat:@"File Xml delle posizioni del iPhone"]; NSString *inizioTag = [NSString stringWithFormat:@"\n\n\n<posizione>"]; NSString *tagName = [NSString stringWithFormat:@"\n <name>%@</name>", name]; NSString *tagX = [NSString stringWithFormat:@"\n <x>%f</x>", x]; NSString *tagY = [NSString stringWithFormat:@"\n <y>%f</y>", y]; NSString *tagZ = [NSString stringWithFormat:@"\n <z>%f</z>", z]; NSString *fineTag= [NSString stringWithFormat:@"\n</posizione>"]; NSData* dataTitoloXML = [titoloXML dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataInizioTag = [inizioTag dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataName = [tagName dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataX = [tagX dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataY = [tagY dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataZ = [tagZ dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataFineTag = [fineTag dataUsingEncoding: NSASCIIStringEncoding]; if(![fileManager fileExistsAtPath:filePath]) [fileManager createFileAtPath:filePath contents:dataTitoloXML attributes:nil]; myHandle = [NSFileHandle fileHandleForUpdatingAtPath:filePath]; [myHandle seekToEndOfFile]; [myHandle writeData:dataInizioTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataName]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataX]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataY]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataZ]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataFineTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; NSLog(@"zp26 %@",filePath); }

    Read the article

  • How to make a file with .pt extension, with xml syntax highlighting and vim's plugin snipmate load p

    - by Somebody still uses you MS-DOS
    I have the following in my .vimrc: au BufNewFile,BufRead *.pt set filetype=xml This is needed because although I'm editing a file with *.pt extension, it's indeed a valid xml file: setting the filetype like this I can have syntax highlighting. I'm using vim's snipmate plugin, and tried to create pt.snippets to specific needs since these files are Zope Page Templates (ZPT with TAL). Now, I have a problem: I don't want to create these snippets in xml.snippets, since they aren't really generic xml snippets, but my *.pt files are set to xml, so when I define my pt snippets they aren't loaded unless I run :set filetype=pt on my pt file on vim - but then I lose syntax highlighting. I would like to be able to have a pt file, with xml syntax highlighting, to be able to load a pt.snippets file from snipmate. How can I do it? (I would like to avoid putting my snippets in a generic snippet file, I would like it to be present only in pt.snippets to be easier to maintain.)

    Read the article

  • moving EDMX file System.Data.MetadataException: Unable to load the specified metadata resource.

    - by Dani
    I have a ASP.NET MVC 2 project. I've created edmx file on the class library project that holds the model. now I've created another class library called it shared and moved the edmx file over there. resolved some issues, everything compiles, but it can't find the connection string resource at runtime. I've copied the ConnectionString part of the Web.Config to the main file, the old class library app.config file and the new class library app.config file. Still get this error: System.Data.MetadataException: Unable to load the specified metadata resource. Line 75: public myProjdb() : base("name=myProjdb", "MyProjdb") in the MyProj.Designer.cs file. Any Idea how to resolve this issue ? Is there a better way to store connection string data ?

    Read the article

  • How can I make a web browser view my .h file as text?

    - by drewbenn
    I want to post a .h file from a project I'm working on. I set a simple href link to it, like: <p>Click here to download the <a href=project_strings.h>strings file</a>. When I click on it, though, my web browser (Iceweasel 12) gives me a prompt to download the file, instead of just displaying it: Is there any magic I can add to the web page, or as a header to the file (that will still allow it to be included by a .c compiled with gcc), to get the .h file to be displayed in the web browser?

    Read the article

  • sharpziplib - can you add a file without it copying the entire zip first?

    - by schmoopy
    Im trying to add an existing file to a .zip file using sharpziplib - problem is, the zip file is 1GB in size. When i try to add 1 small file (400k) sharpziplib creates a copy/temp of the orig zip file before adding the new file - this poses a problem when the amount of free disk space is less than 2x the zip file you are trying to update. for example: 1GB zip myfile.zip 1GB zip myfile.zip.tmp.293 ZipFile zf = new ZipFile(path); zf.BeginUpdate(); zf.Add(file); // Adding a 400k file here causes a 1GB temp file to be created zf.EndUpdate(); zf.Close(); Is there a more efficient way to do this? Thanks :-)

    Read the article

  • Pass data to text file and save it on database

    - by Kasun
    Hi, I need to Pass some data to text file. Then that text file should be save in Data Base(SQL 2005). Then i need to retrieve data from the database by reading the columns to my application. I use VS2005 and need C# solution. Ex: (1) After click "Load" button data should pass to textile. (2) Then Click "Save" button data need to pass to database. (3) After click "Retrive" button data should load to datagride view. Please Help.....

    Read the article

  • Creating and Saving an Excel File

    - by Kris
    I have the following code that creates a new Excel file in my C# code behind. When I attempt to save the file I would like the user to select the location of the save. In Method #1, I can save the file my using the workbook SaveCopyAs without prompting the user for a location. This saves one file to the C:\Temp directory. Method #2 will save the file in my Users\Documents folder, then prompt the user to select the location and save a second copy. How can I eliminate the first copy from saving in the Users\Documents folder? Excel.Application oXL; Excel._Workbook oWB; Excel._Worksheet oSheet; Excel.Range oRng; try { //Start Excel and get Application object. oXL = new Excel.Application(); oXL.Visible = false; //Get a new workbook. oWB = (Excel._Workbook)(oXL.Workbooks.Add(Missing.Value)); oSheet = (Excel._Worksheet)oWB.ActiveSheet; // ***** oSheet.Cells[2, 6] = "Ship To:"; oSheet.get_Range("F2", "F2").Font.Bold = true; oSheet.Cells[2, 7] = sShipToName; oSheet.Cells[3, 7] = sAddress; oSheet.Cells[4, 7] = sCityStateZip; oSheet.Cells[5, 7] = sContactName; oSheet.Cells[6, 7] = sContactPhone; oSheet.Cells[9, 1] = "Shipment No:"; oSheet.get_Range("A9", "A9").Font.Bold = true; oSheet.Cells[9, 2] = sJobNumber; oSheet.Cells[9, 6] = "Courier:"; oSheet.get_Range("F9", "F9").Font.Bold = true; oSheet.Cells[9, 7] = sCarrierName; oSheet.Cells[11, 1] = "Requested Delivery Date:"; oSheet.get_Range("A11", "A11").Font.Bold = true; oSheet.Cells[11, 2] = sRequestDeliveryDate; oSheet.Cells[11, 6] = "Courier Acct No:"; oSheet.get_Range("F11", "F11").Font.Bold = true; oSheet.Cells[11, 7] = sCarrierAcctNum; // ***** Method #1 //oWB.SaveCopyAs(@"C:\Temp\" + sJobNumber +".xls"); Method #2 oXL.SaveWorkspace(sJobNumber + ".xls"); } catch (Exception theException) { String errorMessage; errorMessage = "Error: "; errorMessage = String.Concat(errorMessage, theException.Message); errorMessage = String.Concat(errorMessage, " Line: "); errorMessage = String.Concat(errorMessage, theException.Source); }

    Read the article

  • how to hack this php class for parse ZIP file in random or specific order

    - by Jesse
    My English is poor so I will make it short. Right now, I have imzip.zip which has three txt files: a.txt b.txt c.txt When I try to load imzip.zip using: http://pastebin.com/m1d974990 It loads the files alphabetically. In this case: a.txt b.txt c.txt However, I would like to be able to have the class load on different variables such as by size, date or simply random. The problem is I have no idea how I would go about modifying the class to fit my needs. I would really appreciate your help! :D

    Read the article

  • How can I delete a file in Sinatra after it has been sent via send_file?

    - by John Reilly
    I have a simple sinatra application that needs to generate a file (via an external process), send that file to the browser, and finally, delete the file from the filesystem. Something along these lines: class MyApp < Sinatra::Base get '/generate-file' do # calls out to an external process, # and returns the path to the generated file file_path = generate_the_file() # send the file to the browser send_file(file_path) # remove the generated file, so we don't # completely fill up the filesystem. File.delete(file_path) # File.delete is never called. end end It seems, however, that the send_file call completes the request, and any code after it does not get run. Is there some way to ensure that the generated file is cleaned up after it has been successfully sent to the browser? Or will I need to resort to a cron job running a cleanup script on some interval?

    Read the article

  • AS 2.0 - Passing xml file path as a flashvars in onClipEvent

    - by Anaya
    Hi, I want to pass xml file path dynamically using flashvars. It works ok in Onrollover and Onrollout events. But not in onClipEvent. Below is the code I am using - onClipEvent (load) { cnetXML = new XML(); cnetXML.ignoreWhite = true; cnetXML.onLoad=extractData; var xmlfile = xmlpath; cnetXML.load(xmlfile); function extractData(success) { rootHandler=this.firstChild.childNodes[23].childNodes[5].firstChild.nodeValue; if (rootHandler) gotoAndStop(2); } } If I replace xmlpath in above script with actual link, it works ok. Please let me know what I am missing here? Thanks in advance for your time! Kind Regards

    Read the article

  • How can I do individual file encryption on Dropbox?

    - by Scaine
    I'd like to set a single directory inside Dropbox in which files are encrypted on a file-by-file basis. At the moment, I use a 2Mb Truecrypt container inside my Dropbox which I then have to mount manually, access/change the files within, then unmount manually. At that point, the entire 2Mb uploads to Dropbox. This is a pain for a number of reasons : Dropbox sync will only occur when the Truecrypt container is unmounted, because Dropbox only syncs files that aren't locked and mounting a container locks it. A single byte change to one file inside that container results in the whole 2Mb being uploaded again. It doesn't scale - I was originally using a 10Mb container, but obviously the bigger the container, the longer it takes to sync when it's unmounted. I was wondering if I can somehow use LUKS to implement file-by-file encryption to get round the "container" issues.

    Read the article

  • How can code in a JavaScript file get the file's URL?

    - by dalbaeb
    I need to dynamically load a CSS stylesheet into a page that's on a different domain. How can I get the complete URL of the JS file to use in the href attribute of the stylesheet? For instance, here is the structure: http://bla.com/js/script.js http://bla.com/css/style.css I want to dynamically load the stylesheet into a page http://boo.net/index.html. The problem is, I don't know the bla.com bit in advance, just the fact that the stylesheet is in ../css/ relative to the JS file. The script is, of course, included on index.html. jQuery's fine too.

    Read the article

  • Fedora error log file

    - by user111196
    I am running a java application using this wrapper service yajsw. The problem it just stopped without any error in its logs file. So I was wondering will there be any system log file which will indicate the cause of it going down? Partial of the log file. Apr 6 00:12:20 localhost kernel: imklog 3.22.1, log source = /proc/kmsg started. Apr 6 00:12:20 localhost rsyslogd: [origin software="rsyslogd" swVersion="3.22.1" x-pid="2234" x-info="http://www.rsyslog.com"] (re)start Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys cpuset Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys cpu Apr 6 00:12:20 localhost kernel: Linux version 2.6.27.41-170.2.117.fc10.x86_64 ([email protected]) (gcc version 4.3.2 20081105 (Red Hat 4.3.2-7) (GCC) ) #1 SMP Thu Dec 10 10:36:29 EST 2009 Apr 6 00:12:20 localhost kernel: Command line: ro root=UUID=722ebf87-437f-4634-9c68-a82d157fa948 rhgb quiet Apr 6 00:12:20 localhost kernel: KERNEL supported cpus: Apr 6 00:12:20 localhost kernel: Intel GenuineIntel Apr 6 00:12:20 localhost kernel: AMD AuthenticAMD Apr 6 00:12:20 localhost kernel: Centaur CentaurHauls Apr 6 00:12:20 localhost kernel: BIOS-provided physical RAM map: Apr 6 00:12:20 localhost kernel: BIOS-e820: 0000000000000000 - 00000000000a0000 (usable) Apr 6 00:12:20 localhost kernel: BIOS-e820: 0000000000100000 - 00000000cfb50000 (usable) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000cfb50000 - 00000000cfb66000 (reserved) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000cfb66000 - 00000000cfb85c00 (ACPI data) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000cfb85c00 - 00000000d0000000 (reserved) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000e0000000 - 00000000f0000000 (reserved) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000fe000000 - 0000000100000000 (reserved) Apr 6 00:12:20 localhost kernel: BIOS-e820: 0000000100000000 - 0000000330000000 (usable) Apr 6 00:12:20 localhost kernel: DMI 2.5 present. Apr 6 00:12:20 localhost kernel: last_pfn = 0x330000 max_arch_pfn = 0x3ffffffff Apr 6 00:12:20 localhost kernel: x86 PAT enabled: cpu 0, old 0x7040600070406, new 0x7010600070106 Apr 6 00:12:20 localhost kernel: last_pfn = 0xcfb50 max_arch_pfn = 0x3ffffffff Apr 6 00:12:20 localhost kernel: init_memory_mapping Apr 6 00:12:20 localhost kernel: last_map_addr: cfb50000 end: cfb50000 Apr 6 00:12:20 localhost kernel: init_memory_mapping Apr 6 00:12:20 localhost kernel: last_map_addr: 330000000 end: 330000000 Apr 6 00:12:20 localhost kernel: RAMDISK: 37bfc000 - 37fef6c8 Apr 6 00:12:20 localhost kernel: ACPI: RSDP 000F21B0, 0024 (r2 DELL ) Apr 6 00:12:20 localhost kernel: ACPI: XSDT 000F224C, 0084 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: FACP CFB83524, 00F4 (r3 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: DSDT CFB66000, 4974 (r1 DELL PE_SC3 1 INTL 20050624) Apr 6 00:12:20 localhost kernel: ACPI: FACS CFB85C00, 0040 Apr 6 00:12:20 localhost kernel: ACPI: APIC CFB83078, 00B6 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: SPCR CFB83130, 0050 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: HPET CFB83184, 0038 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: MCFG CFB831C0, 003C (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: WD__ CFB83200, 0134 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: SLIC CFB83338, 0176 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: ERST CFB6AAF4, 0210 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: HEST CFB6AD04, 027C (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: BERT CFB6A974, 0030 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: EINJ CFB6A9A4, 0150 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: TCPA CFB834BC, 0064 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: No NUMA configuration found Apr 6 00:12:20 localhost kernel: Faking a node at 0000000000000000-0000000330000000 Apr 6 00:12:20 localhost kernel: Bootmem setup node 0 0000000000000000-0000000330000000 Apr 6 00:12:20 localhost kernel: NODE_DATA [0000000000015000 - 0000000000029fff] Apr 6 00:12:20 localhost kernel: bootmap [000000000002a000 - 000000000008ffff] pages 66 Apr 6 00:12:20 localhost kernel: (7 early reservations) ==> bootmem [0000000000 - 0330000000] Apr 6 00:12:20 localhost kernel: #0 [0000000000 - 0000001000] BIOS data page ==> [0000000000 - 0000001000] Apr 6 00:12:20 localhost kernel: #1 [0000006000 - 0000008000] TRAMPOLINE ==> [0000006000 - 0000008000] Apr 6 00:12:20 localhost kernel: #2 [0000200000 - 0000a310cc] TEXT DATA BSS ==> [0000200000 - 0000a310cc] Apr 6 00:12:20 localhost kernel: #3 [0037bfc000 - 0037fef6c8] RAMDISK ==> [0037bfc000 - 0037fef6c8] Apr 6 00:12:20 localhost kernel: #4 [000009f000 - 0000100000] BIOS reserved ==> [000009f000 - 0000100000] Apr 6 00:12:20 localhost kernel: #5 [0000008000 - 000000c000] PGTABLE ==> [0000008000 - 000000c000] Apr 6 00:12:20 localhost kernel: #6 [000000c000 - 0000015000] PGTABLE ==> [000000c000 - 0000015000] Apr 6 00:12:20 localhost kernel: found SMP MP-table at [ffff8800000fe710] 000fe710 Apr 6 00:12:20 localhost kernel: Zone PFN ranges: Apr 6 00:12:20 localhost kernel: DMA 0x00000000 -> 0x00001000 Apr 6 00:12:20 localhost kernel: DMA32 0x00001000 -> 0x00100000 Apr 6 00:12:20 localhost kernel: Normal 0x00100000 -> 0x00330000 Apr 6 00:12:20 localhost kernel: Movable zone start PFN for each node Apr 6 00:12:20 localhost kernel: early_node_map[3] active PFN ranges Apr 6 00:12:20 localhost kernel: 0: 0x00000000 -> 0x000000a0 Apr 6 00:12:20 localhost kernel: 0: 0x00000100 -> 0x000cfb50 Apr 6 00:12:20 localhost kernel: 0: 0x00100000 -> 0x00330000 Apr 6 00:12:20 localhost kernel: ACPI: PM-Timer IO Port: 0x808 Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x01] lapic_id[0x00] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x02] lapic_id[0x04] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x03] lapic_id[0x02] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x04] lapic_id[0x06] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x05] lapic_id[0x01] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x06] lapic_id[0x05] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x07] lapic_id[0x03] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x08] lapic_id[0x07] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC_NMI (acpi_id[0xff] high edge lint[0x1]) Apr 6 00:12:20 localhost kernel: ACPI: IOAPIC (id[0x08] address[0xfec00000] gsi_base[0]) Apr 6 00:12:20 localhost kernel: IOAPIC[0]: apic_id 8, version 0, address 0xfec00000, GSI 0-23 Apr 6 00:12:20 localhost kernel: ACPI: IOAPIC (id[0x09] address[0xfec81000] gsi_base[64]) Apr 6 00:12:20 localhost kernel: IOAPIC[1]: apic_id 9, version 0, address 0xfec81000, GSI 64-87 Apr 6 00:12:20 localhost kernel: ACPI: IOAPIC (id[0x0a] address[0xfec84000] gsi_base[160]) Apr 6 00:12:20 localhost kernel: IOAPIC[2]: apic_id 10, version 0, address 0xfec84000, GSI 160-183 Apr 6 00:12:20 localhost kernel: ACPI: IOAPIC (id[0x0b] address[0xfec84800] gsi_base[224]) Apr 6 00:12:20 localhost kernel: IOAPIC[3]: apic_id 11, version 0, address 0xfec84800, GSI 224-247 Apr 6 00:12:20 localhost kernel: ACPI: INT_SRC_OVR (bus 0 bus_irq 0 global_irq 2 dfl dfl) Apr 6 00:12:20 localhost kernel: ACPI: INT_SRC_OVR (bus 0 bus_irq 9 global_irq 9 high level) Apr 6 00:12:20 localhost kernel: Setting APIC routing to flat Apr 6 00:12:20 localhost kernel: ACPI: HPET id: 0x8086a201 base: 0xfed00000 Apr 6 00:12:20 localhost kernel: Using ACPI (MADT) for SMP configuration information Apr 6 00:12:20 localhost kernel: SMP: Allowing 8 CPUs, 0 hotplug CPUs Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000000a0000 - 0000000000100000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000cfb50000 - 00000000cfb66000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000cfb66000 - 00000000cfb85000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000cfb85000 - 00000000cfb86000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000cfb86000 - 00000000d0000000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000d0000000 - 00000000e0000000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000e0000000 - 00000000f0000000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000f0000000 - 00000000fe000000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000fe000000 - 0000000100000000 Apr 6 00:12:20 localhost kernel: Allocating PCI resources starting at d1000000 (gap: d0000000:10000000) Apr 6 00:12:20 localhost kernel: PERCPU: Allocating 65184 bytes of per cpu data Apr 6 00:12:20 localhost kernel: Built 1 zonelists in Zone order, mobility grouping on. Total pages: 3096524 Apr 6 00:12:20 localhost kernel: Policy zone: Normal Apr 6 00:12:20 localhost kernel: Kernel command line: ro root=UUID=722ebf87-437f-4634-9c68-a82d157fa948 rhgb quiet Apr 6 00:12:20 localhost kernel: Initializing CPU#0 Apr 6 00:12:20 localhost kernel: PID hash table entries: 4096 (order: 12, 32768 bytes) Apr 6 00:12:20 localhost kernel: Extended CMOS year: 2000 Apr 6 00:12:20 localhost kernel: TSC: PIT calibration confirmed by PMTIMER. Apr 6 00:12:20 localhost kernel: TSC: using PMTIMER calibration value Apr 6 00:12:20 localhost kernel: Detected 1994.992 MHz processor. Apr 6 00:12:20 localhost kernel: Console: colour VGA+ 80x25 Apr 6 00:12:20 localhost kernel: console [tty0] enabled Apr 6 00:12:20 localhost kernel: Checking aperture... Apr 6 00:12:20 localhost kernel: No AGP bridge found Apr 6 00:12:20 localhost kernel: PCI-DMA: Using software bounce buffering for IO (SWIOTLB) Apr 6 00:12:20 localhost kernel: Placing software IO TLB between 0x20000000 - 0x24000000 Apr 6 00:12:20 localhost kernel: Memory: 12324244k/13369344k available (3311k kernel code, 253484k reserved, 1844k data, 1296k init) Apr 6 00:12:20 localhost kernel: SLUB: Genslabs=13, HWalign=64, Order=0-3, MinObjects=0, CPUs=8, Nodes=1 Apr 6 00:12:20 localhost kernel: Calibrating delay loop (skipped), value calculated using timer frequency.. 3989.98 BogoMIPS (lpj=1994992) Apr 6 00:12:20 localhost kernel: Security Framework initialized Apr 6 00:12:20 localhost kernel: SELinux: Initializing. Apr 6 00:12:20 localhost kernel: Dentry cache hash table entries: 2097152 (order: 12, 16777216 bytes) Apr 6 00:12:20 localhost kernel: Inode-cache hash table entries: 1048576 (order: 11, 8388608 bytes) Apr 6 00:12:20 localhost kernel: Mount-cache hash table entries: 256 Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys ns Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys cpuacct Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys devices Apr 6 00:12:20 localhost kernel: CPU: L1 I cache: 32K, L1 D cache: 32K Apr 6 00:12:20 localhost kernel: CPU: L2 cache: 4096K Apr 6 00:12:20 localhost kernel: CPU 0/0 -> Node 0 Apr 6 00:12:20 localhost kernel: CPU: Physical Processor ID: 0 Apr 6 00:12:20 localhost kernel: CPU: Processor Core ID: 0 Apr 6 00:12:20 localhost kernel: CPU0: Thermal monitoring enabled (TM1) Apr 6 00:12:20 localhost kernel: using mwait in idle threads. Apr 6 00:12:20 localhost kernel: ACPI: Core revision 20080609 Apr 6 00:12:20 localhost kernel: ..TIMER: vector=0x30 apic1=0 pin1=2 apic2=-1 pin2=-1 Apr 6 00:12:20 localhost kernel: CPU0: Intel(R) Xeon(R) CPU E5335 @ 2.00GHz stepping 07 Apr 6 00:12:20 localhost kernel: Using local APIC timer interrupts. Apr 6 00:12:20 localhost kernel: Detected 20.781 MHz APIC timer. Apr 6 00:12:20 localhost kernel: Booting processor 1/4 ip 6000 Apr 6 00:12:20 localhost kernel: Initializing CPU#1 Apr 6 00:12:20 localhost kernel: Calibrating delay using timer specific routine.. 3990.05 BogoMIPS (lpj=1995026) Apr 6 00:12:20 localhost kernel: CPU: L1 I cache: 32K, L1 D cache: 32K Apr 6 00:12:20 localhost kernel: CPU: L2 cache: 4096K Apr 6 00:12:20 localhost kernel: CPU 1/4 -> Node 0 Apr 6 00:12:20 localhost kernel: CPU: Physical Processor ID: 1 Apr 6 00:12:20 localhost kernel: CPU: Processor Core ID: 0 Apr 6 00:12:20 localhost kernel: CPU1: Thermal monitoring enabled (TM2) Apr 6 00:12:20 localhost kernel: x86 PAT enabled: cpu 1, old 0x7040600070406, new 0x7010600070106 Apr 6 00:12:20 localhost kernel: CPU1: Intel(R) Xeon(R) CPU E5335 @ 2.00GHz stepping 07 Apr 6 00:12:20 localhost kernel: checking TSC synchronization [CPU#0 -> CPU#1]: passed. Apr 6 00:12:20 localhost kernel: Booting processor 2/2 ip 6000 Apr 6 00:12:20 localhost kernel: Initializing CPU#2 Apr 6 00:12:20 localhost kernel: Calibrating delay using timer specific routine.. 3990.05 BogoMIPS (lpj=1995029)

    Read the article

  • UnicodeEncodeError when uploading files in Django admin

    - by Samuel Linde
    Note: I asked this question on StackOverflow, but I realize this might be a more proper place to ask this kind of question. I'm trying to upload a file called 'Testaråäö.txt' via the Django admin app. I'm running Django 1.3.1 with Gunicorn 0.13.4 and Nginx 0.7.6.7 on a Debian 6 server. Database is PostgreSQL 8.4.9. Other Unicode data is saved to the database with no problem, so I guess the problem must be with the filesystem somehow. I've set http { charset utf-8; } in my nginx.conf. LC_ALL and LANG is set to 'sv_SE.UTF-8'. Running 'locale' verifies this. I even tried setting LC_ALL and LANG in my nginx init script just to make sure locale is set properly. Here's the traceback: Traceback (most recent call last): File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/handlers/base.py", line 111, in get_response response = callback(request, *callback_args, **callback_kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/options.py", line 307, in wrapper return self.admin_site.admin_view(view)(*args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 93, in _wrapped_view response = view_func(request, *args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/views/decorators/cache.py", line 79, in _wrapped_view_func response = view_func(request, *args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/sites.py", line 197, in inner return view(request, *args, **kwargs) File "/srv/django/letebo/app/cms/admin.py", line 81, in change_view return super(PageAdmin, self).change_view(request, obj_id) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 28, in _wrapper return bound_func(*args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 93, in _wrapped_view response = view_func(request, *args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 24, in bound_func return func(self, *args2, **kwargs2) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/transaction.py", line 217, in inner res = func(*args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/options.py", line 985, in change_view self.save_formset(request, form, formset, change=True) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/options.py", line 677, in save_formset formset.save() File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/forms/models.py", line 482, in save return self.save_existing_objects(commit) + self.save_new_objects(commit) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/forms/models.py", line 613, in save_new_objects self.new_objects.append(self.save_new(form, commit=commit)) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/forms/models.py", line 717, in save_new obj.save() File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/base.py", line 460, in save self.save_base(using=using, force_insert=force_insert, force_update=force_update) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/base.py", line 504, in save_base self.save_base(cls=parent, origin=org, using=using) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/base.py", line 543, in save_base for f in meta.local_fields if not isinstance(f, AutoField)] File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/fields/files.py", line 255, in pre_save file.save(file.name, file, save=False) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/fields/files.py", line 92, in save self.name = self.storage.save(name, content) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/files/storage.py", line 48, in save name = self.get_available_name(name) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/files/storage.py", line 74, in get_available_name while self.exists(name): File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/files/storage.py", line 218, in exists return os.path.exists(self.path(name)) File "/srv/.virtualenvs/letebo/lib/python2.6/genericpath.py", line 18, in exists st = os.stat(path) UnicodeEncodeError: 'ascii' codec can't encode characters in position 52-54: ordinal not in range(128) I tried running Gunicorn with debugging turned on, and the file uploads without any problem at all. I suppose this must mean that the issue is with Nginx. Still beats me where to look, though. Here are the raw response headers from Gunicorn and Nginx, if it makes any sense: Gunicorn: HTTP/1.1 302 FOUND Server: gunicorn/0.13.4 Date: Thu, 09 Feb 2012 14:50:27 GMT Connection: close Transfer-Encoding: chunked Expires: Thu, 09 Feb 2012 14:50:27 GMT Vary: Cookie Last-Modified: Thu, 09 Feb 2012 14:50:27 GMT Location: http://my-server.se:8000/admin/cms/page/15/ Cache-Control: max-age=0 Content-Type: text/html; charset=utf-8 Set-Cookie: messages="yada yada yada"; Path=/ Nginx: HTTP/1.1 500 INTERNAL SERVER ERROR Server: nginx/0.7.67 Date: Thu, 09 Feb 2012 14:50:57 GMT Content-Type: text/html; charset=utf-8 Transfer-Encoding: chunked Connection: close Vary: Cookie 500 UPDATE: Both locale.getpreferredencoding() and sys.getfilesystemencoding() outputs 'UTF-8'. locale.getdefaultlocale() outputs ('sv_SE', 'UTF8'). This seem correct to me, so I'm still not sure why I keep getting these errors.

    Read the article

< Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >