Search Results

Search found 385 results on 16 pages for 'reasoning'.

Page 4/16 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

• soft question - Which of these topics is likely to be relevant in the future?

  - by Fool

  I hear some topics in computer science, such as object-oriented programming, are relevant today but may become obsolete in the future. I'm picking courses for a minor in computer science, and I need one more elective. Could someone help me choose topic(s) from the following list that would grant timeless knowledge, relevant and applicable in the future? Why are such topics relevant? Artificial Intelligence Human-Computer Interaction Object-Oriented Programming Operating Systems Compilers Networking Databases Graphics Automata and Complexity Theory Logic and Automated Reasoning Algorithms If some of these titles are too vague, I'll provide more info.

  Read the article

• initial Class design: access modifiers and no-arg constructors

  - by yas

  Context: Student working through Class design in personal/side project for Summer. I've never written anything implemented by others or had to maintain code. Trying to maximize encapsulation and imagining what would make code easy to maintain. Concept: Tight/Loose Class design where Tight and Loose refer to access modifiers and constructors. Tight: initially, everything, including setters, is private and a no-arg constructor is not provided (only a full constructor). Loose: not Tight Exceptions: the obvious like toString Reasoning: If code, at the very beginning, is tight, then it should be guaranteed that changes, with respect to access/creation, should never damage existing implementations. The loosening of code happens incrementally and must be thought through, justified, and safe (validated). Benefit: Existing implementing code should not break if changes are made later. Cost: Takes more time to create. Since this is my own thinking, I hope to get feedback as to whether I should push to work this way. Good idea or bad idea?

  Read the article

• Best practices for upgrading user data when updating versions of software

  - by Javy

  In my code I check the current version of the software on launch and compare it to the version stored in the user's data file(s). If the version is newer, then I call different methods to update the old data to the newer data version, if necessary. I usually have to make a new method to convert the data with each update that changes user data in some way, and cannot remove the old ones in case there was someone who missed an update. So the app must be able to go through each method call and update their data until they get their data current. With larger data sets, this could be a problem. In addition, I recently had a brief discussion with another StackOverflow user this and he indicated he always appended a date stamp to the filename to manage data versions, although his reasoning as to why this was better than storing the version data in the file itself was unclear. Since I've rarely seen management of user data versions in books I've read, I'm curious what are the best practices for naming user data files and procedures for updating older data to newer versions.

  Read the article

• How do you accept arguments in the main.cpp file and reference another file?

  - by Jason H.

  I have a basic understanding of programming and I currently learning C++. I'm in the beginning phases of building my own CLI program for ubuntu. However, I have hit a few snags and I was wondering if I could get some clarification. The program I am working on is called "sat" and will be available via command line only. I have the main.cpp. However, my real question is more of a "best practices" for programming/organization. When my program "sat" is invoked I want it to take additional arguments. Here is an example: > sat task subtask I'm not sure if the task should be in its own task.cpp file for better organization or if it should be a function in the main.cpp? If the task should be in its own file how do you accept arguments in the main.cpp file and reference the other file? Any thoughts on which method is preferred and reference material to backup the reasoning?

  Read the article

• Microsoft Access 2010: How to Format Forms

  For the purpose of this tutorial, we will be working on formatting a form that people can use to enter in a customer's information. As is, the form is decent and usable, but what if you want to change its look around so that it has a custom look? What if you want to tweak its settings so that it better reflects your company or brand? That is exactly what we are about to do. The process is very simple and can even be a bit fun as you get creative with it. The reasoning behind formatting a form in Microsoft Access 2010 is rather logical. If someone is going to be using a form on a daily bas...

  Read the article

• Programming my first C++ program

  - by Jason H.

  I have a basic understanding of programming and I currently learning C++. I'm in the beginning phases of building my own CLI program for ubuntu. However, I have hit a few snags and I was wondering if I could get some clarification. The program I am working on is called "sat" and will be available via command line only. I have the main.cpp. However, my real question is more of a "best practices" for programming/organization. When my program "sat" is invoked I want it to take additional arguments. Here is an example: > sat task subtask I'm not sure if the task should be in its own task.cpp file for better organization or if it should be a function in the main.cpp? If the task should be in its own file how do you accept arguments in the main.cpp file and reference the other file? Any thoughts on which method is preferred and reference material to backup the reasoning?

  Read the article

• How do I tell my boss he made the wrong choice? [migrated]

  - by SomeKittens

  Recently, our biggest product failed majorly because we'd only used outsourced labor to do it, and they never tested anything, etc. Finally, our CEO decided that the US team should learn the code and fix it up. (Not a total rewrite, but lots of formatting/style changes, refactoring, etc). However, he knows next to nothing about programming (thankfully, he admits it). He had been grooming me to take on the project manager position, but I had to go back to college. Now he gave it to another programmer who is naive and inexperienced. I don't feel the naive programmer will do nearly as well. The CEO's reasoning is that the naive programmer can work full time and I can only do part time, so the less senior programmer could put more work into it. How can I convince him that 15 hours of my time is worth more than the other guy's 40?

  Read the article

• Restoring two finger middle click again

  - by Thomas A.

  it used to be that tapping two fingers on the touchpad send a middle mouse click. Now it does a right click and three fingers now are the middle click. I really can't understand the change and think it is a bug or badly copied from Apple or something. The reasoning escapes me totally. I use middle click to open links in a new tab in the browser all day and I rarely use right click (and I have a right mouse button below the touchpad, doh) Tapping three fingers on my tiny EeePC touchpad is next to impossible so I want the old behavior. I found: synclient TapButtons2=2 synclient TapButtons3=3 but that did not work on 10.10 Does anyone know how to restore sane behavior?

  Read the article

• Disqus 2012 comments NOT being indexed by Google

  - by Buckers

  We run a high-traffic website at http://www.onedirection.net and we've been using Disqus throughout this year, initially to great effect. We accepted the upgrade to Disqus 2012 back in June, loving the increased user experience and the better community feel - albeit back to an Iframe again. However the fact we were specifically told that the comments are now being indexed by Google was great, and the dynamic nature of the iFrame suited our site (all our pages are cached, so by using Disqus the comments are updated straight away). However, it seems that the Disqus 2012 comments are not being indexed, and we've noticed an obvious fall in traffic over the last few months. Initially we didn't put this down to Disqus and focused on other issues (Google algorithm updates etc). But we're quickly coming down the reasoning that our pages now contain less indexable text, and we are getting less traffic because of this. We've tried emailing Disqus directly but they're very slow and don't seem keen to help. Any thoughts on this?

  Read the article

• SQL Why is prefixing column names considered bad practice?

  - by P.Brian.Mackey

  According to a popular SO post is it considered a bad practice to prefix table names. At my company every column is prefixed by a table name. This is difficult for me to read. I'm not sure the reason, but this naming is actually the company standard. I can't stand the naming convention, but I have no documentation to back up my reasoning. All I know is that reading AdventureWorks is much simpler. In this our company DB you will see a table, Person and it might have column name: Person_First_Name or maybe even Person_Person_First_Name (don't ask me why you see person 2x) Why is it considered a bad practice to pre-fix column names? Are underscores considered evil in SQL as well? Note: I own Pro SQL Server 2008 - Relation Database design and implementation. References to that book are welcome.

  Read the article

• In terms of SEO, is it better to have a URL broken down by folder, or with dashed names?

  - by VictorKilo

  I am creating a friendly url interpreter for my website. I have read dozens of similar topics on this site, but none that seem to address my particular situation. What I want to know is if it's better to have: A well broken down URL where each category is represented by a folder domain.com/1036/OR/Lane/Lowell/Wetleau-Subdivision -OR- A URL which groups all of the categories and terms together domain.com/1036/Wetleau-Subdivision-Lowell-OR-Lane I am asking only in terms of what is best for SEO, not necessarily human readability. My thinking is that it may be better to group them all together like they are in the second example. My reasoning being that all of those terms represent the page and are more likely to draw a result. I am a complete SEO nub though, and I crave some expert guidance. Thank you in advance for any help given.

  Read the article

• Where in a typical rendering pipeline does visibility and shading occur?

  - by user29163

  I am taking a computer graphics course. The book and the lecture notes are vague on the on the order of flow between the different steps in the rendering process. For example, if we have specified a view in a scene, and then want to perform a projection transformation for that given view, then we have to go through a sequence of transformations. In the end we end up with a normalized "viewcube" ready to be mapped 2D after clipping. But why do we end up with a cube (ie 3D thing), when a projection results in projecting the 3D objects to 2D. (depth information is lost?) The other line of reasoning is that all information further needed is stored within the "cube" and that visibility detection and shading is performed with respect to this cube and then we perform rasterezation.

  Read the article

• If I have true i/o false or vice versa, is it an OBOE?

  - by Protector one

  I often make the mistake of inverting my truth values in my code (e.g. in my if clauses). It gives me the same feeling as when making an OBOE (Off By One Error), even though it's technically not. Would you call it an OBOE, or better yet, is there a specific term for "off by truth value"-errors? My reasoning is that all possible values of a boolean are true and false. In other words, the possible values are contained in the array: [true, false]. If you access this array by index, you'll always be off by one… when selecting the wrong one. This becomes especially obvious when you calculate your index as: index = someInt % 2. Now I understand that this usually not the case, but in my mind, it always feels like this. Almost got it, just off by one…

  Read the article

• How do you code against CSRF malicious requests?

  - by user355950

  how to Decline malicious requests.... Cross-Site Request Forgery Severity: Medium Test Type: Application Remediation Tasks: Decline malicious requests Reasoning: The same request was sent twice in different sessions and the same response was received. This shows that none of the parameters are dynamic (session identifiers are sent only in cookies) and therefore that the application is vulnerable to this issue.

  Read the article

• I dont understand Access modifiers in OOP (JAVA)

  - by Imran

  I know this is a silly question but i don't understand Access Modifiers in OOP. Why do we make for example in JAVA instance variables private and then use public getter and setter methods to access them? I mean whats the reasoning/logic behind this? You still get to the instance variable but why use setter and getter methods when you can just make your variables public? please excuse my ignorance as i'm simply trying to understand why we do this? Thank you in advance;-)

  Read the article

• can rest framework like jersey be used in clojure instead of compojure

  - by foop1

  Hi , iam newbie to clojure, just curious as to can i use jersey REST api as REST webframework for clojure? all along i see people talking about compojure? if you can provide me any resource or reasoning that would be great Thank you

  Read the article

• in jQuery what is the difference between $.myFunction and $.fn.myFunction ?

  - by codeninja

  I'm delving into writing plugins for jQuery and I'm trying to understand the distinction between $.f and $.fn.f I've seen pluggin authors use both, or sometimes assign $.f = $.fn.f Can someone explain this to me, reasoning, benefits, etc?

  Read the article

• Utility method - Pass a File or String?

  - by James P.

  Here's an example of a utility method: public static Long getFileSize(String fileString) { File file = new File(fileString); if (file == null || !file.isFile()) return null; return file.length(); } Is it a good practise to pass a String rather than a File to a method like this? In general what reasoning should be applied when making utility methods of this style?

  Read the article

• Naming conventions for private members of .NET types

  - by Joan Venge

  Normally when I have a private field inside a class or a struct, I use camelCasing, so it would be obvious that it's indeed private when you see the name of it, but in some of my colleagues' C# code, I see that they use m_ mostly or sometimes _, like there is some sort of convention. Aren't .NET naming conventions prevent you from using underscores for member names? And when you mention the MS naming conventions or what not, they tell you it's the best way, but don't explain the reasoning behind it.

  Read the article

• Fluent API Style Usage

  - by Chris Dwyer

  When programming against a fluent API, I've seen the style mostly like this: var obj = objectFactory.CreateObject() .SetObjectParameter(paramName, value) .SetObjectParameter(paramName, value) .DoSomeTransformation(); What is the reasoning behind putting the dot at the beginning of the line instead of the end of the line like this: var obj = objectFactory.CreateObject(). SetObjectParameter(paramName, value). SetObjectParameter(paramName, value). DoSomeTransformation(); Or, is it merely a style thing that a team makes a consensus on?

  Read the article

• Why doesn't Python require exactly four spaces per indentation level?

  - by knorv

  Whitespace is signification in Python in that code blocks are defined by their indentation. Furthermore, Guido van Rossum recommends using four spaces per indentation level (see PEP 8: Style Guide for Python Code). What was the reasoning behind not requiring exactly four spaces per indentation level as well? Are there any technical reasons? It seems like all the arguments that can be made for making whitespace define code blocks can also be used to argument for setting an exact whitespace length for one indentation level (say four spaces).

  Read the article

• When to use Genetic Algorithms and when to use Neural Networks?

  - by Neil N

  Is there a rule of thumb or set of examples to determine when Genetic Algorithms versus when to use Neural Networks to solve a problem? I know there are cases in which you can have both methods mixed, but I am looking for a high level reasoning between the two methods. EDIT: XKCD has now touched on genetic algo's:

  Read the article

• xmlns naming convention

  - by elmuerte

  Do you use a naming convention for your XML namespaces? And if so, what reasoning lies behind it. I was actually amazed that hardly anyone wrote about a naming convention for XML namespaces. Most namespaces I've seen have the format of http://example.org/<some identifier> or http://example.org/scheme/<some identifier>. But that really lacks structuring beyond the initial "company" identifier.

  Read the article

• Why are side-effects modeled as monads in Haskell?

  - by bodacydo

  Could anyone give some pointers on why the unpure computations in Haskell are modeled as monads? I mean monad is just an interface with 4 operations, so what was the reasoning as modeling side-effects in it?

  Read the article

• Regex in Python

  - by newToProgramming

  SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

  Read the article

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >