Search Results

Search found 3512 results on 141 pages for 'circular buffer'.

Page 39/141 | < Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • How do you send a named pipe string from umnanaged to managed code space?

    - by billmcf
    I appear to have a named pipes 101 issue. I have a very simple set up to connect a simplex named pipe transmitting from a C++ unmanaged app to a C# managed app. The pipe connects, but I cannot send a "message" through the pipe unless I close the handle which appears to flush the buffer and pass the message through. It's like the message is blocked. I have tried reversing the roles of client/server and invoking them with different Flag combinations without any luck. I can easily send messages in the other direction from C# managed to C++ unmanaged. Does anyone have any insight. Can any of you guys successfully send messages from C++ unmanaged to C# managed? I can find plenty of examples of intra amanged or unmanaged pipes but not inter managed to/from unamanged - just claims to be able to do it. In the listings, I have omitted much of the wrapper stuff for clarity. The key bits I believe that are relevant are the pipe connection/creation/read and write methods. Don't worry too much about blocking/threading here. C# Server side // This runs in its own thread and so it is OK to block private void ConnectToClient() { // This server will listen to the sending client if (m_InPipeStream == null) { m_InPipeStream = new NamedPipeServerStream("TestPipe", PipeDirection.In, 1); } // Wait for client to connect to our server m_InPipeStream.WaitForConnection(); // Verify client is running if (!m_InPipeStream.IsConnected) { return; } // Start listening for messages on the client stream if (m_InPipeStream != null && m_InPipeStream.CanRead) { ReadThread = new Thread(new ParameterizedThreadStart(Read)); ReadThread.Start(m_InPipeStream); } } // This runs in its own thread and so it is OK to block private void Read(object serverObj) { NamedPipeServerStream pipeStream = (NamedPipeServerStream)serverObj; using (StreamReader sr = new StreamReader(pipeStream)) { while (true) { string buffer = "" ; try { // Blocks here until the handle is closed by the client-side!! buffer = sr.ReadLine(); // <<<<<<<<<<<<<< Sticks here } catch { // Read error break; } // Client has disconnected? if (buffer == null || buffer.Length == 0) break; // Fire message received event if message is non-empty if (MessageReceived != null && buffer != "") { MessageReceived(buffer); } } } } C++ client side // Static - running in its own thread. DWORD CNamedPipe::ListenForServer(LPVOID arg) { // The calling app (this) is passed as the parameter CNamedPipe* app = (CNamedPipe*)arg; // Out-Pipe: connect as a client to a waiting server app->m_hOutPipeHandle = CreateFile("\\\\.\\pipe\\TestPipe", GENERIC_WRITE, 0, NULL, OPEN_EXISTING, FILE_ATTRIBUTE_NORMAL, NULL); // Could not create handle if (app->m_hInPipeHandle == NULL || app->m_hInPipeHandle == INVALID_HANDLE_VALUE) { return 1; } return 0; } // Sends a message to the server BOOL CNamedPipe::SendMessage(CString message) { DWORD dwSent; if (m_hOutPipeHandle == NULL || m_hOutPipeHandle == INVALID_HANDLE_VALUE) { return FALSE; } else { BOOL bOK = WriteFile(m_hOutPipeHandle, message, message.GetLength()+1, &dwSent, NULL); //FlushFileBuffers(m_hOutPipeHandle); // <<<<<<< Tried this return (!bOK || (message.GetLength()+1) != dwSent) ? FALSE : TRUE; } } // Somewhere in the Windows C++/MFC code... ... // This write is non-blocking. It just passes through having loaded the pipe. m_pNamedPipe->SendMessage("Hi de hi"); ...

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • zlib gzgets extremely slow?

    - by monkeyking
    I'm doing stuff related to parsing huge globs of textfiles, and was testing what input method to use. There is not much of a difference using c++ std::ifstreams vs c FILE, According to the documentation of zlib, it supports uncompressed files, and will read the file without decompression. I'm seeing a difference from 12 seconds using non zlib to more than 4 minutes using zlib.h This I've tested doing multiple runs, so its not a disk cache issue. Am I using zlib in some wrong way? thanks #include <zlib.h> #include <cstdio> #include <cstdlib> #include <fstream> #define LENS 1000000 size_t fg(const char *fname){ fprintf(stderr,"\t-> using fgets\n"); FILE *fp =fopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(NULL!=fgets(buffer,LENS,fp)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t is(const char *fname){ fprintf(stderr,"\t-> using ifstream\n"); std::ifstream is(fname,std::ios::in); size_t nLines =0; char *buffer = new char[LENS]; while(is. getline(buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t iz(const char *fname){ fprintf(stderr,"\t-> using zlib\n"); gzFile fp =gzopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(0!=gzgets(fp,buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } int main(int argc,char**argv){ if(atoi(argv[2])==0) fg(argv[1]); if(atoi(argv[2])==1) is(argv[1]); if(atoi(argv[2])==2) iz(argv[1]); }

    Read the article

  • Why isn't my log4net appender buffering?

    - by Eric
    I've created a custom log4net appender. It descends from log4net.Appender.SmtpAppender which descends from log4net.Appender.BufferingAppenderSkeleton. I programatically setup the following parameters in its constructor: this.Lossy = false; //don't drop any messages this.BufferSize = 3; //buffer up to 3 messages this.Threshold = log4net.Core.Level.Error; //append messages of Error or higher this.Evaluator = new log4net.Core.LevelEvaluator(Level.Off); //don't flush the buffer for any message, regardless of level I expect this would buffer 3 events of level Error or higher and deliver those events when the buffer is filled. However, I'm finding that the events are not buffered at all; instead, SendBuffer() is called immediately every time an error is logged. Is there a mistake in my configuration? Thanks

    Read the article

  • boost.asio error on read from socket.

    - by niXman
    The following code of the client: typedef boost::array<char, 10> header_packet; header_packet header; boost::system::error_code error; ... /** send header */ boost::asio::write( _socket, boost::asio::buffer(header, header.size()), boost::asio::transfer_all(), error ); /** send body */ boost::asio::write( _socket, boost::asio::buffer(buffer, buffer.length()), boost::asio::transfer_all(), error ); of the server: struct header { boost::uint32_t header_length; boost::uint32_t id; boost::uint32_t body_length; }; static header unpack_header(const header_packet& data) { header hdr; sscanf(data.data(), "%02d%04d%04d", &hdr.header_length, &hdr.id, &hdr.body_length); return hdr; } void connection::start() { boost::asio::async_read( _socket, boost::asio::buffer(_header, _header.size()), boost::bind( &connection::read_header_handler, shared_from_this(), boost::asio::placeholders::error ) ); } /***************************************************************************/ void connection::read_header_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed header: " << _header.c_array() << std::endl; std::cout << constants::unpack_header(_header); boost::asio::async_read( _socket, boost::asio::buffer(_body, constants::unpack_header(_header).body_length), boost::bind( &connection::read_body_handler, shared_from_this(), boost::asio::placeholders::error ) ); } else { /** report error */ std::cout << "read header finished with error: " << e.message() << std::endl; } } /***************************************************************************/ void connection::read_body_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed body: " << _body.c_array() << std::endl; start(); } else { /** report error */ std::cout << "read body finished with error: " << e.message() << std::endl; } } On the server side the method read_header_handler() is called, but the method read_body_handler() is never called. Though the client has written down the data in a socket. The header is readed and decoded successfully. What's the error?

    Read the article

  • how to mount partitions from USB drives in Windows using Delphi?

    - by user569556
    Hi. I'm a Delphi programmer. I want to mount all partitions from USB drives in Windows (XP). The OS is doing this automatically but there are situations when such a program is useful. I know how to find if a drive is on USB or not. My code so far is: type STORAGE_QUERY_TYPE = (PropertyStandardQuery = 0, PropertyExistsQuery, PropertyMaskQuery, PropertyQueryMaxDefined); TStorageQueryType = STORAGE_QUERY_TYPE; STORAGE_PROPERTY_ID = (StorageDeviceProperty = 0, StorageAdapterProperty); TStoragePropertyID = STORAGE_PROPERTY_ID; STORAGE_PROPERTY_QUERY = packed record PropertyId: STORAGE_PROPERTY_ID; QueryType: STORAGE_QUERY_TYPE; AdditionalParameters: array[0..9] of AnsiChar; end; TStoragePropertyQuery = STORAGE_PROPERTY_QUERY; STORAGE_BUS_TYPE = (BusTypeUnknown = 0, BusTypeScsi, BusTypeAtapi, BusTypeAta, BusType1394, BusTypeSsa, BusTypeFibre, BusTypeUsb, BusTypeRAID, BusTypeiScsi, BusTypeSas, BusTypeSata, BusTypeMaxReserved = $7F); TStorageBusType = STORAGE_BUS_TYPE; STORAGE_DEVICE_DESCRIPTOR = packed record Version: DWORD; Size: DWORD; DeviceType: Byte; DeviceTypeModifier: Byte; RemovableMedia: Boolean; CommandQueueing: Boolean; VendorIdOffset: DWORD; ProductIdOffset: DWORD; ProductRevisionOffset: DWORD; SerialNumberOffset: DWORD; BusType: STORAGE_BUS_TYPE; RawPropertiesLength: DWORD; RawDeviceProperties: array[0..0] of AnsiChar; end; TStorageDeviceDescriptor = STORAGE_DEVICE_DESCRIPTOR; const IOCTL_STORAGE_QUERY_PROPERTY = $002D1400; var i: Integer; H: THandle; USBDrives: array of Byte; Query: TStoragePropertyQuery; dwBytesReturned: DWORD; Buffer: array[0..1023] of Byte; sdd: TStorageDeviceDescriptor absolute Buffer; begin SetLength(UsbDrives, 0); SetErrorMode(SEM_FAILCRITICALERRORS); for i := 0 to 99 do begin H := CreateFile(PChar('\\.\PhysicalDrive' + IntToStr(i)), 0, FILE_SHARE_READ or FILE_SHARE_WRITE, nil, OPEN_EXISTING, 0, 0); if H <> INVALID_HANDLE_VALUE then begin try dwBytesReturned := 0; FillChar(Query, SizeOf(Query), 0); FillChar(Buffer, SizeOf(Buffer), 0); sdd.Size := SizeOf(Buffer); Query.PropertyId := StorageDeviceProperty; Query.QueryType := PropertyStandardQuery; if DeviceIoControl(H, IOCTL_STORAGE_QUERY_PROPERTY, @Query, SizeOf(Query), @Buffer, SizeOf(Buffer), dwBytesReturned, nil) then if sdd.BusType = BusTypeUsb then begin SetLength(USBDrives, Length(USBDrives) + 1); UsbDrives[High(USBDrives)] := Byte(i); end; finally CloseHandle(H); end; end; end; for i := 0 to High(USBDrives) do begin // end; end. But I don't know how to access partitions on each drive and mounts them. Can you please help me? I searched before I asked and I couldn't find a working code. But if I did not properly then I'm sorry and please show me that topic. Best regards, John

    Read the article

  • get the current time in C

    - by Antrromet
    I want to get the current time of my system. For that i'm using the following code in C. time_t now; struct tm *mytime = localtime(&now); if ( strftime(buffer, sizeof buffer, "%X", mytime) ) { printf("time1 = \"%s\"\n", buffer); } But the problem of this code is that its giving some random time.Also the random time is different all the time.I want the current time of my system. Can anyone please tell me how to solve this issue?

    Read the article

  • Is the C++ compiler optimizer allowed to break my destructor ability to be called multiple times?

    - by sharptooth
    We once had an interview with a very experienced C++ developer who couldn't answer the following question: is it necessary to call the base class destructor from the derived class destructor in C++? Obviously the answer is no, C++ will call the base class destructor automagically anyway. But what if we attempt to do the call? As I see it the result will depend on whether the base class destructor can be called twice without invoking erroneous behavior. For example in this case: class BaseSafe { public: ~BaseSafe() { } private: int data; }; class DerivedSafe { public: ~DerivedSafe() { BaseSafe::~BaseSafe(); } }; everything will be fine - the BaseSafe destructor can be called twice safely and the program will run allright. But in this case: class BaseUnsafe { public: BaseUnsafe() { buffer = new char[100]; } ~BaseUnsafe () { delete[] buffer; } private: char* buffer; }; class DerivedUnsafe { public: ~DerivedUnsafe () { BaseUnsafe::~BaseUnsafe(); } }; the explicic call will run fine, but then the implicit (automagic) call to the destructor will trigger double-delete and undefined behavior. Looks like it is easy to avoid the UB in the second case. Just set buffer to null pointer after delete[]. But will this help? I mean the destructor is expected to only be run once on a fully constructed object, so the optimizer could decide that setting buffer to null pointer makes no sense and eliminate that code exposing the program to double-delete. Is the compiler allowed to do that?

    Read the article

  • What happens when we say "listen to a port" ?

    - by smwikipedia
    Hi, When we start a server application, we always need to speicify the port number it listens to. But how is this "listening mechanism" implemented under the hood? My current imagination is like this: The operating system associate the port number with some buffer. The server application's responsibiligy is to monitor this buffer. If there's no data in this buffer, the server application's listen operation will just block the application. When some data arrives from the wire, the operating system will know that check the data and see if it is targed at this port number. And then it will fill the buffer. And then OS will notify the blocked server application and the server application will get the data and continue to run. Question is: If the above scenario is correct, how could the opearting system know there's data arriving from wire? It cannot be a busy pooling. Is it some kind of interrupt-based mechanism? If there's too much data arriving and the buffer is not big enough, will there be data loss? Is the "listen to a port" operation really a blocking operation? Many thanks.

    Read the article

  • wxPython - How can I display a html formatted string in wx.RichTextCtrl

    - by wxpydon
    Hello, I'm trying to display some string (html formatted) in a Richtext Ctrl. In my code I tried to use it this way (self.txtmain is the RichTextCtrl): out = StringIO() htmlhandler = rt.RichTextHTMLHandler() buffer = self.txtmain.GetBuffer() buffer.AddHandler(htmlhandler) out.write(string) out.seek(0) htmlhandler.LoadStream(buffer, out) self.txtmain.Refresh() No errors are issued, but the RichTextCtrl windows is not updated. What am I missing here?

    Read the article

  • reading and writing QByteArrays

    - by synchronicity
    I'm having trouble reading and writing QByteArray data to a file. My goal is to save QPixmap data into a QByteArray and save that QByteArray to a file (with the ability to read this QByteArray back from the file and into a QPixmap). I want to use following code from the QPixmap documentation: QPixmap pixmap(<image path>); QByteArray bytes; QBuffer buffer(&bytes); buffer.open(QIODevice::WriteOnly); pixmap.save(&buffer, "PNG"); // writes pixmap into bytes in PNG format After writing the buffer to a file, I want to be able to retrieve the QByteArray and load it back into a QPixmap using the QPixmap::loadFromData() function. Please let me know if any further clarification is needed (I'm open to alternative approaches as well, I just need to be able to read and write the QPixmap to a file! :) );

    Read the article

  • get content from website with utf8 format

    - by zahir
    i want how to get the content from websites with utf8 format,, i have writing the following code is try { String webnames = "http://pathivu.com"; URL url = new URL(webnames); URLConnection urlc = url.openConnection(); //BufferedInputStream buffer = new BufferedInputStream(urlc.getInputStream()); BufferedReader buffer = new BufferedReader(new InputStreamReader(urlc.getInputStream(), "UTF8")); StringBuilder builder = new StringBuilder(); int byteRead; while ((byteRead = buffer.read()) != -1) builder.append((char) byteRead); buffer.close(); String text=builder.toString(); System.out.println(text); } catch (IOException e) { e.printStackTrace(); } but i cant get the correct format... thanks and advance..

    Read the article

  • public class ImageHandler : IHttpHandler

    - by Ken
    cmd.Parameters.AddWithValue("@id", new system.Guid (imageid)); What using System reference would this require? Here is the handler: using System; using System.Collections.Specialized; using System.Web; using System.Web.Configuration; using System.Web.Security; using System.Globalization; using System.Configuration; using System.Data.SqlClient; using System.Data; using System.IO; using System.Web.Profile; using System.Drawing; public class ImageHandler : IHttpHandler { public void ProcessRequest(HttpContext context) { string imageid; if (context.Request.QueryString["id"] != null) imageid = (context.Request.QueryString["id"]); else throw new ArgumentException("No parameter specified"); context.Response.ContentType = "image/jpeg"; Stream strm = ShowProfileImage(imageid.ToString()); byte[] buffer = new byte[8192]; int byteSeq = strm.Read(buffer, 0, 8192); while (byteSeq > 0) { context.Response.OutputStream.Write(buffer, 0, byteSeq); byteSeq = strm.Read(buffer, 0, 8192); } //context.Response.BinaryWrite(buffer); } public Stream ShowProfileImage(String imageid) { string conn = ConfigurationManager.ConnectionStrings["MyConnectionString1"].ConnectionString; SqlConnection connection = new SqlConnection(conn); string sql = "SELECT image FROM Profile WHERE UserId = @id"; SqlCommand cmd = new SqlCommand(sql, connection); cmd.CommandType = CommandType.Text; cmd.Parameters.AddWithValue("@id", new system.Guid (imageid));//Failing Here!!!! connection.Open(); object img = cmd.ExecuteScalar(); try { return new MemoryStream((byte[])img); } catch { return null; } finally { connection.Close(); } } public bool IsReusable { get { return false; } } }

    Read the article

  • Performance Cost of a Memcopy in C/C++

    - by Cenoc
    So whenever I write code I always think about the performance implications. I've often wondered, what is the "cost" of using a memcopy relative to other functions in terms of performance? For example, I may be writing a sequence of numbers to a static buffer and concentrate on a frame within the buffer, in order to keep the frame once I get to the end of the buffer, I might memcopy all of it to the beginning OR I can implement an algorithm to amortize the computation.

    Read the article

  • Creating android app Database with big amount of data

    - by Thomas
    Hi all, The database of my application need to be filled with a lot of data, so during onCreate(), it's not only some create table sql instructions, there is a lot of inserts. The solution I chose is to store all this instructions in a sql file located in res/raw and which is loaded with Resources.openRawResource(id). It works well but I face to encoding issue, I have some accentuated caharacters in the sql file which appears bad in my application. This my code to do this : public String getFileContent(Resources resources, int rawId) throws IOException { InputStream is = resources.openRawResource(rawId); int size = is.available(); // Read the entire asset into a local byte buffer. byte[] buffer = new byte[size]; is.read(buffer); is.close(); // Convert the buffer into a string. return new String(buffer); } public void onCreate(SQLiteDatabase db) { try { // get file content String sqlCode = getFileContent(mCtx.getResources(), R.raw.db_create); // execute code for (String sqlStatements : sqlCode.split(";")) { db.execSQL(sqlStatements); } Log.v("Creating database done."); } catch (IOException e) { // Should never happen! Log.e("Error reading sql file " + e.getMessage(), e); throw new RuntimeException(e); } catch (SQLException e) { Log.e("Error executing sql code " + e.getMessage(), e); throw new RuntimeException(e); } The solution I found to avoid this is to load the sql instructions from a huge static final string instead of a file, and all accentutated characters appears well. But Isn't there a more elegant way to load sql instructions than a big static final String attribute with all sql instructions ? Thanks in advance Thomas

    Read the article

  • replacing variables in output in php

    - by Thorpe Obazee
    Right now I have this code. <?php error_reporting(E_ALL); require_once('content_config.php'); function callback($buffer) { // replace all the apples with oranges foreach ($config as $key => $value) { $buffer = str_replace($key, $value, $buffer); } return $buffer; } ob_start("callback"); ?> some content <?php ob_end_flush(); ?> in the content_config.php file: $config['SiteName'] = 'MySiteName'; $config['SiteAuthor'] = 'thatGuy'; What I want to do is that I want to replace the placeholders that with the key of the config array with its value. Right now, it doesn't work :(

    Read the article

  • Preallocating memory with C++ in realtime environment

    - by Elazar Leibovich
    I'm having a function which gets an input buffer of n bytes, and needs an auxillary buffer of n bytes in order to process the given input buffer. (I know vector is allocating memory at runtime, let's say that I'm using a vector which uses static preallocated memory. Imagine this is NOT an STL vector.) The usual approach is void processData(vector<T> &vec) { vector<T> &aux = new vector<T>(vec.size()); //dynamically allocate memory // process data } //usage: processData(v) Since I'm working in a real time environment, I wish to preallocate all the memory I'll ever need in advance. The buffer is allocated only once at startup. I want that whenever I'm allocating a vector, I'll automatically allocate auxillary buffer for my processData function. I can do something similar with a template function static void _processData(vector<T> &vec,vector<T> &aux) { // process data } template<size_t sz> void processData(vector<T> &vec) { static aux_buffer[sz]; vector aux(vec.size(),aux_buffer); // use aux_buffer for the vector _processData(vec,aux); } // usage: processData<V_MAX_SIZE>(v); However working alot with templates is not much fun (now let's recompile everything since I changed a comment!), and it forces me to do some bookkeeping whenever I use this function. Are there any nicer designs around this problem?

    Read the article

  • Read from file into pointer to struct

    - by cla barzu
    I need help with pointers in C. I have to read from a file, and fill an array with pointers to struct rcftp_msg . Since now I did the next things: struct rcftp_msg { uint8_t version; uint8_t flags; uint16_t len; uint8_t buffer[512]; }; struct rcftp_msg *windows [10]; pfile = fopen(file,"r"); // Open the file I have to read from the file into the buffer, but I don't know how to do it. I tried the next: for (i = 0; i <10; i++){ leng=fread (**windows[i]->buffer**,sizeof(uint8_t),512,pfile); } I think windows[i]-buffer is bad, cuz that don't work. Sorry for my bad English :(

    Read the article

  • Make function declarations based on function definitions

    - by Clinton Blackmore
    I've written a .cpp file with a number of functions in it, and now need to declare them in the header file. It occurred to me that I could grep the file for the class name, and get the declarations that way, and it would've worked well enough, too, had the complete function declaration before the definition -- return code, name, and parameters (but not function body) -- been on one line. It seems to me that this is something that would be generally useful, and must've been solved a number of times. I am happy to edit the output and not worried about edge cases; anything that gives me results that are right 95% of the time would be great. So, if, for example, my .cpp file had: i2cstatus_t NXTI2CDevice::writeRegisters( uint8_t start_register, // start of the register range uint8_t bytes_to_write, // number of bytes to write uint8_t* buffer = 0) // optional user-supplied buffer { ... } and a number of other similar functions, getting this back: i2cstatus_t NXTI2CDevice::writeRegisters( uint8_t start_register, // start of the register range uint8_t bytes_to_write, // number of bytes to write uint8_t* buffer = 0) for inclusion in the header file, after a little editing, would be fine. Getting this back: i2cstatus_t writeRegisters( uint8_t start_register, uint8_t bytes_to_write, uint8_t* buffer); or this: i2cstatus_t writeRegisters(uint8_t start_register, uint8_t bytes_to_write, uint8_t* buffer); would be even better.

    Read the article

  • C string program

    - by mrblippy
    Hi, i have been given a task to do ar school that must read three strings in, store the third string in dynamically allocated memory and print out the last 4 letters of the first word alphabetically. Here is the program i have so far but the strings are all stored in different variables, making them hard to sort. if anyone could give me a hand and help me finish this program i would be very grateful. thanks #include <stdio.h> #include <stdlib.h> #include <string.h> int main() { char word1[101]; char word2[101]; char* word3; char buffer[101]; scanf("%s", word1); scanf("%s", word2); scanf("%s", buffer); word3 = (char *) malloc(strlen(buffer)+1); strcpy(word3, buffer); return 0; }

    Read the article

  • Allocating memory for a char pointer that is part of a struct

    - by mrblippy
    hi, im trying to read in a word from a user, then dynamically allocate memory for the word and store it in a struct array that contains a char *. i keep getting a implicit declaration of function âstrlenâ so i know im going wrong somewhere. struct class { char class_code[4]; char *name; }; char buffer[101]; struct unit units[1000]; scanf("%s", buffer); units[0].name = (char *) malloc(strlen(buffer)+1); strcpy(units[0].name, buffer);

    Read the article

  • Template neglects const (why?)

    - by Gabriel
    Does somebody know, why this compiles?? template< typename TBufferTypeFront, typename TBufferTypeBack = TBufferTypeFront> class FrontBackBuffer{ public: FrontBackBuffer( const TBufferTypeFront front, const TBufferTypeBack back): ////const reference assigned to reference??? m_Front(front), m_Back(back) { }; ~FrontBackBuffer() {}; TBufferTypeFront m_Front; ///< The front buffer TBufferTypeBack m_Back; ///< The back buffer }; int main(){ int b; int a; FrontBackBuffer<int&,int&> buffer(a,b); // buffer.m_Back = 33; buffer.m_Front = 55; } I compile with GCC 4.4. Why does it even let me compile this? Shouldn't there be an error that I cannot assign a const reference to a non-const reference?

    Read the article

  • Downloading Large JSON File to local file using Java

    - by user1279675
    I'm attempting to download a JSON from the following URL - http://api.crunchbase.com/v/1/companies.js - to a local file. I'm using Java 1.7 and the following JSON Libraries - http://www.json.org/java/ - to attempt to make it work. Here's my code: public static void download(String address, String localFileName) { OutputStream out = null; URLConnection conn = null; InputStream in = null; try { URL url = new URL(address); out = new BufferedOutputStream( new FileOutputStream(localFileName)); conn = url.openConnection(); in = conn.getInputStream(); byte[] buffer = new byte[1024]; int numRead; long numWritten = 0; while ((numRead = in.read(buffer)) != -1) { out.write(buffer, 0, numRead); numWritten += numRead; System.out.println(buffer.length); System.out.println(" " + buffer.hashCode()); } System.out.println(localFileName + "\t" + numWritten); } catch (Exception exception) { exception.printStackTrace(); } finally { try { if (in != null) { in.close(); } if (out != null) { out.close(); } } catch (IOException ioe) { } } } When I run the code everything seems to work until midway through the loop the program seems to stop and not continue reading the JSON Object. Does anyone know why this would stop reading? How could I fix the issue?

    Read the article

  • Alert and if changes behaviour dom copying

    - by lowkey
    Hi guys! Tried to make a little old school ajax (iframe-javascript) script. A bit of mootools is used for DOM navigation Description: HTML: 1 iframe called "buffer" 1 div called "display" JAVASCRIPT: (short: copy iframe content into a div on the page) 1) onLoad on iframe triggers handler(), a counter makes sure it only run once (this is because otherwise firefox will go into feedback loop. What i think happens: iframe on load handler() copyBuffer change src of iframe , and firefox takes that as an onload again) 2) copybuffer() is called, it sets src of iframe then copies iframe content into div, then erases iframe content THE CODE: count=0; function handler(){ if (count==0){ copyBuffer(); count++; } } function copyBuffer(){ $('buffer').set('src','http://www.somelink.com/'); if (window.frames['buffer'] && $('display') ) { $('display').innerHTML = window.frames['buffer'].document.body.innerHTML; window.frames['buffer'].document.body.innerHTML=""; } } problems: QUESTION 1) nothing happens, the content is not loaded into the div. But if i either: A) remove the counter and let the script run in a feedback loop: the content is suddenly copied into the div, but off course there is a feedback loop going on, you can see it keeps loading in the status bar. OR B) insert an alert in the copyBuffer function. The content is copied, without the feedback loop. why does this happen? QUESTION 2) The If wrapped around the copying code i got from a source on the internet. I am not sure what it does? If i remove it the code does not work in: Safari and Chrome. Many thanks in advance!

    Read the article

< Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >