Search Results

Search found 34274 results on 1371 pages for 'mysql table'.

Page 389/1371 | < Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >

  • problem with unicode in javaEE and save question mark in database

    - by Jeus
    when i insert persian information with use JEE6(JSF and JPA) my information save question mark for example "???" === "???" my database is Mysql and my table is UTF-8 . when insert persian data directly in database is correct and save correct. i know that with change one property in JEE my problem go to solved but i don`t know where is it ?

    Read the article

  • Application time out issue

    - by harigm
    I have build the web application using Java1.5, Struts framework with Mysql database Deployed on the JBOSS4.0.5 Server Every thing seems to be fine when the activity is there on the server. Every morning, If I tried to connect to application, it shows the application is down. Once I restart the server, It works fine. From past 1 month, I am just restarting the server every day. Can any one help me where I am doing wrong in the configuration settings Please suggest me How i can eliminate this extra work every day

    Read the article

  • Datatype query on datetime and tinyint

    - by sarah
    Hi , I have Mysql column type has datetime what should be the corresponding datatype in entity bean class for the same column ,as well for tinyint what would be the corresponding datatype in entity bean class for the same column ?

    Read the article

  • uploading file size

    - by Anup Prakash
    As we all know, By default in PHP+MySQL, we can upload a file of size 1.4MB (max). 1) My Question is how can i increase the limitation of this uploading file size? 2) What is the maximum limitation for file to be uploaded in database? Thanx for viewing my query and special thanx for answering my questin.

    Read the article

  • Anything similar to Hibernate in PHP?

    - by harigm
    I am a Java programmer and was working on a project using Hibernate and Struts for some time. Now For my new project, I am working on PHP and Mysql (learning PHP). Is there any technology which is similar to Hibernate for PHP? If yes, can anyone give me the link where I can understand and use it? Is there a POJO concept in PHP?

    Read the article

  • (EXCEL)VBA Spin button which steps through in an sql databases date time

    - by Gulredy
    I have an sql Database table in MySQL which have lots of rows with varied date time values. For example: 2012-08-21 10:10:00 <-- with these date there are around 12 rows 2012-08-21 15:31:00 <-- with these date there are around 5 rows 2012-08-22 11:40:00 <-- with these date there are around 10 rows 2012-08-22 12:17:00 <-- with these date there are around 9 rows 2012-08-22 12:18:00 <-- with these date there are around 7 rows 2012-08-25 07:21:00 <-- with these date there are around 6 rows If the user clicks on the SpinButton1_SpinUp() or SpinButton1_SpinDown() button then it should do the following: The SpinButton1_SpinUp() button should filter out those data from an sql table which is the next after what we are currently on now. Example: We have currently selected: 2012-08-21 15:31:00. The user hits the SpinUp button then the program selects those date from the database, which is the next higher value like this one: 2012-08-22 11:40:00. So the user hits the SpinUp button the data which is selected in the database will change from those with date: 2012-08-21 15:31:00 to those with date: 2012-08-22 11:40:00 The SpinButton1_SpinDown() will do exactly the reverse of the SpinUp button. When the user hits the SpinDown button the data which is selected in the database will change from those with date: 2012-08-21 15:31:00 to those with date 2012-08-21 10:10:00 So I think the date which we are currently on, should be stored in a variable. But on button hit not every bigger or lower data should be selected in the database, only those which are the closest bigger or the closest lower date. How can I do this? I hope I described my problem understandable. My native language is not english, so misunderstandings can occur! Please ask if you don't understand something! Thank you for reading!

    Read the article

  • Hotel Reservation system Database schema

    - by SpikETidE
    Hi Everyone.... I am about to develop a online hotel reservation system...using php and mysql... I have some doubts about my current database schema and the business logic to get the hotels in which rooms are free between two particular dates... Does anyone know of some kind of tutorial where i can get some idea about the hotel reservation schema and the business logics that should be used in the system...? Thanks for your suggestions....

    Read the article

  • T-SQL Table Joins - Unique Situation

    - by Dimitri
    Hello Everyone. This is my first time encountering the case like this and don't quite know how to handle. Situation: I have one table tblSettingsDefinition, with fields: ID, GroupID, Name, typeID, DefaultValue. Then I have tblSettingtypes with fields TypeID, Name. And I have final table, tblUserSettings with fields SettingID, SettingDefinitionID, UserID, Value. The whole point of this is to have customizable settings. Setting can be defined for a Group or as global setting (if GroupID is NULL). It will have a default value, but if user modifies the setting, an entry is added to tblUserSettings that stores new value. I want to have a query that grabs user settings by first looking at the tblUserSettings, and if it has records for the given user, grabs them, if not retrieves default settings. But the trick is that no matter if user has settings or not, I need to have fields from other two table retrieved to know the setting's Type, Name etc... (which are stored in those other tables). I'm writing query something like this: SELECT * FROM tblSettingDefinition SD LEFT JOIN tblUserSettings US ON SD.SettingID = US.SettingDefinitionID JOIN tblSettingTypes ST ON SD.TypeID=ST.ID WHERE US.UserID=@UserID OR ((SD.GroupID IS NULL) OR (SD.GroupID=(SELECT GroupID FROM tblUser WHERE ID=@UserID))) but it retrieves settings for all users from tblUserSettings instead of just ones that match current @UserID. And if @UserID has no records in tblUserSettings, still, all user settings are retrieved instead of the defaults from tblSettingDefinition. Hope I made myself clear. Any help would be highly appreciated. Thank you.

    Read the article

  • SQL query using information from 4 tables (not all directly linked)

    - by Yvonne
    I'm developing a simple classroom system, where teachers manage classes and their subjects. I have 2 levels of access in my teachers table, assigned by an integer (1 = admin, 2 = user)... Meaning that the headteacher is the admin :) A teacher (of level 1) can have have many classes and a class can have many teachers (so I have 'TeachersClasses' table). A class can have many subjects, and a teacher can have many subjects. Basically, I'm attempting a query to display the admin teacher's (level 1) subjects. However, only teachers with a level of 2, are directly related to a subject, which is set by the admin user. The headteacher can view all of their subjects via the classroom, but I cannot get all of the subjects to be displayed on one page, instead I can only get the subjects to appear under a specific classroom right now... This is what I have so far, which is returning nothing. (I'm guessing this may require an SQL clause more advanced that 'INNER JOIN' which is the only join type I am familiar with, and thought it would be enough! $query = "SELECT subjects.subjectid, subjects.subjectname, subjects.subjectdetails, classroom.classid, classroom.classname FROM subjects INNER JOIN classroom ON subjects.subjectid = classroom.classid INNER JOIN teacherclasses ON classroom.classid = teacherclasses.classid INNER JOIN teachers ON teacherclasses.teacherid = teachers.teacherid WHERE teachers.teacherid = '".intval( $_SESSION['SESS_TEACHERID'] )."'"; In order for all subjects related to the headteachers class to be displayed, I'm gathering that all of my tables will need to be called up here? Thanks for any help! Example output: subject name: maths // teacher: mr smith // classroom: DG99 x10 for all the subjects associated with the headteachers classrooms :)

    Read the article

  • how to compare dates in php and sql?

    - by sebastian
    Hi, I want to make a notification system. Shortly.. to compare two dates, the only problem is that i want to compare the months. to see if a month or two have passed from last notification. i want to use one or two months from an entry in a mysql database. the client must select when the notification must come, one or two months. thank you, Sebastian

    Read the article

  • Planning management slots/sessions

    - by Glide
    I have a planning structure on two tables to store available slots by day, and sessions. A slot is defined by a range of time in the day. CREATE TABLE slot ( `id` int(11) NOT NULL AUTO_INCREMENT , `date` date , `start` time , `end` time ); Sessions can't overlap themselves and must be wrapped in a slot. CREATE TABLE session ( `id` int(11) NOT NULL AUTO_INCREMENT , `date` date , `start` time , `end` time ); I need to generate a list of available blocks of time of a certain duration, in order to create sessions. Example: INSERT INTO slot (date, start, end) VALUES ("2010-01-01", "10:00", "19:00") , ("2010-01-02", "10:00", "15:00") , ("2010-01-02", "16:00", "20:30") ; INSERT INTO slot (date, start, end) VALUES ("2010-01-01", "10:00", "19:00") , ("2010-01-02", "10:00", "15:00") , ("2010-01-02", "16:00", "20:30") ; 2010-01-01 <##><####> <- Sessions ------------------------------------ <- Slots 10 11 12 13 14 15 16 17 18 19 20 2010-01-02 <##########> <########> <- Sessions -------------------- ------------------ <- Slots 10 11 12 13 14 15 16 17 18 19 20 I need to know which spaces of 1 hour I can use: +------------+-------+-------+ | date | start | end | +------------+-------+-------+ | 2010-01-01 | 13:00 | 14:00 | | 2010-01-01 | 14:00 | 15:00 | | 2010-01-01 | 15:00 | 16:00 | | 2010-01-01 | 16:00 | 17:00 | | 2010-01-01 | 17:00 | 18:00 | | 2010-01-01 | 18:00 | 19:00 | | 2010-01-02 | 10:00 | 11:00 | | 2010-01-02 | 11:00 | 12:00 | | 2010-01-02 | 16:00 | 17:00 | +------------+-------+-------+

    Read the article

  • Social Network News Feed Database & Design

    - by pws5068
    I'm designing a News Feed system using PHP/MySQL similar to facebook's. I have asked a similar question before but now I've changed the design and I'm looking for feedback. Example Notifications: User_A commented on User_B's new album. "Hey man nice picture!" User_B added a new Photo to [his/her] profile. [show photo thumbnail] Initially, I implemented this using excessive columns for Obj1:Type1 | Obj2:Type2 | etc.. Now the design is set up using a couple special keywords, and actor/receiver relationships. My database is designed for efficiency - using a table of messages joined on a table containing userid,actionid,receiverid,receiverObjectTypeID, Here's a condensed version of what it will look like once joined: News_ID | User_ID | Message | Timestamp 2643 A %a commented on %o's new %r. SomeTimestamp 2644 B %a added a new %r to [his/her] profile. SomeTimestamp %a = the User_ID of the person doing the action %r = the receiving object %o = the owner of the receiving object (for example the owner of the album) (NULL if %r is a user) Questions: Is this a smart (efficient/scalable) way to move forward? How can I show messages like: "User_B added 4 new photos to his profile."?

    Read the article

  • Store IPv6 in database

    - by poru
    What's the best practise to store IP's with PHP in MySQL database? There's a function called ip2long - but this is just for IPv4. But what about IPv6? I know a php function that is for IPv6 IP's, but it doesn't work on Windows with PHP < Version 5.3

    Read the article

  • Datetime and date-range comparsion

    - by Ockonal
    Hello guys, I have datetime-row in mysql database. I have to check time between now and that date using php. If the range is bigger then 1 month - do somtething. I tried something like this: $dateFromMysql = strtotime($rowData); $currentDate = date("m/d/y g:i A"); And then comparsion by hands. It's ugly.

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • SQL: Join vs. subquery

    - by Col. Shrapnel
    I am an old-school MySQL user and always preferred JOIN over sub-query. But nowadays everyone uses sub-query and I hate it, dunno why. Though I've lack of theoretical knowledge to judge myself if there are any difference. Well, I am curious if sub-query as good as join and there is no thing to worry about?

    Read the article

  • select rows with column that is not null?

    - by fayer
    by default i have one column in mysql table to be NULL. i want to select some rows but only if the field value in that column is not NULL. what is the correct way of typing it? $query = "SELECT * FROM names WHERE id = '$id' AND name != NULL"; is this correct?

    Read the article

  • Zend Framework Relationships - findDependentRowset

    - by Morten Nielsen
    Hello, When I call the method findDependentRowset, the returning rowset contains all the rows in the dependent table, and not only the rowsets that matches the reference. Hoping someone could explain this, since I was of the assumption that findDependentRowset would only return rowset matching my 'rule'? I have the following DbTable Models: class Model_DbTable_Advertisement extends Zend_Db_Table_Abstract { protected $_name = 'Advertisements'; protected $_primary = 'Id'; protected $_dependentTables = array ( 'Model_DbTable_Image', ); } class Model_DbTable_Image extends Zend_Db_Table_Abstract { protected $_name = 'Images'; protected $_primary = 'Id'; protected $_referenceMap = array( 'Images' => array( 'column' => 'AdvertisementId', 'refColumn' => 'Id', 'refTableClass' => 'Model_DbTable_Advertisement', ) ); } Now when i execute the following: (Simplified for Question sake) $model = new Model_DbTable_Advertisement(); $rowSet = $model->fetchAll(); $row = $rowSet->current(); $dRow = $row->findDependentRowset('Model_DbTable_Image'); I would expect $dRow to only contain 'Images' that has the same advertisementId as $row, but instead i receive all rows in the Images table. Any help appriciated. Kind regards, Morten

    Read the article

  • db:migrate creates sequences but doesn't alter table?

    - by RewbieNewbie
    Hello, I have a migration that creates a postres sequence for auto incrementing a primary identifier, and then executes a statement for altering the column and specifying the default value: execute 'CREATE SEQUENCE "ServiceAvailability_ID_seq";' execute <<-SQL ALTER TABLE "ServiceAvailability" ALTER COLUMN "ID" set DEFAULT NEXTVAL('ServiceAvailability_ID_seq'); SQL If I run db:migrate everything seems to work, in that no errors are returned, however, if I run the rails application I get: Mnull value in column "ID" violates not-null constraint I have discovered by executing the sql statement in the migration manually, that this error is because the alter statement isn't working, or isn't being executed. If I manually execute the following statement: CREATE SEQUENCE "ServiceAvailability_ID_seq; I get: error : ERROR: relation "serviceavailability_id_seq" already exists Which means the migration successfully created the sequence! However, if I manually run: ALTER TABLE "ServiceProvider" ALTER COLUMN "ID" set DEFAULT NEXTVAL('ServiceProvider_ID_seq'); SQL It runs successfully and creates the default NEXTVAL. So the question is, why is the migration file creating the sequence with the first execute statement, but not altering the table in the second execute? (Remembering, no errors are output on running db:migrate) Thank you and apologies for tl:dr

    Read the article

  • Get 10 Most Entered Entries

    - by Belgin Fish
    Hi, I'm just wondering if it's possible to retrieve the the most entered entries from the mysql database It's like this : ID - Value Id is auto increment, and value is the text that is being entered, i'd like to have it display the top 10 most entered terms, how could i do that?

    Read the article

  • T-SQL - Left Outer Joins - Fileters in the where clause versus the on clause.

    - by Greg Potter
    I am trying to compare two tables to find rows in each table that is not in the other. Table 1 has a groupby column to create 2 sets of data within table one. groupby number ----------- ----------- 1 1 1 2 2 1 2 2 2 4 Table 2 has only one column. number ----------- 1 3 4 So Table 1 has the values 1,2,4 in group 2 and Table 2 has the values 1,3,4. I expect the following result when joining for Group 2: `Table 1 LEFT OUTER Join Table 2` T1_Groupby T1_Number T2_Number ----------- ----------- ----------- 2 2 NULL `Table 2 LEFT OUTER Join Table 1` T1_Groupby T1_Number T2_Number ----------- ----------- ----------- NULL NULL 3 The only way I can get this to work is if I put a where clause for the first join: PRINT 'Table 1 LEFT OUTER Join Table 2, with WHERE clause' select table1.groupby as [T1_Groupby], table1.number as [T1_Number], table2.number as [T2_Number] from table1 LEFT OUTER join table2 --****************************** on table1.number = table2.number --****************************** WHERE table1.groupby = 2 AND table2.number IS NULL and a filter in the ON for the second: PRINT 'Table 2 LEFT OUTER Join Table 1, with ON clause' select table1.groupby as [T1_Groupby], table1.number as [T1_Number], table2.number as [T2_Number] from table2 LEFT OUTER join table1 --****************************** on table2.number = table1.number AND table1.groupby = 2 --****************************** WHERE table1.number IS NULL Can anyone come up with a way of not using the filter in the on clause but in the where clause? The context of this is I have a staging area in a database and I want to identify new records and records that have been deleted. The groupby field is the equivalent of a batchid for an extract and I am comparing the latest extract in a temp table to a the batch from yesterday stored in a partioneds table, which also has all the previously extracted batches as well. Code to create table 1 and 2: create table table1 (number int, groupby int) create table table2 (number int) insert into table1 (number, groupby) values (1, 1) insert into table1 (number, groupby) values (2, 1) insert into table1 (number, groupby) values (1, 2) insert into table2 (number) values (1) insert into table1 (number, groupby) values (2, 2) insert into table2 (number) values (3) insert into table1 (number, groupby) values (4, 2) insert into table2 (number) values (4)

    Read the article

< Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >