Search Results

Search found 16413 results on 657 pages for 'array manipulation'.

Page 389/657 | < Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >

  • beforeClose not working in jGrowl?

    - by sparkymark75
    I have the following code which pulls json data from an ASP.NET page and displays these as notifications. The code will also take a note of what's been pulled through and store it in an array to prevent it being shown again in the same session. I'm now trying to implement functionality so that when the user closes a message, it's ID is recorded in a cookie to prevent it ever being shown again. To do this, I'm trying to write to the cookie when the beforeClose event fires. Everything else works fine apart from the saving to a cookie bit. Is there something wrong with my code that I'm missing? var alreadyGrowled = new Array(); var noteCookie = $.cookie("notificationsViewed"); if (noteCookie != null) { alreadyGrowled = noteCookie.split(","); } function growlCheckNew() { $.getJSON('getNotifications.aspx', function(data) { $(data).each(function(entryIndex, entry) { var newMessage = true; $(alreadyGrowled).each(function(index, msg_id) { if (entry['ID'] == msg_id) { newMessage = false; } }); if (newMessage == true) { $.jGrowl(entry['Message'], { sticky: true, header: entry['Title'], beforeClose: function(e, m) { $.cookie("notificationsViewed", entry['ID']); } }); } alreadyGrowled.push(entry['ID']); }); }); }

    Read the article

  • Program repeats each time a character is scanned .. How to stop it ?

    - by ZaZu
    Hello there, I have a program that has this code : #include<stdio.h> main(){ int input; char g; do{ printf("Choose a numeric value"); printf(">"); scanf("\n%c",&input); g=input-'0'; }while((g>=-16 && g<=-1)||(g>=10 && g<=42)||(g>=43 && g<=79)); } It basically uses ASCII manipulation to allow the program to accept numbers only .. '0' is given the value 48 by default...the ASCII value - 48 gives a ranges of numbers above (in the while statement) Anyway, whenever a user inputs numbers AND alphabets, such as : abr39293afakvmienb23 The program ignores : a,b,r .. But takes '3' as the first input. For a b and r, the code under the do loop repeats. So for the above example, I get : Choose a numeric value >Choose a numeric value> Choose a numeric value >3 Is there a way I can stop this ??? I tried using \n%c to scan the character and account for whitespace, but that didnt work :( Please help thank you very much !

    Read the article

  • Can't use my form

    - by Alexandr
    I have class with my form in folder /application/forms/Auth.php it looks like class Form_Auth extends Zend_Form { public function __construct() { $this->setName(); parent::__construct(); $username = new Zend_Form_Element_Text('username'); $password = new Zend_Form_Element_Password('password'); $mail = new Zend_Form_Element_Text('mail'); $submit = new Zend_Form_Element_Submit('submit'); $this->addElements(array($username,$password,$mail,$submit)); } } When i try create object $this->view->form = new Form_Auth(); is see exeption Application error Exception information: Message: Invalid name provided; must contain only valid variable characters and be non-empty Stack trace: D:\WWW\zends\application\Forms\Auth.php(8): Zend_Form-setName() d:\WWW\zends\application\controllers\RegistrationController.php(49): Form_Auth-__construct() D:\WebServer\ZendFramework\ZendFramework\library\Zend\Controller\Action.php(513): RegistrationController-indexAction() D:\WebServer\ZendFramework\ZendFramework\library\Zend\Controller\Dispatcher\Standard.php(289): Zend_Controller_Action-dispatch('indexAction') D:\WebServer\ZendFramework\ZendFramework\library\Zend\Controller\Front.php(954): Zend_Controller_Dispatcher_Standard-dispatch(Object(Zend_Controller_Request_Http), Object(Zend_Controller_Response_Http)) D:\WebServer\ZendFramework\ZendFramework\library\Zend\Application\Bootstrap\Bootstrap.php(97): Zend_Controller_Front-dispatch() D:\WebServer\ZendFramework\ZendFramework\library\Zend\Application.php(366): Zend_Application_Bootstrap_Bootstrap-run() D:\WWW\zends\public\index.php(26): Zend_Application-run() {main} Request Parameters: array ( 'controller' = 'registration', 'action' = 'index', 'module' = 'default', ) the version zf is 1.10.3 what i do wrong ?

    Read the article

  • JNI Stream binary data from C++ to Java

    - by Cliff
    I need help passing binary data into Java. I'm trying to use jbytearray but when the data gets into Java it appears corrupt. Can somebody give me a hand? Here's a snip of some example code. First the native C++ side: printf("Building audio array copy\n"); jbyteArray rawAudioCopy = env-NewByteArray(10); jbyte toCopy[10]; printf("Filling audio array copy\n"); char theBytes[10] = {0,1,2,3,4,5,6,7,8,9}; for (int i = 0; i < sizeof(theBytes); i++) { toCopy[i] = theBytes[i]; } env->SetByteArrayRegion(rawAudioCopy,0,10,toCopy); printf("Finding object callback\n"); jmethodID aMethodId = env->GetMethodID(env->GetObjectClass(obj),"handleAudio","([B)V"); if(0==aMethodId) throw MyRuntimeException("Method not found error",99); printf("Invoking the callback\n"); env->CallVoidMethod(obj,aMethodId, &rawAudioCopy); and then the Java callback method: public void handleAudio(byte[] audio){ System.out.println("Audio supplied to Java [" + audio.length + "] bytes"); byte[] expectedAudio = {0,1,2,3,4,5,6,7,8,9}; for (int i = 0; i < audio.length; i++) { if(audio[i]!= expectedAudio[i]) System.err.println("Expected byte " + expectedAudio[i] + " at byte " + i + " but got byte " + audio[i]); else System.out.print('.'); } System.out.println("Audio passed back accordingly!"); } I get the following output when the callback is invoked: library loaded! Audio supplied to Java [-2019659176] bytes Audio passed back accordingly!

    Read the article

  • scanf segfaults and various other anomalies inside while loop

    - by Shadow
    while(1){ //Command prompt char *command; printf("%s>",current_working_directory); scanf("%s",command);<--seg faults after input has been received. printf("\ncommand:%s\n",command); } I am getting a few different errors and they don't really seem reproducible(except for the segfault at this point .<). This code worked fine about 10 minutes ago, then it infinite looped the printf command and now it seg faults on the line mentioned above. The only thing I changed was scanf("%s",command); to what it currently is. If I change the command variable to be an array it works, obviously this is because the storage is set aside for it. 1) I got prosecuted about telling someone that they needed to malloc a pointer* (But that usually seems to solve the problem such as making it an array) 2) the command I am entering is "magic" 5 characters so there shouldn't be any crazy stack overflow. 3) I am running on mac OSX 10.6 with newest version of xCode(non-OS4) and standard gcc 4) this is how I compile the program: gcc --std=c99 -W sfs.c Just trying to figure out what is going on. Being this is for a school project I am never going to have to see again, I will just code some noob work around that would make my boss cry :) But for afterwards I would love to figure out why this is happening and not just make some fix for it, and if there is some fix for it why that fix works.

    Read the article

  • about c# OBJECTS and the Possibilties it has.

    - by user527825
    As a novice programmer and i always wonder about c# capabilities.i know it is still early to judge that but all i want to know is can c# do complex stuffs or something outside windows OS. 1- I think c# is a proprietary language (i don't know if i said that right) meaning you can't do it outside visual studio or windows. 2-also you cant create your own controller(called object right?) like you are forced to use these available in toolbox and their properties and methods. 3-can c# be used with openGL API or DirectX API . 4-Finally it always bothers me when i think i start doing things in visual studio, i know it sounds arrogant to say but sometimes i feel that i don't like to be forced to use something even if its helpful, like i feel (do i have the right to feel?) that i want to do all things by myself? don't laugh i just feel that this will give me a better understanding. 5- is visual c# is like using MaxScript inside 3ds max in that c# is exclusive to do windows and forms and components that are windows related and maxscript is only for 3d editing and manipulation for various things in the software. If it is too difficult for a beginner i hope you don't answer the fourth question as i don't have enough motivation and i want to keep the little i have. thank you for your time. Note: 1-sorry for my English, i am self taught and never used the language with native speakers so expect so errors. 2-i have a lot of questions regarding many things, what is the daily ratio you think for asking (number of questions) that would not bother the admins of the site and the members here. thank you for your time.

    Read the article

  • CIE XYZ colorspace: do I have RGBA or XYZA?

    - by Tronic
    I plan to write a painting program based on linear combinations of xy plane points (0,1), (1,0) and (0,0). Such system works identically to RGB, except that the primaries are not within the gamut but at the corners of a triangle that encloses the entire gamut. I have seen the three points being referred to as X, Y and Z (upper case) somewhere, but I cannot find the page anymore (I marked them to the picture myself). My pixel format stores the intensity of each of those three components the same way as RGB does, together with alpha value. This allows using pretty much any image manipulation operation designed for RGBA without modifying the code. What is my format called? Is it XYZA, RGBA or something else? Google doesn't seem to know of XYZA. RGBA will get confused with sRGB + alpha (which I also need to use in the same program). Notice that the primaries X, Y and Z and their intensities have little to do with the x, y and z coordinates (lower case) that are more commonly used.

    Read the article

  • How to implement a simple queue properly?

    - by Stephen Hsu
    The current Go library doesn't provide the queue container. To implement a simple queue, I use circle array as the underlying data structure. It follows algorithms mentioned in TAOCP: Insert Y into queue X: X[R]<-Y; R<-(R+1)%M; if R=F then OVERFLOW. Delete Y from queue X: if F=R then UNDERFLOW; Y<-X[F]; F<-(F+1) % M. F: Front, R: Rear, M: Array length. Following is the code: package main import ( "fmt" ) type Queue struct { len int head, tail int q []int } func New(n int) *Queue { return &Queue{n, 0, 0, make([]int, n)} } func (p *Queue) Enqueue(x int) bool { p.q[p.tail] = x p.tail = (p.tail + 1) % p.len return p.head != p.tail } func (p *Queue) Dequeue() (int, bool) { if p.head == p.tail { return 0, false } x := p.q[p.head] p.head = (p.head + 1) % p.len return x, true } func main() { q := New(10) for i := 1; i < 13; i++ { fmt.Println(i, q.Enqueue(i)) } fmt.Println() for i := 1; i < 13; i++ { fmt.Println(q.Dequeue()) } } But the output is obviously wrong: 1 true 2 true 3 true 4 true 5 true 6 true 7 true 8 true 9 true 10 false 11 true 12 true 11 true 12 true 0 false 0 false 0 false 0 false 0 false 0 false 0 false 0 false 0 false 0 false I think I need one more field to make the code work properly. What do you suggest?

    Read the article

  • Swt file dialog too much files selected?

    - by InsertNickHere
    Hi there, the swt file dialog will give me an empty result array if I select too much files (approx. 2500files). The listing shows you how I use this dialog. If i select too many sound files, the syso will show 0. Debugging tells me, that the files array is empty in this case. Is there any way to get this work? FileDialog fileDialog = new FileDialog(mainView.getShell(), SWT.MULTI); fileDialog.setText("Choose sound files"); fileDialog.setFilterExtensions(new String[] { new String("*.wav") }); Vector<String> result = new Vector<String>(); fileDialog.open(); String[] files = fileDialog.getFileNames(); for (int i = 0, n = files.length; i < n; i++) { if( !files[i].contains(".wav")) { System.out.println(files[i]); } StringBuffer stringBuffer = new StringBuffer(); stringBuffer.append(fileDialog.getFilterPath()); if (stringBuffer.charAt(stringBuffer.length() - 1) != File.separatorChar) { stringBuffer.append(File.separatorChar); } stringBuffer.append(files[i]); stringBuffer.append(""); String finalName = stringBuffer.toString(); if( !finalName.contains(".wav")) { System.out.println(finalName); } result.add(finalName); } System.out.println(result.size()) ;

    Read the article

  • PHP URL parameters append return special character

    - by Alexandre Lavoie
    I'm programming a function to build an URL, here it is : public static function requestContent($p_lParameters) { $sParameters = "?key=TEST&format=json&jsoncallback=none"; foreach($p_lParameters as $sParameterName => $sParameterValue) { $sParameters .= "&$sParameterName=$sParameterValue"; } echo "<span style='font-size: 16px;'>URL : http://api.oodle.com/api/v2/listings" . $sParameters . "</span><br />"; $aXMLData = file_get_contents("http://api.oodle.com/api/v2/listings" . $sParameters); return json_decode($aXMLData,true); } And I am calling this function with this array list : print_r() result : Array ( [region] => canada [category] => housing/sale/home ) But this is very strange I get an unexpected character (note the special character none*®*ion) : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home For information I use this header : <meta http-equiv="Content-Type" content="text/html;charset=UTF-8" /> <?php header('Content-Type: text/html;charset=UTF-8'); ?> EDIT : $sRequest = "http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none&region=canada&category=housing/sale/home"; echo "<span style='font-size: 16px;'>URL : " . $sRequest . "</span><br />"; return the exact URL with problem : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home Thank you for your help!

    Read the article

  • How to change value inside a JSON string.

    - by Jeremy Roy
    I have a JSON string array of objects like this. [{"id":"4","rank":"adm","title":"title 1"}, {"id":"2","rank":"mod","title":"title 2"}, {"id":"5","rank":"das","title":"title 3"}, {"id":"1","rank":"usr","title":"title 4"}, {"id":"3","rank":"ref","title":"title 5"}] I want to change the title value of it, once the id is matching. So if my variable myID is 5, I want to change the title "title 5" to new title, and so on. And then I get the new JSON array to $("#rangArray").val(jsonStr); Something like $.each(jsonStr, function(k,v) { if (v==myID) { this.title='new title'; $("#myTextArea").val(jsonStr); } }); Here is the full code. $('img.delete').click(function() { var deltid = $(this).attr("id").split('_'); var newID = deltid[1]; var jsonStr = JSON.stringify(myArray); $.each(jsonStr, function(k,v) { if (v==newID) { // how to change the title jsonStr[k].title = 'new title'; alert(jsonStr); $("#rangArray").val(jsonStr); } }); }); The above is not working. Any help please?

    Read the article

  • How do you deserialize a collection with child collections?

    - by Stuart Helwig
    I have a collection of custom entity objects one property of which is an ArrayList of byte arrays. The custom entity is serializable and the collection property is marked with the following attributes: [XmlArray("Images"), XmlArrayItem("Image",typeof(byte[]))] So I serialize a collection of these custom entities and pass them to a web service, as a string. The web service receives the string and byte array in tact, The following code then attempts to deserialize the collection - back into custom entities for processing... XmlSerializer ser = new XmlSerializer(typeof(List<myCustomEntity>)); StringReader reader = new StringReader(xmlStringPassedToWS); List<myCustomEntity> entities = (List<myCustomEntity>)ser.Deserialize(reader); foreach (myCustomEntity e in entities) { // ...do some stuff... foreach (myChildCollection c in entities.ChildCollection { // .. do some more stuff.... } } I've checked the XML resulting from the initial serialization and it does contain byte array - the child collection, as does the StringReader built above. After the deserialization process, the resulting collection of custom entites is fine, except that each object in the collection does not contain any items in its child collection. (i.e. it doesn't get to "...do some more stuff..." above. Can someone please explain what I am doing wrong? Is it possible to serialize ArrayLists within a generic collection of custom entities?

    Read the article

  • CSS style refresh in IE after dynamic removal of style link

    - by rybz
    Hi! I've got a problem with the dynamic style manipulation in IE7 (IE8 is fine). Using javascript I need to add and remove the < link / node with the definition of css file. Adding and removing the node as a child of < head / works fine under Firefox. Unfortunately, after removing it in the IE, although The tag is removed properly, the page style does not refresh. In the example below a simple css (makes background green) is appended and removed. After the removal in FF the background turns default, but in IE stays green. index.html <html> <head> </head> <script language="javascript" type="text/javascript"> var node; function append(){ var headID = document.getElementsByTagName("head")[0]; node = document.createElement('link'); node.type = 'text/css'; node.rel = 'stylesheet'; node.href = "s.css"; node.media = 'screen'; headID.appendChild(node); } function remove(){ var headID = document.getElementsByTagName("head")[0]; headID.removeChild(node); } </script> <body> <div onClick="append();"> add </div> <div onClick="remove();"> remove </div> </body> </html> And the style sheet: s.css body { background-color:#00CC33 } Here is the live example: http://rlab.pl/dynamic-style/ Is there a way to get it working?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Powershell - Using variables in -Include filter

    - by TheD
    (again!) My final question for the night. I have a function which uses the Get-ChildItem to work out the newest file within a folder. The reason being I need to find the latest incremental backup in a folder and script an EXE to mount it. However, within this same folder there are multiple backup chains for all different servers: i.e. SERVER1_C_VOL_b001_i015.spi SERVER2_D_VOL_b001_i189.spi SERVER1_C_VOL_b002_i091.spi SERVER1_E_VOL_b002_i891.spi (this is the newest file created) I want only to look at SERVER1, look at only the C_VOL and look at only b001 - nothing else. I have all these seperate components: the drive letter, the Server Name, the b00X number stored in array. How then can I go and use the Get-ChildItem with the -Include filter to only look at: .spi SERVER1 C_VOL b001 Given I have all of these separate components in an array taken from a text file: Get-Content .\PostBackupCheck-TextFile.txt | Select-Object -First $i { $a = $_ -split ' ' ; $locationArray += "$($a[0]):\$($a[1])\$($a[2])" ; $imageArray += "$($a[2])_$($a[3])_VOL_b00$($a[4])_i$($a[5]).spi" } I then go onto try and filter then and then get stuck: $latestIncremental = Get-ChildItem -Path ${shadowProtectDataLocation}\*.* -Include *.spi | Sort-Object LastAccessTime -Descending | Select-Object -First 1 I have the .spi filtered, but how can I also just include the C (for volume), the number for the b00x and the server name. Thanks!

    Read the article

  • Referencing not-yet-defined variables - Java

    - by user2537337
    Because I'm tired of solving math problems, I decided to try something more engaging with my very rusty (and even without the rust, very basic) Java skills. I landed on a super-simple people simulator, and thus far have been having a grand time working through the various steps of getting it to function. Currently, it generates an array of people-class objects and runs a for loop to cycle through a set of actions that alter the relationships between them, which I have stored in a 2d integer array. When it ends, I go look at how much they all hate each other. Fun stuff. Trouble has arisen, however, because I would like the program to clearly print what action is happening when it happens. I thought the best way to do this would be to add a string, description, to my "action" class (which stores variables for the actor, reactor, and the amount the relationship changes). This works to a degree, in that I can print a generic message ("A fight has occurred!") with no problem. However, ideally I would like it to be a little more specific ("Person A has thrown a rock at Person B's head!"). This latter goal is proving more difficult: attempting to construct an action with a description string that references actor and reactor gets me a big old error, "Cannot reference field before it is defined." Which makes perfect sense. I believe I'm not quite in programmer mode, because the only other way I can think to do this is an unwieldy switch statement that negates the need for each action to have its own nicely-packaged description. And there must be a neater way. I am not looking for examples of code, only a push in the direction of the right concept to handle this.

    Read the article

  • How do I optimize this postfix expression tree for speed?

    - by Peter Stewart
    Thanks to the help I received in this post: I have a nice, concise recursive function to traverse a tree in postfix order: deque <char*> d; void Node::postfix() { if (left != __nullptr) { left->postfix(); } if (right != __nullptr) { right->postfix(); } d.push_front(cargo); return; }; This is an expression tree. The branch nodes are operators randomly selected from an array, and the leaf nodes are values or the variable 'x', also randomly selected from an array. char *values[10]={"1.0","2.0","3.0","4.0","5.0","6.0","7.0","8.0","9.0","x"}; char *ops[4]={"+","-","*","/"}; As this will be called billions of times during a run of the genetic algorithm of which it is a part, I'd like to optimize it for speed. I have a number of questions on this topic which I will ask in separate postings. The first is: how can I get access to each 'cargo' as it is found. That is: instead of pushing 'cargo' onto a deque, and then processing the deque to get the value, I'd like to start processing it right away. I don't yet know about parallel processing in c++, but this would ideally be done concurrently on two different processors. In python, I'd make the function a generator and access succeeding 'cargo's using .next(). But I'm using c++ to speed up the python implementation. I'm thinking that this kind of tree has been around for a long time, and somebody has probably optimized it already. Any Ideas? Thanks

    Read the article

  • Is it a good idea to use an integer column for storing US ZIP codes in a database?

    - by Yadyn
    From first glance, it would appear I have two basic choices for storing ZIP codes in a database table: Text (probably most common), i.e. char(5) or varchar(9) to support +4 extension Numeric, i.e. 32-bit integer Both would satisfy the requirements of the data, if we assume that there are no international concerns. In the past we've generally just gone the text route, but I was wondering if anyone does the opposite? Just from brief comparison it looks like the integer method has two clear advantages: It is, by means of its nature, automatically limited to numerics only (whereas without validation the text style could store letters and such which are not, to my knowledge, ever valid in a ZIP code). This doesn't mean we could/would/should forgo validating user input as normal, though! It takes less space, being 4 bytes (which should be plenty even for 9-digit ZIP codes) instead of 5 or 9 bytes. Also, it seems like it wouldn't hurt display output much. It is trivial to slap a ToString() on a numeric value, use simple string manipulation to insert a hyphen or space or whatever for the +4 extension, and use string formatting to restore leading zeroes. Is there anything that would discourage using int as a datatype for US-only ZIP codes?

    Read the article

  • Deserialize json with json.net c#

    - by 76mel
    Hi, am new to Json so a little green. I have a Rest Based Service that returns a json string; {"treeNode":[{"id":"U-2905","pid":"R","userId":"2905"}, {"id":"U-2905","pid":"R","userId":"2905"}]} I have been playing with the Json.net and trying to Deserialize the string into Objects etc. I wrote an extention method to help. public static T DeserializeFromJSON<T>(this Stream jsonStream, Type objectType) { T result; using (StreamReader reader = new StreamReader(jsonStream)) { JsonSerializer serializer = new JsonSerializer(); try { result = (T)serializer.Deserialize(reader, objectType); } catch (Exception e) { throw; } } return result; } I was expecting an array of treeNode[] objects. But its seems that I can only deserialize correctly if treeNode[] property of another object. public class treeNode { public string id { get; set; } public string pid { get; set; } public string userId { get; set; } } I there a way to to just get an straight array from the deserialization ? Cheers

    Read the article

  • How do I interact with a Perl object that has a hash attribute?

    - by brydgesk
    I have a class with several variables, one of which is a hash (_runs): sub new { my ($class, $name) = @_; my $self = { _name => $name, ... _runs => (), _times => [], ... }; bless ($self, $class); return $self; } Now, all I'm trying to do is create an accessor/mutator, as well as another subroutine that pushes new data into the hash. But I'm having a hell of a time getting all the referencing/dereferencing/$self calls working together. I've about burned my eyes out with "Can't use string ("blah") as a HASH ref etc etc" errors. For the accessor, what is 'best practice' for returning hashes? Which one of these options should I be using (if any)?: return $self->{_runs}; return %{ $self->{_runs} }; return \$self->{_runs}; Further, when I'm using the hash within other subroutines in the class, what syntax do I use to copy it? my @runs = $self->{_runs}; my @runs = %{ $self->{_runs} }; my @runs = $%{ $self->{_runs} }; my @runs = $$self->{_runs}; Same goes for iterating over the keys: foreach my $dt (keys $self->{_runs}) foreach my $dt (keys %{ $self->{_runs} }) And how about actually adding the data? $self->{_runs}{$dt} = $duration; %{ $self->{_runs} }{$dt} = $duration; $$self->{_runs}{$dt} = $duration; You get the point. I've been reading articles about using classes, and articles about referencing and dereferencing, but I can't seem to get my brain to combine the knowledge and use both at the same time. I got my _times array working finally, but mimicking my array syntax over to hashes didn't work.

    Read the article

  • File streaming in PHP - How to replicate this C#.net code in PHP?

    - by openid_kenja
    I'm writing an interface to a web service where we need to upload configuration files. The documentation only provides a sample in C#.net which I am not familiar with. I'm trying to implement this in PHP. Can someone familiar with both languages point me in the right direction? I can figure out all the basics, but I'm trying to figure out suitable PHP replacements for the FileStream, ReadBytes, and UploadDataFile functions. I believe that the RecService object contains the URL for the web service. Thanks for your help! private void UploadFiles() { clientAlias = “<yourClientAlias>”; string filePath = “<pathToYourDataFiles>”; string[] fileList = {"Config.txt", "ProductDetails.txt", "BrandNames.txt", "CategoryNames.txt", "ProductsSoldOut.txt", "Sales.txt"}; RecommendClient RecService = new RecommendClient(); for (int i = 0; i < fileList.Length; i++) { bool lastFile = (i == fileList.Length - 1); //start generator after last file try { string fileName = filePath + fileList[i]; if (!File.Exists(fileName)) continue; // file not found } // set up a file stream and binary reader for the selected file and convert to byte array FileStream fStream = new FileStream(fileName, FileMode.Open, FileAccess.Read); BinaryReader br = new BinaryReader(fStream); byte[] data = br.ReadBytes((int)numBytes); br.Close(); // pass byte array to the web service string result = RecService.UploadDataFile(clientAlias, fileList[i], data, lastFile); fStream.Close(); fStream.Dispose(); } catch (Exception ex) { // log an error message } } }

    Read the article

  • Symfony Form render with Self Referenced Entity

    - by benarth
    I have an Entity containing Self-Referenced mapping. class Category { /** * @var integer * * @ORM\Column(name="id", type="integer") * @ORM\Id * @ORM\GeneratedValue(strategy="AUTO") */ private $id; /** * @var string * * @ORM\Column(name="name", type="string", length=100) */ private $name; /** * @ORM\OneToMany(targetEntity="Category", mappedBy="parent") */ private $children; /** * @ORM\ManyToOne(targetEntity="Category", inversedBy="children") * @ORM\JoinColumn(name="parent_id", referencedColumnName="id") */ private $parent; } In my CategoryType I have this : public function buildForm(FormBuilderInterface $builder, array $options) { $plan = $this->plan; $builder->add('name'); $builder->add('parent', 'entity', array( 'class' => 'xxxBundle:Category', 'property' => 'name', 'empty_value' => 'Choose a parent category', 'required' => false, 'query_builder' => function(EntityRepository $er) use ($plan) { return $er->createQueryBuilder('u') ->where('u.plan = :plan') ->setParameter('plan', $plan) ->orderBy('u.id', 'ASC'); }, )); } Actually, when I render the form field Category this is something like Cat1 Cat2 Cat3 Subcat1 Subcat2 Cat4 I would like to know if it's possible and how to display something more like, a kind of a simple tree representation : Cat1 Cat2 Cat3 -- Subcat1 -- Subcat2 Cat4 Regards.

    Read the article

  • Subset and lagging list data structure R

    - by user1234440
    I have a list that is indexed like the following: >list.stuff [[1]] [[1]]$vector ... [[1]]$matrix .... [[1]]$vector [[2]] null [[3]] [[3]]$vector ... [[3]]$matrix .... [[3]]$vector . . . Each segment in the list is indexed according to another vector of indexes: >index.list 1, 3, 5, 10, 15 In list.stuff, only at each of the indexes 1,3,5,10,15 will there be 2 vectors and one matrix; everything else will be null like [[2]]. What I want to do is to lag like the lag.xts function so that whatever is stored in [[1]] will be pushed to [[3]] and the last one drops off. This also requires subsetting the list, if its possible. I was wondering if there exists some functions that handle list manipulation. My thinking is that for xts, a time series can be extracted based on an index you supply: xts.object[index,] #returns the rows 1,3,5,10,15 From here I can lag it with: lag.xts(xts.object[index,]) Any help would be appreciated thanks: EDIT: Here is a reproducible example: list.stuff<-list() vec<-c(1,2,3,4,5,6,7,8,9) vec2<-c(1,2,3,4,5,6,7,8,9) mat<-matrix(c(1,2,3,4,5,6,7,8),4,2) list.vec.mat<-list(vec=vec,mat=mat,vec2=vec2) ind<-c(2,4,6,8,10) for(i in ind){ list.stuff[[i]]<-list.vec.mat }

    Read the article

  • WordPress: Using a Where Clause With A Custom Field

    - by Steve Wilkison
    I have a bunch of events that are listed on a particular page. Each event is a post. I need them to display in the order in which they occur, NOT the order of the posting date. So, I've created a custom field called TheDate and enter in the date in this format for each one: 20110306. Then, I wrote my query like this: query_posts( array ( 'cat' => '4', 'posts_per_page' => -1, 'orderby' => 'meta_value_num', 'meta_key' => 'TheDate', 'order' => 'ASC' ) ); Works perfectly and displays the events in the correct order. However, I also want it to ONLY display dates from today onward. I don't want it to display dates which have passed. It seems the way to do this is with a "filter." I tried this, but it doesn't work. $todaysdate = date('Ymd'); query_posts( array ( 'cat' => '4', 'posts_per_page' => -1, 'orderby' => 'meta_value_num', 'meta_key' => 'TheDate', 'order' => 'ASC' ) ); function filter_where( $where = '' ) { $where .= "meta_value_num >= $todaysdate"; return $where; } add_filter( 'posts_where', 'filter_where' ); I figure it's just a matter of where I'm using this filter, I probably have it in the wrong place. Or maybe the filter itself is bad. Any help or guidance would be greatly appreciated. Thanks!

    Read the article

  • What are the attributes that are need to Send with this FEDEX shipping script?

    - by Fero
    could any one please tell me what are the attributes that are send with $ship_data ? I am too confused about it. I know that ORIGIN ADDRESS, DESTINATION ADDRESS, NAME etc.. need to be send. But how the data should be aligned. Like name is FIRST, address is SECOND etc... Any help will be useful ** // create new fedex object $fed = new FedExDC('#########','#########'); $ship_data = array( 75= 'LBS', 16= 'Ma' , 13= '44 Main street' , 5= '312 stuart st', 1273= '01', 1274= '01', 18= '6173335555', 15= 'Boston', 23= '1', 9= '02134', 183= '6175556985', 8= 'MA', 117= 'US', 17= '02116', 50= 'US', 4= 'Vermonster LLC', 7= 'Boston', 1369= '1', 12= 'Jay Powers', 1333= '1', 1401= '1.0', 116= 1, 68= 'USD', 1368= 1, 1369= 1, 1370= 5 ); // Ship example $ship_Ret = $fed-ship_express($ship_data); if ($error = $fed-getError()) { echo "ERROR :". $error; } else { // Save the label to disk $fed-label('mylabel.png'); } /* tracking example $track_Ret = $fed-track( array( 29 = 790344664540, )); echo $fed-debug_str. "\n"; echo "Price ".$ship_Ret[1419];*/ echo ""; if ($error = $fed-getError()) { die("ERROR: ". $error); } else { // decode and save label $fed-label('myLabel.png'); echo $fed-debug_str. "\n"; echo "\n\n"; echo "Price $".$ship_Ret[1419]; echo "\n"; echo "Tracking# ".$ship_Ret[29]; } echo ""; ?** Thanks Fero

    Read the article

< Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >