Search Results

Search found 14008 results on 561 pages for 'easy marks'.

Page 386/561 | < Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >

• Why does OpenGL have to completely break backwards compatablity?

  - by directx

  I'm not sure if this only applies to JOGL or the entire OpenGL project in general. But there seems to be a vast difference between versions 3.x and 2.x; Code that works on one version will not work on another. It looks to me like the library designers intentionally renamed various classes, packages, and functions just to screw up the existing code. I've never seen anything like this before. The problem is I'm not sure which library to use now, and when looking at code it's not so easy to figure out whether it's supposed to run on 2.x or 3.x.

  Read the article

• Callback exception/error handling for ASP TreeView OnTreeNodePopulate?

  - by MHutchinson

  We're using an asp:TreeView configured with lazy loading. The callback method assigned for OnTreeNodePopulate throws an exception if the user has been logged out since the page was loaded. What we want to do is to direct the user to the login page. First attempt was to catch the exception on the server and try Response.Redirect(...), but that doesn't work because you can't redirect within a callback. I've tried various other approaches, including using ClientScript.RegisterStartupScript(...) but that doesn't seem to work for OnTreeNodePopulate. If there was some way we could hook into the callback event handling on the client side then it would be easy, but the TreeView doesn't seem to offer anything here. Suggestions?

  Read the article

• Adding Content to a Randomized Background

  - by user2903815

  On refresh my background image changes. I need to add a header to change with each background. How would I add an h1 tag to the php. I am unfamiliar with php but I feel like this should be an easy fix. Here's my script: <script type="text/javascript"> var bgcount = 3; function changebg() { var num = Math.ceil( Math.random() * bgcount ); document.body.background = 'bgs/'+num+'.jpg'; document.body.style.backgroundRepeat = "no-repeat"; document.body.style.backgroundAttachment = "fixed"; document.body.style.backgroundSize = "cover"; } </script> Thanks!

  Read the article

• Replace Emails and HREFS with enclosing HREFS in C#

  - by Nissan Fan

  I have an Email body that used to be plain text, but now I've made it HTML. The emails are generated using a number of methods and none of them are easy to convert. What I have is: Some content [email protected], some http://www.somewebsite/someurl.aspx. What I'd like to do is create a function that automatically encloses all email addresses and all URLs withing a string in HREF tags so that the HTML email reads properly in all email clients. Does anyone have a function for this?

  Read the article

• Duplicate / Copy records in the same MySQL table

  - by Digits

  I have been looking for a while now but I can not find an easy solution for my problem. I would like to duplicate a record in a table, but of course, the unique primary key needs to be updated. I have this query: INSERT INTO invoices SELECT * FROM invoices AS iv WHERE iv.ID=XXXXX ON DUPLICATE KEY UPDATE ID = (SELECT MAX(ID)+1 FROM invoices) the problem is that this just changes the ID of the row instead of copying the row. Does anybody know how to fix this ? Thank you verrry much, Digits //edit: I would like to do this without typing all the field names because the field names can change over time.

  Read the article

• Error about TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `<top (required)>'

  - by edi susanto

  hy guys . . im new at this . . sorry for the word that's not understandable and the easy question . . i'd like to ask about an error that shown below : TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `' i want to test the result by render json in soapUI. does anyone know what's the problem so that the error will show up like above ? thanks before.regards,edy

  Read the article

• Reading a bmp file and inverting it in C

  - by user1763396

  I have an assignment that deals with reading a bmp file into memory, inverts the pixels, and then saves the inverted image to a new file. From this description it seems fairly easy, however I don't think my professor did a great job in explaining the necessary steps to go about doing so. He taught us about fread and fwrite but there is so much more. Can anyone explain the process in going about this problem (I'm no looking for a direct answer just an explanation). Here is the link to the problem's description: https://engineering.purdue.edu/OOSD/F2012/Exercises/ex5.html Thanks in advance for any sort of help. NOTE: I actually have looked into this problem but since I don't have a good standing on this info it's not quite "clicking".

  Read the article

• WPF binding: Doing a temperature converter app

  - by Bob

  Hi there, I'm doing a little app that basically has 2 text boxes. You'll enter Fahrenheit into TextBoxA and Celsius into TextBoxB. As the text changes in TextBoxA I want the equivalent Celsius value to be displayed in TextBoxB and vice versa. I can come up with a solution pretty easy for this but i'm trying to be a little clever. Is there a way to do it all in Xaml except for a Convert class that does the maths? So basically I want the TextChanged event of one textBox to pass in it's value into a Converter class that is evaluated and sent to the other TextBox and visa versa. Anyone know how I can achieve this ... and if it's possible at all?

  Read the article

• CouchDB emit with lookup key that is array, such that order of array elements are ignored.

  - by MatternPatching

  When indexing a couchdb view, you can emit an array as the key such as: emit(["one", "two", "three"], doc); I appreciate the fact that when searching the view, the order is important, but sometimes I would like the view to ignore it. I have thought of a couple of options. 1. By convention, just emit the contents in alphabetical order, and ensure that looking up uses the same convention. 2. Somehow hash in a manner that disregards the order, and emit/search based on that hash. (This is fairly easy, if you simply hash each one individually, "sum" the hashes, then mod.) Note: I'm sure this may be covered somewhere in the authoritative guide, but I was unsuccessful in finding it.

  Read the article

• Can I distort a bitmap image in Flash?

  - by drpepper

  Hi, what I would like to do is to take a loaded GIF file as a Bitmap, and then distort it by stretching and shrinking parts of it, so it would look like it got squished up against the screen. I'm pretty sure that there's no easy way in Flash to go beyond scaling and shearing, but I wonder if there might be some simple techniques to accomplish this kind of effect. By the way, I've also thought of pre-deforming the images in GIMP and saving them there, but I can't find a simple way to do it without learning their scripting language. Thanks for your help!

  Read the article

• Odd toString behavior in javascript

  - by George

  I have this small function that's behaving oddly to me. Easy enough to work around, but enough to pique my curiosity. function formatNumber(number,style) { if (typeof style == 'number') { style = style.toString(); } return (number).format(style); } The return format part is based on another function that requires the style variable to be a string to work properly, so I'm just checking if style is a number and if it is to convert it to a string. When the function above is written as is, the format function format doesn't work properly. However when I write it as simply: return (number).format(style.toString()); Everything works. Is there a difference between putting the .toString function inside the format call vs performing it before hand and setting it as the variable style?

  Read the article

• Reading in MIPS external file so another file can use it?

  - by SkyWookie

  Hey all, I'm working on this final thing for my MIPS project and it's deceptively easy. I need to get a procedure (called feed) and let its main driver program use it by reading it in. I know that I'm supposed to use the call code 14 and .globl sym (I think) in order to feed it into the file and have it read it. I just need a basic tutorial or something, as I CANNOT find it on the Internet or in my book (just lists the call code, real helpful). Here's what I know: I need to use read, but I also need a file descriptor (don't know where to get it). I need to put the buffer in $a1 and the length in $a2. Well, that's about it. If there's any decent tutorial you could whip up or if there is one online that I don't see let me know please :). I just need a push in the right direction, I'm sure it can't be too difficult, just can't find any info on it!

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Secure way to run other people code (sandbox) on my server?

  - by amikazmi

  I want to make a web service that run other people code locally... Naturally, I want to limit their code access to certain "sandbox" directory, and that they wont be able to connect to other parts of my server (DB, main webserver, etc) Whats the best way to do it? Run VMware/Virtualbox: (+) I guess it's as secure as it gets.. even if someone manage to "hack".. they only hack the guest machine (+) can limit the cpu & memory the process uses (+) easy to setup.. just create the VM (-) harder to "connect" the sandbox directory from the host to the guest (-) wasting extra memory and cpu for managing the VM Run underprivileged user: (+) doesnt waste extra resources (+) sandbox directory is just a plain directory (?) cant limit cpu and memory? (?) dont know if it's secure enough... Any other way? Server running Fedora Core 8, the "other" codes written in Java & C++

  Read the article

• Best way to test class methods without running __init__

  - by KenFar

  I've got a simple class that gets most of its arguments via init, which also runs a variety of private methods that do most of the work. Output is available either through access to object variables or public methods. Here's the problem - I'd like my unittest framework to directly call the private methods called by init with different data - without going through init. What's the best way to do this? So far, I've been refactoring these classes so that init does less and data is passed in separately. This makes testing easy, but I think the usability of the class suffers a little.

  Read the article

• Offer access to a private page without login

  - by dccarmo

  So I've been struggling with a nice and easy way to allow users to access a private page without asking them to fill out a login/password form. What I'm thinking about using right now is for each private page I generate a uniqueid (using php uniqid function) and then send the URI to the user. He would access his private page as "www.mywebsite.com/private_page/13ffa2c4a". I think it's relatively safe and user friendly, without asking too much of information. I thought maybe when the user access this page it would ask for it's e-mail just to be sure, but the best would be nothing at all. Is this really safe? I mean not internet banking safe, but enough for a simple access? Do you think there's a better solution? Thanks. :)

  Read the article

• Suggestions on including free database products to include in an application - SQL Server Express or

  - by superartsy

  I am working on an enterprise level product that is designed around SQL Server Express and specifically its features (views, concurrent users, stored procedures, CASE and IF statements). Though we don't use any advanced SQL Server features, the database size limit of 4GB in the Express edition may up being a limitation. A work-around is that customers can move to more full-featured versions of SQL Server. The problem is that SQL Server Express deployment is not easy, and the installer size is huge. This is a major drawback for someone looking to try our product. You don't want end-users to not buy a product because the download is huge. Does anyone have any recommendations of a database that has a smaller footprint but all the features of Express and which can be migrated to express?

  Read the article

• Creating CFArray from MySQL Result Array

  - by Andrew

  Is there an easy way to dump an array returned from mysql_fetch_row into a CFArray? (part of the PHP implementation of CFPropertyList) I'm bummed by the lack of documentation on CFPropertyList for PHP. Iterating through each item in the array seems inefficient. I'm open to using a different mysql_fetch_... command. I'd like to just say: $NewArray = new CFArray( $ResultArray ) But that deosn't seem to work. This is my current code: $plist = new CFPropertyList(); $ResultRow = mysqli_fetch_row( $result ); $plist-add( $TableRow = new CFArray() ); foreach ( $ResultRow as $Item ){ $TableRow-add( new CFString( $Item ) ); }

  Read the article

• Server Side code Pushing Data to client Browser while current thread is busy Comet (programming)

  - by h_power11

  Hello Friends, I am writing one simple web page with bunch of textboxes and a button control. Now when user finished editing the values on this text boxes user has to click the button and this button invoke heavily process intensive algorithm on server side code based on the data received from client (Textboxes) And it could some time takes up to 30 to 45 minutes to complete the whole operation so the current thread is still inside the button click event handler function. That background task only provides one event, and the web page subscribes to it to get some text data after each stage of processing I was wandering if there is any way I can keep user up-to-date with what is the current progress on that background task. I have div element to print the current status information So I am looking for some sort of reverse mechanism then "get" and "post". I have read some articles on the Comet (programming) but I can't find any easy or definitive answer Thanks in advance

  Read the article

• UiScrollView with scrolling content

  - by objektivs

  I have a detail page of type UIScrollView. On it I want an optional UIImageView and a mandatory UITextView. If no image is available then the image view should not take any space. The text for the text view can be of varying sizes. When the view is loaded with, say, the image and the text I need to be able to scroll through all the contents. So the image slips off the top of the screen. I just can't get this work and I feel it ought to be easy. Any ideas?

  Read the article

• iPhone SDK: Keep an image from scrolling with a UIScrollView

  - by Wudstock

  Hi, I've been searching all over for an easy way to do this. Right now I have a UIScrollView setup as my main view. There's an Image on the left and a column of TextFields on the right. When any TextField is tapped, the keyboard comes up and hides the bottom TextField. So I have the ScrollView move up to unhide the bottom TextField. Question #1: Is there a way to have it respond to a specific TextField instead of all of them? Question #2: Is there a way to keep the Image on the left static so it doesn't move with the TextFields? Thanks in advance for any help.

  Read the article

• jQuery selector depending on children

  - by wiradikusuma

  Hi guys, I have an HTML form consisting of some text-inputs. I'm using jqTransform to prettify them. Now I want to add two buttons that will add and remove text-input dynamically. Adding is easy: $('#container').append(''); $('input[name=foo]:last-child').jqTransInputText(); But removing is tricky: $('WHAT-TO-SELECT').remove(); I can't do "input[name=foo]:last-child" since it's already wrapped (some divs) by jqTransform. To put this question in another way: How do I select based on "who has child of type input with 'foo' as its name"?

  Read the article

• Filtering across two ManyToMany fields

  - by KVISH

  I have a User model and an Event model. I have the following for both: class Event(models.Model): ... timestamp = models.DateTimeField() organization_map = models.ManyToManyField(Organization) class User(AuthUser): ... subscribed_orgs = models.ManyToManyField('Organization') I want to find all events that were created in a certain timeframe and find the users who are subscribed to those organizations. I know how to write SQL for this (it's very easy), but whats the pythonic way of doing this using Django ORM? I'm trying as per below: orgs = Organization.objects.all() events = Event.objects.filter(timestamp__gt=min_time) # Min time is the time I want to start from events = events.filter(organization_map__in=orgs) But from there, how do I map to users who have that organization as a subscription? I'm trying to map it like so: users = User.objects.filter(subscribed_orgs__in=...

  Read the article

• How to Best Setup a Website Project in VS.NET

  - by Jason

  I have very little experience with setting up a website from scratch in a .NET environment. As I am doing this now, I am wondering - what's the best way to go? Is it better to create a new Website Project, and include the various backend services and database code as part of that project, or is it better to split out the various aspects of the project? If the second, how would I go about doing that? I want to ensure that this project is easy to manage in the future (in terms of source control, deployment, etc), so I want to make sure I'm starting off on the right foot. I was unable to find any tutorials online, but if you have any, I would appreciate those as well. Thanks!

  Read the article

• Looking for an example of selecting a row(s) with multiple columns from a grid view and add them to

  Here is the situation dealing with a vb.net website, I have students who will be enrolled into a course. The student grid view has many columns like client_no, student_name, date_of_birth, address, etc. There are over 100000 students so I will need to filter the student grid view to find the correct student to enroll in the course. Once they are found, the user selects them and somehow moves them to the enrolled grid view. If a student drops out then they would be removed from the enrolled grid view. This process needs to be easy to understand and use. Are there any examples available or other suggestions on how to do this?

  Read the article

< Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >