Search Results

Search found 16413 results on 657 pages for 'array manipulation'.

Page 389/657 | < Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >

  • How do you deserialize a collection with child collections?

    - by Stuart Helwig
    I have a collection of custom entity objects one property of which is an ArrayList of byte arrays. The custom entity is serializable and the collection property is marked with the following attributes: [XmlArray("Images"), XmlArrayItem("Image",typeof(byte[]))] So I serialize a collection of these custom entities and pass them to a web service, as a string. The web service receives the string and byte array in tact, The following code then attempts to deserialize the collection - back into custom entities for processing... XmlSerializer ser = new XmlSerializer(typeof(List<myCustomEntity>)); StringReader reader = new StringReader(xmlStringPassedToWS); List<myCustomEntity> entities = (List<myCustomEntity>)ser.Deserialize(reader); foreach (myCustomEntity e in entities) { // ...do some stuff... foreach (myChildCollection c in entities.ChildCollection { // .. do some more stuff.... } } I've checked the XML resulting from the initial serialization and it does contain byte array - the child collection, as does the StringReader built above. After the deserialization process, the resulting collection of custom entites is fine, except that each object in the collection does not contain any items in its child collection. (i.e. it doesn't get to "...do some more stuff..." above. Can someone please explain what I am doing wrong? Is it possible to serialize ArrayLists within a generic collection of custom entities?

    Read the article

  • Powershell - Using variables in -Include filter

    - by TheD
    (again!) My final question for the night. I have a function which uses the Get-ChildItem to work out the newest file within a folder. The reason being I need to find the latest incremental backup in a folder and script an EXE to mount it. However, within this same folder there are multiple backup chains for all different servers: i.e. SERVER1_C_VOL_b001_i015.spi SERVER2_D_VOL_b001_i189.spi SERVER1_C_VOL_b002_i091.spi SERVER1_E_VOL_b002_i891.spi (this is the newest file created) I want only to look at SERVER1, look at only the C_VOL and look at only b001 - nothing else. I have all these seperate components: the drive letter, the Server Name, the b00X number stored in array. How then can I go and use the Get-ChildItem with the -Include filter to only look at: .spi SERVER1 C_VOL b001 Given I have all of these separate components in an array taken from a text file: Get-Content .\PostBackupCheck-TextFile.txt | Select-Object -First $i { $a = $_ -split ' ' ; $locationArray += "$($a[0]):\$($a[1])\$($a[2])" ; $imageArray += "$($a[2])_$($a[3])_VOL_b00$($a[4])_i$($a[5]).spi" } I then go onto try and filter then and then get stuck: $latestIncremental = Get-ChildItem -Path ${shadowProtectDataLocation}\*.* -Include *.spi | Sort-Object LastAccessTime -Descending | Select-Object -First 1 I have the .spi filtered, but how can I also just include the C (for volume), the number for the b00x and the server name. Thanks!

    Read the article

  • Need Associated ID Added to a While Loop (php)

    - by user319361
    Been trying to get my head around while loops for the last few days but the code seems very inefficient for what Im trying to achieve. I'm assuming I'm overcomplicating this though nothing I've tried seems to work. Each topic in my forum can have related topic IDs stored in a seperate table. A post ID is also stored in this table, as that specific post references why they are considered related. DB Table contains only: topic_id, related_id, post_id // Get related IDs and post IDs for current topic being viewed $result = $db->query('SELECT related_id, post_id FROM related_topics WHERE topic_id='.$id.''); // If related topics found, put both of the IDs into arrays if ($db->num_rows($result)) { while($cur_related = mysql_fetch_array($result)){ $reltopicarray[] = $cur_related['related_id']; $relpost[] = $cur_related['post_id']; } // If the first array isnt empty, get some additional info about each related ID from another table if(!empty($reltopicarray)) { $pieces = $reltopicarray; $glued = "\"".implode('", "', $pieces)."\""; $fetchtopics = $db->query('SELECT id, subject, author, image, etc FROM topics WHERE id IN('.$glued.')'); } // Print each related topic while($related = mysql_fetch_array($fetchtopics)){ ?> <a href="view.php?id=<?php echo $related['id']; ?>"><?php echo $related['subject']; ?></a> by <?php echo $related['author']; ?> // Id like to show the Post ID below (from the array in the first while loop) // The below link doesnt work as Im outside the while loop by this point. <br /><a href="view.php?post_id=<?php echo $cur_related['post_id']; ?>">View Relationship</a> <?php } ?> The above currently works, however I'm trying to also display the post_id link below each related topic link, as shown above. Would be greatful if someone can lend a hand. Thanks :)

    Read the article

  • pure/const functions in C++

    - by Albert
    Hi, I'm thinking of using pure/const functions more heavily in my C++ code. (pure/const attribute in GCC) However, I am curious how strict I should be about it and what could possibly break. The most obvious case are debug outputs (in whatever form, could be on cout, in some file or in some custom debug class). I probably will have a lot of functions, which don't have any side effects despite this sort of debug output. No matter if the debug output is made or not, this will absolutely have no effect on the rest of my application. Or another case I'm thinking of is the use of my own SmartPointer class. In debug mode, my SmartPointer class has some global register where it does some extra checks. If I use such an object in a pure/const function, it does have some slight side effects (in the sense that some memory probably will be different) which should not have any real side effects though (in the sense that the behaviour is in any way different). Similar also for mutexes and other stuff. I can think of many complex cases where it has some side effects (in the sense of that some memory will be different, maybe even some threads are created, some filesystem manipulation is made, etc) but has no computational difference (all those side effects could very well be left out and I would even prefer that). How does it work out in practice? If I mark such functions as pure/const, could it break anything (considering that the code is all correct)?

    Read the article

  • Using a function found in a different file in a loop

    - by Anders
    This question is related to BuddyPress, and a follow-up question from this question I have a .csv-file with 790 rows and 3 columns where the first column is the group name, second is the group description and last (third) the slug. As far as I've been told I can use this code: <?php $groups = array(); if (($handle = fopen("groupData.csv", "r")) !== FALSE) { while (($data = fgetcsv($handle, 1000, ",")) !== FALSE) { $group = array('group_id' = 'SOME ID', 'name' = $data[0], 'description' = $data[1], 'slug' = groups_check_slug(sanitize_title(esc_attr($data[2]))), 'date_created' = gmdate( "Y-m-d H:i:s" ), 'status' = 'public' ); $groups[] = $group; } fclose($handle); } foreach ($groups as $group) { groups_create_group($group); } With http://www.nomorepasting.com/getpaste.php?pasteid=35217 which is called bp-groups.php. The thing is that I can't make it work. I've created a new file with the code written above called groupgenerator.php uploaded the .csv file to the same folder and opened groupgenerator.php in my browser. But, i get this error: Fatal error: Call to undefined function groups_check_slug() in What am I doing wrong?

    Read the article

  • scanf segfaults and various other anomalies inside while loop

    - by Shadow
    while(1){ //Command prompt char *command; printf("%s>",current_working_directory); scanf("%s",command);<--seg faults after input has been received. printf("\ncommand:%s\n",command); } I am getting a few different errors and they don't really seem reproducible(except for the segfault at this point .<). This code worked fine about 10 minutes ago, then it infinite looped the printf command and now it seg faults on the line mentioned above. The only thing I changed was scanf("%s",command); to what it currently is. If I change the command variable to be an array it works, obviously this is because the storage is set aside for it. 1) I got prosecuted about telling someone that they needed to malloc a pointer* (But that usually seems to solve the problem such as making it an array) 2) the command I am entering is "magic" 5 characters so there shouldn't be any crazy stack overflow. 3) I am running on mac OSX 10.6 with newest version of xCode(non-OS4) and standard gcc 4) this is how I compile the program: gcc --std=c99 -W sfs.c Just trying to figure out what is going on. Being this is for a school project I am never going to have to see again, I will just code some noob work around that would make my boss cry :) But for afterwards I would love to figure out why this is happening and not just make some fix for it, and if there is some fix for it why that fix works.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Referencing not-yet-defined variables - Java

    - by user2537337
    Because I'm tired of solving math problems, I decided to try something more engaging with my very rusty (and even without the rust, very basic) Java skills. I landed on a super-simple people simulator, and thus far have been having a grand time working through the various steps of getting it to function. Currently, it generates an array of people-class objects and runs a for loop to cycle through a set of actions that alter the relationships between them, which I have stored in a 2d integer array. When it ends, I go look at how much they all hate each other. Fun stuff. Trouble has arisen, however, because I would like the program to clearly print what action is happening when it happens. I thought the best way to do this would be to add a string, description, to my "action" class (which stores variables for the actor, reactor, and the amount the relationship changes). This works to a degree, in that I can print a generic message ("A fight has occurred!") with no problem. However, ideally I would like it to be a little more specific ("Person A has thrown a rock at Person B's head!"). This latter goal is proving more difficult: attempting to construct an action with a description string that references actor and reactor gets me a big old error, "Cannot reference field before it is defined." Which makes perfect sense. I believe I'm not quite in programmer mode, because the only other way I can think to do this is an unwieldy switch statement that negates the need for each action to have its own nicely-packaged description. And there must be a neater way. I am not looking for examples of code, only a push in the direction of the right concept to handle this.

    Read the article

  • Is it possible to split HTML using DOMDocument?

    - by Lynn Adrianna
    Using DOMDocument, is it possible to split a block of HTML by text wrapped in tags and those that are not, while maintaining the order? Sorry, if this doesn't make sense. My example should make it clear. Let's say I have the following block of HTML: text1<b style="color:pink">text2</b>text3<b>text4</b> <b style="font-weight:bold">text5</b> Is it possible create an array as such: array( [0] => text1 [1] => <b style="color:pink">text2</b> [2] => text3 [3] => <b>text4</b> [4] => [5] => <b style="font-weight:bold">text5</b> ) Below is my current working solution, which uses a regular expression, to split the HTML. $tokens = preg_split('/(<b\b[^>]*>.*?<\/b>)/i', $html, null, PREG_SPLIT_DELIM_CAPTURE); However, I always read that it is a bad idea to parse HTML using regular expressions, so was just wondering if there is a better way.

    Read the article

  • Symfony Form render with Self Referenced Entity

    - by benarth
    I have an Entity containing Self-Referenced mapping. class Category { /** * @var integer * * @ORM\Column(name="id", type="integer") * @ORM\Id * @ORM\GeneratedValue(strategy="AUTO") */ private $id; /** * @var string * * @ORM\Column(name="name", type="string", length=100) */ private $name; /** * @ORM\OneToMany(targetEntity="Category", mappedBy="parent") */ private $children; /** * @ORM\ManyToOne(targetEntity="Category", inversedBy="children") * @ORM\JoinColumn(name="parent_id", referencedColumnName="id") */ private $parent; } In my CategoryType I have this : public function buildForm(FormBuilderInterface $builder, array $options) { $plan = $this->plan; $builder->add('name'); $builder->add('parent', 'entity', array( 'class' => 'xxxBundle:Category', 'property' => 'name', 'empty_value' => 'Choose a parent category', 'required' => false, 'query_builder' => function(EntityRepository $er) use ($plan) { return $er->createQueryBuilder('u') ->where('u.plan = :plan') ->setParameter('plan', $plan) ->orderBy('u.id', 'ASC'); }, )); } Actually, when I render the form field Category this is something like Cat1 Cat2 Cat3 Subcat1 Subcat2 Cat4 I would like to know if it's possible and how to display something more like, a kind of a simple tree representation : Cat1 Cat2 Cat3 -- Subcat1 -- Subcat2 Cat4 Regards.

    Read the article

  • d3: Coloring Multiple Lines from Nested Data

    - by diet_coke
    I'm currently assembling some line graphs with circles at the datapoints from arrays of JSON objects formatted like so: var data = [{ "name": "metric1", "datapoints": [ [10.0, 1333519140], [48.0, 1333519200] ] }, { "name": "metric2", "datapoints": [ [48.0, 1333519200], [12.0, 1333519260] ] }] I want to have a color for each metric, so I'm trying to color them based on the index of the object within the array data. The code I have currently for just placing the circles looks like: // We bind an svg group to each metric. var metric_groups = this.vis.selectAll("g.metric_group") .data(data).enter() .append("g") .attr("class", "metric_group"); // Then bind a circle for each datapoint. var circles = metric_groups.selectAll("circle") .data(function(d) { return d.datapoints; }); circles.enter().append("circle") .attr("r", 3.5); Now if I change that last bit to something like: circles.enter().append("circle") .attr("r", 3.5); .style("fill", function(d,i) { return i%2 ? "red" : "blue"; } I get alternating red and blue circles, as could be expected. Taking some advice from Nested Selections : 'Nesting and Index', I tried: circles.enter().append("circle") .attr("r", 3.5); .style("fill", function(d,i,j) { return j%2 ? "red" : "blue"; } Which doesn't work (j is undefined), presumably because we are in the named property datapoints, rather than an array element. How might I go about doing the coloring that I want without changing my data structure? Thanks!

    Read the article

  • about c# OBJECTS and the Possibilties it has.

    - by user527825
    As a novice programmer and i always wonder about c# capabilities.i know it is still early to judge that but all i want to know is can c# do complex stuffs or something outside windows OS. 1- I think c# is a proprietary language (i don't know if i said that right) meaning you can't do it outside visual studio or windows. 2-also you cant create your own controller(called object right?) like you are forced to use these available in toolbox and their properties and methods. 3-can c# be used with openGL API or DirectX API . 4-Finally it always bothers me when i think i start doing things in visual studio, i know it sounds arrogant to say but sometimes i feel that i don't like to be forced to use something even if its helpful, like i feel (do i have the right to feel?) that i want to do all things by myself? don't laugh i just feel that this will give me a better understanding. 5- is visual c# is like using MaxScript inside 3ds max in that c# is exclusive to do windows and forms and components that are windows related and maxscript is only for 3d editing and manipulation for various things in the software. If it is too difficult for a beginner i hope you don't answer the fourth question as i don't have enough motivation and i want to keep the little i have. thank you for your time. Note: 1-sorry for my English, i am self taught and never used the language with native speakers so expect so errors. 2-i have a lot of questions regarding many things, what is the daily ratio you think for asking (number of questions) that would not bother the admins of the site and the members here. thank you for your time.

    Read the article

  • CSS style refresh in IE after dynamic removal of style link

    - by rybz
    Hi! I've got a problem with the dynamic style manipulation in IE7 (IE8 is fine). Using javascript I need to add and remove the < link / node with the definition of css file. Adding and removing the node as a child of < head / works fine under Firefox. Unfortunately, after removing it in the IE, although The tag is removed properly, the page style does not refresh. In the example below a simple css (makes background green) is appended and removed. After the removal in FF the background turns default, but in IE stays green. index.html <html> <head> </head> <script language="javascript" type="text/javascript"> var node; function append(){ var headID = document.getElementsByTagName("head")[0]; node = document.createElement('link'); node.type = 'text/css'; node.rel = 'stylesheet'; node.href = "s.css"; node.media = 'screen'; headID.appendChild(node); } function remove(){ var headID = document.getElementsByTagName("head")[0]; headID.removeChild(node); } </script> <body> <div onClick="append();"> add </div> <div onClick="remove();"> remove </div> </body> </html> And the style sheet: s.css body { background-color:#00CC33 } Here is the live example: http://rlab.pl/dynamic-style/ Is there a way to get it working?

    Read the article

  • CIE XYZ colorspace: do I have RGBA or XYZA?

    - by Tronic
    I plan to write a painting program based on linear combinations of xy plane points (0,1), (1,0) and (0,0). Such system works identically to RGB, except that the primaries are not within the gamut but at the corners of a triangle that encloses the entire gamut. I have seen the three points being referred to as X, Y and Z (upper case) somewhere, but I cannot find the page anymore (I marked them to the picture myself). My pixel format stores the intensity of each of those three components the same way as RGB does, together with alpha value. This allows using pretty much any image manipulation operation designed for RGBA without modifying the code. What is my format called? Is it XYZA, RGBA or something else? Google doesn't seem to know of XYZA. RGBA will get confused with sRGB + alpha (which I also need to use in the same program). Notice that the primaries X, Y and Z and their intensities have little to do with the x, y and z coordinates (lower case) that are more commonly used.

    Read the article

  • I want to input JSONObject from jquery.post() to a a simple JS chart(bar chart)?

    - by ann-stack
    HI I am very new to both json and js charts. In the example of bar chart, they are giving a hard coded array like this, var myData = new Array(['U.S.A.', 69.5], ['Canada', 2.8], ['Japan & SE.Asia', 5.6] ); var myChart = new JSChart('graph', 'bar'); myChart.setDataArray(myData); Instead of that I want to use the response of $.post() method which is in json. Here is the piece of code. var myData=[]; $.post("JSONServlet", function(data) { $.each(data.Userdetails, function(i, data) { myData[i] = []; myData[i]['text'] = data['firstname']; myData[i]['id'] = data['ssn']; alert("first name " +myData[i]['text']+ " salary " +myData[i]['id']); // I am getting correct data here, but how to assign this myData to barchart }); }, "json"); is this the logic to use or how else can i get username and salary from the response and pass it to the barchart. Please help. I am stuck with this. thanks in advance.

    Read the article

  • Python optimization problem?

    - by user342079
    Alright, i had this homework recently (don't worry, i've already done it, but in c++) but I got curious how i could do it in python. The problem is about 2 light sources that emit light. I won't get into details tho. Here's the code (that I've managed to optimize a bit in the latter part): import math, array import numpy as np from PIL import Image size = (800,800) width, height = size s1x = width * 1./8 s1y = height * 1./8 s2x = width * 7./8 s2y = height * 7./8 r,g,b = (255,255,255) arr = np.zeros((width,height,3)) hy = math.hypot print 'computing distances (%s by %s)'%size, for i in xrange(width): if i%(width/10)==0: print i, if i%20==0: print '.', for j in xrange(height): d1 = hy(i-s1x,j-s1y) d2 = hy(i-s2x,j-s2y) arr[i][j] = abs(d1-d2) print '' arr2 = np.zeros((width,height,3),dtype="uint8") for ld in [200,116,100,84,68,52,36,20,8,4,2]: print 'now computing image for ld = '+str(ld) arr2 *= 0 arr2 += abs(arr%ld-ld/2)*(r,g,b)/(ld/2) print 'saving image...' ar2img = Image.fromarray(arr2) ar2img.save('ld'+str(ld).rjust(4,'0')+'.png') print 'saved as ld'+str(ld).rjust(4,'0')+'.png' I have managed to optimize most of it, but there's still a huge performance gap in the part with the 2 for-s, and I can't seem to think of a way to bypass that using common array operations... I'm open to suggestions :D

    Read the article

  • How do I optimize this postfix expression tree for speed?

    - by Peter Stewart
    Thanks to the help I received in this post: I have a nice, concise recursive function to traverse a tree in postfix order: deque <char*> d; void Node::postfix() { if (left != __nullptr) { left->postfix(); } if (right != __nullptr) { right->postfix(); } d.push_front(cargo); return; }; This is an expression tree. The branch nodes are operators randomly selected from an array, and the leaf nodes are values or the variable 'x', also randomly selected from an array. char *values[10]={"1.0","2.0","3.0","4.0","5.0","6.0","7.0","8.0","9.0","x"}; char *ops[4]={"+","-","*","/"}; As this will be called billions of times during a run of the genetic algorithm of which it is a part, I'd like to optimize it for speed. I have a number of questions on this topic which I will ask in separate postings. The first is: how can I get access to each 'cargo' as it is found. That is: instead of pushing 'cargo' onto a deque, and then processing the deque to get the value, I'd like to start processing it right away. I don't yet know about parallel processing in c++, but this would ideally be done concurrently on two different processors. In python, I'd make the function a generator and access succeeding 'cargo's using .next(). But I'm using c++ to speed up the python implementation. I'm thinking that this kind of tree has been around for a long time, and somebody has probably optimized it already. Any Ideas? Thanks

    Read the article

  • Swt file dialog too much files selected?

    - by InsertNickHere
    Hi there, the swt file dialog will give me an empty result array if I select too much files (approx. 2500files). The listing shows you how I use this dialog. If i select too many sound files, the syso will show 0. Debugging tells me, that the files array is empty in this case. Is there any way to get this work? FileDialog fileDialog = new FileDialog(mainView.getShell(), SWT.MULTI); fileDialog.setText("Choose sound files"); fileDialog.setFilterExtensions(new String[] { new String("*.wav") }); Vector<String> result = new Vector<String>(); fileDialog.open(); String[] files = fileDialog.getFileNames(); for (int i = 0, n = files.length; i < n; i++) { if( !files[i].contains(".wav")) { System.out.println(files[i]); } StringBuffer stringBuffer = new StringBuffer(); stringBuffer.append(fileDialog.getFilterPath()); if (stringBuffer.charAt(stringBuffer.length() - 1) != File.separatorChar) { stringBuffer.append(File.separatorChar); } stringBuffer.append(files[i]); stringBuffer.append(""); String finalName = stringBuffer.toString(); if( !finalName.contains(".wav")) { System.out.println(finalName); } result.add(finalName); } System.out.println(result.size()) ;

    Read the article

  • PHP URL parameters append return special character

    - by Alexandre Lavoie
    I'm programming a function to build an URL, here it is : public static function requestContent($p_lParameters) { $sParameters = "?key=TEST&format=json&jsoncallback=none"; foreach($p_lParameters as $sParameterName => $sParameterValue) { $sParameters .= "&$sParameterName=$sParameterValue"; } echo "<span style='font-size: 16px;'>URL : http://api.oodle.com/api/v2/listings" . $sParameters . "</span><br />"; $aXMLData = file_get_contents("http://api.oodle.com/api/v2/listings" . $sParameters); return json_decode($aXMLData,true); } And I am calling this function with this array list : print_r() result : Array ( [region] => canada [category] => housing/sale/home ) But this is very strange I get an unexpected character (note the special character none*®*ion) : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home For information I use this header : <meta http-equiv="Content-Type" content="text/html;charset=UTF-8" /> <?php header('Content-Type: text/html;charset=UTF-8'); ?> EDIT : $sRequest = "http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none&region=canada&category=housing/sale/home"; echo "<span style='font-size: 16px;'>URL : " . $sRequest . "</span><br />"; return the exact URL with problem : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home Thank you for your help!

    Read the article

  • Subset and lagging list data structure R

    - by user1234440
    I have a list that is indexed like the following: >list.stuff [[1]] [[1]]$vector ... [[1]]$matrix .... [[1]]$vector [[2]] null [[3]] [[3]]$vector ... [[3]]$matrix .... [[3]]$vector . . . Each segment in the list is indexed according to another vector of indexes: >index.list 1, 3, 5, 10, 15 In list.stuff, only at each of the indexes 1,3,5,10,15 will there be 2 vectors and one matrix; everything else will be null like [[2]]. What I want to do is to lag like the lag.xts function so that whatever is stored in [[1]] will be pushed to [[3]] and the last one drops off. This also requires subsetting the list, if its possible. I was wondering if there exists some functions that handle list manipulation. My thinking is that for xts, a time series can be extracted based on an index you supply: xts.object[index,] #returns the rows 1,3,5,10,15 From here I can lag it with: lag.xts(xts.object[index,]) Any help would be appreciated thanks: EDIT: Here is a reproducible example: list.stuff<-list() vec<-c(1,2,3,4,5,6,7,8,9) vec2<-c(1,2,3,4,5,6,7,8,9) mat<-matrix(c(1,2,3,4,5,6,7,8),4,2) list.vec.mat<-list(vec=vec,mat=mat,vec2=vec2) ind<-c(2,4,6,8,10) for(i in ind){ list.stuff[[i]]<-list.vec.mat }

    Read the article

  • JNI Stream binary data from C++ to Java

    - by Cliff
    I need help passing binary data into Java. I'm trying to use jbytearray but when the data gets into Java it appears corrupt. Can somebody give me a hand? Here's a snip of some example code. First the native C++ side: printf("Building audio array copy\n"); jbyteArray rawAudioCopy = env-NewByteArray(10); jbyte toCopy[10]; printf("Filling audio array copy\n"); char theBytes[10] = {0,1,2,3,4,5,6,7,8,9}; for (int i = 0; i < sizeof(theBytes); i++) { toCopy[i] = theBytes[i]; } env->SetByteArrayRegion(rawAudioCopy,0,10,toCopy); printf("Finding object callback\n"); jmethodID aMethodId = env->GetMethodID(env->GetObjectClass(obj),"handleAudio","([B)V"); if(0==aMethodId) throw MyRuntimeException("Method not found error",99); printf("Invoking the callback\n"); env->CallVoidMethod(obj,aMethodId, &rawAudioCopy); and then the Java callback method: public void handleAudio(byte[] audio){ System.out.println("Audio supplied to Java [" + audio.length + "] bytes"); byte[] expectedAudio = {0,1,2,3,4,5,6,7,8,9}; for (int i = 0; i < audio.length; i++) { if(audio[i]!= expectedAudio[i]) System.err.println("Expected byte " + expectedAudio[i] + " at byte " + i + " but got byte " + audio[i]); else System.out.print('.'); } System.out.println("Audio passed back accordingly!"); } I get the following output when the callback is invoked: library loaded! Audio supplied to Java [-2019659176] bytes Audio passed back accordingly!

    Read the article

  • How do I interact with a Perl object that has a hash attribute?

    - by brydgesk
    I have a class with several variables, one of which is a hash (_runs): sub new { my ($class, $name) = @_; my $self = { _name => $name, ... _runs => (), _times => [], ... }; bless ($self, $class); return $self; } Now, all I'm trying to do is create an accessor/mutator, as well as another subroutine that pushes new data into the hash. But I'm having a hell of a time getting all the referencing/dereferencing/$self calls working together. I've about burned my eyes out with "Can't use string ("blah") as a HASH ref etc etc" errors. For the accessor, what is 'best practice' for returning hashes? Which one of these options should I be using (if any)?: return $self->{_runs}; return %{ $self->{_runs} }; return \$self->{_runs}; Further, when I'm using the hash within other subroutines in the class, what syntax do I use to copy it? my @runs = $self->{_runs}; my @runs = %{ $self->{_runs} }; my @runs = $%{ $self->{_runs} }; my @runs = $$self->{_runs}; Same goes for iterating over the keys: foreach my $dt (keys $self->{_runs}) foreach my $dt (keys %{ $self->{_runs} }) And how about actually adding the data? $self->{_runs}{$dt} = $duration; %{ $self->{_runs} }{$dt} = $duration; $$self->{_runs}{$dt} = $duration; You get the point. I've been reading articles about using classes, and articles about referencing and dereferencing, but I can't seem to get my brain to combine the knowledge and use both at the same time. I got my _times array working finally, but mimicking my array syntax over to hashes didn't work.

    Read the article

  • Overloading generic implicit conversions

    - by raichoo
    Hi I'm having a little scala (version 2.8.0RC1) problem with implicit conversions. Whenever importing more than one implicit conversion the first one gets shadowed. Here is the code where the problem shows up: // containers class Maybe[T] case class Nothing[T]() extends Maybe[T] case class Just[T](value: T) extends Maybe[T] case class Value[T](value: T) trait Monad[C[_]] { def >>=[A, B](a: C[A], f: A => C[B]): C[B] def pure[A](a: A): C[A] } // implicit converter trait Extender[C[_]] { class Wrapper[A](c: C[A]) { def >>=[B](f: A => C[B])(implicit m: Monad[C]): C[B] = { m >>= (c, f) } def >>[B](b: C[B])(implicit m: Monad[C]): C[B] = { m >>= (c, { (x: A) => b } ) } } implicit def extendToMonad[A](c: C[A]) = new Wrapper[A](c) } // instance maybe object maybemonad extends Extender[Maybe] { implicit object MaybeMonad extends Monad[Maybe] { override def >>=[A, B](a: Maybe[A], f: A => Maybe[B]): Maybe[B] = { a match { case Just(x) => f(x) case Nothing() => Nothing() } } override def pure[A](a: A): Maybe[A] = Just(a) } } // instance value object identitymonad extends Extender[Value] { implicit object IdentityMonad extends Monad[Value] { override def >>=[A, B](a: Value[A], f: A => Value[B]): Value[B] = { a match { case Value(x) => f(x) } } override def pure[A](a: A): Value[A] = Value(a) } } import maybemonad._ //import identitymonad._ object Main { def main(args: Array[String]): Unit = { println(Just(1) >>= { (x: Int) => MaybeMonad.pure(x) }) } } When uncommenting the second import statement everything goes wrong since the first "extendToMonad" is shadowed. However, this one works: object Main { implicit def foo(a: Int) = new { def foobar(): Unit = { println("Foobar") } } implicit def foo(a: String) = new { def foobar(): Unit = { println(a) } } def main(args: Array[String]): Unit = { 1 foobar() "bla" foobar() } } So, where is the catch? What am I missing? Regards, raichoo

    Read the article

  • Deserialize json with json.net c#

    - by 76mel
    Hi, am new to Json so a little green. I have a Rest Based Service that returns a json string; {"treeNode":[{"id":"U-2905","pid":"R","userId":"2905"}, {"id":"U-2905","pid":"R","userId":"2905"}]} I have been playing with the Json.net and trying to Deserialize the string into Objects etc. I wrote an extention method to help. public static T DeserializeFromJSON<T>(this Stream jsonStream, Type objectType) { T result; using (StreamReader reader = new StreamReader(jsonStream)) { JsonSerializer serializer = new JsonSerializer(); try { result = (T)serializer.Deserialize(reader, objectType); } catch (Exception e) { throw; } } return result; } I was expecting an array of treeNode[] objects. But its seems that I can only deserialize correctly if treeNode[] property of another object. public class treeNode { public string id { get; set; } public string pid { get; set; } public string userId { get; set; } } I there a way to to just get an straight array from the deserialization ? Cheers

    Read the article

  • Creating a RESTful API - HELP!

    - by Martin Cox
    Hi Chaps Over the last few weeks I've been learning about iOS development, which has naturally led me into the world of APIs. Now, searching around on the Internet, I've come to the conclusion that using the REST architecture is very much recommended - due to it's supposed simplicity and ease of implementation. However, I'm really struggling with the implementation side of REST. I understand the concept; using HTTP methods as verbs to describe the action of a request and responding with suitable response codes, and so on. It's just, I don't understand how to code it. I don't get how I map a URI to an object. I understand that a GET request for domain.com/api/user/address?user_id=999 would return the address of user 999 - but I don't understand where or how that mapping from /user/address to some method that queries a database has taken place. Is this all coded in one php script? Would I just have a method that grabs the URI like so: $array = explode("/", ltrim(rtrim($_SERVER['REQUEST_URI'], "/"), "/")) And then cycle through that array, first I would have a request for a "user", so the PHP script would direct my request to the user object and then invoke the address method. Is that what actually happens? I've probably not explained my thought process very well there. The main thing I'm not getting is how that URI /user/address?id=999 somehow is broken down and executed - does it actually resolve to code? class user(id) { address() { //get user address } } I doubt I'm making sense now, so I'll call it a day trying to explain further. I hope someone out there can understand what I'm trying to say! Thanks Chaps, look forward to your responses. Martin p.s - I'm not a developer yet, I'm learning :)

    Read the article

< Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >