Search Results

Search found 12672 results on 507 pages for 'anonymous methods'.

Page 40/507 | < Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >

  • Reflecting over classes in .NET produces methods only differing by a modifier

    - by mrjoltcola
    I'm a bit boggled by something, I hope the CLR gearheads can help. Apparently my gears aren't big enough. I have a reflector utility that generates assembly stubs for Cola for .NET, and I find classes have methods that only differ by a modifier, such as virtual. Example below, from Oracle.DataAccess.dll, method GetType(): class OracleTypeException : System.SystemException { virtual string ToString (); virtual System.Exception GetBaseException (); virtual void set_Source (string value); virtual void GetObjectData (System.Runtime.Serialization.SerializationInfo info, System.Runtime.Serialization.StreamingContext context); virtual System.Type GetType (); // here virtual bool Equals (object obj); virtual int32 GetHashCode (); System.Type GetType (); // and here } What is this? I have not been able to reproduce this with C# and it causes trouble for Cola as it thinks GetType() is a redefinition, since the signature is identical. My method reflector starts like this: static void DisplayMethod(MethodInfo m) { if ( // Filter out things Cola cannot yet import, like generics, pointers, etc. m.IsGenericMethodDefinition || m.ContainsGenericParameters || m.ReturnType.IsGenericType || !m.ReturnType.IsPublic || m.ReturnType.IsArray || m.ReturnType.IsPointer || m.ReturnType.IsByRef || m.ReturnType.IsPointer || m.ReturnType.IsMarshalByRef || m.ReturnType.IsImport ) return; // generate stub signature // [snipped] }

    Read the article

  • Choosing between instance methods and separate functions?

    - by StackedCrooked
    Adding functionality to a class can be done by adding a method or by defining a function that takes an object as its first parameter. Most programmers that I know would choose for the solution of adding a instance method. However, I sometimes prefer to create a separate function. For example, in the example code below Area and Diagonal are defined as separate functions instead of methods. I find it better this way because I think these functions provide enhancements rather than core functionality. Is this considered a good/bad practice? If the answer is "it depends", then what are the rules for deciding between adding method or defining a separate function? class Rect { public: Rect(int x, int y, int w, int h) : mX(x), mY(y), mWidth(w), mHeight(h) { } int x() const { return mX; } int y() const { return mY; } int width() const { return mWidth; } int height() const { return mHeight; } private: int mX, mY, mWidth, mHeight; }; int Area(const Rect & inRect) { return inRect.width() * inRect.height(); } float Diagonal(const Rect & inRect) { return std::sqrt(std::pow(static_cast<float>(inRect.width()), 2) + std::pow(static_cast<float>(inRect.height()), 2)); }

    Read the article

  • Java - Calling all methods of a class

    - by Thomas Eschemann
    I'm currently working on an application that has to render several Freemarker templates. So far I have a Generator class that handles the rendering. The class looks more or less like this: public class Generator { public static void generate(…) { renderTemplate1(); renderTemplate2(); renderTemplate3(); } private static void render(…) { // renders the template } private static void renderTemplate1() { // Create config object for the rendering // and calls render(); }; private static void renderTemplate1() { // Create config object for the rendering // and calls render(); }; … } This works, but it doesn't really feel right. What I would like to do is create a class that holds all the renderTemplate...() methods and then call them dynamically from my Generator class. This would make it cleaner and easier to extend. I was thinking about using something like reflection, but it doesn't really feel like a good solution either. Any idea on how to implement this properly ?

    Read the article

  • Rails Browser Detection Methods

    - by alvincrespo
    Hey Everyone, I was wondering what methods are standard within the industry to do browser detection in Rails? Is there a gem, library or sample code somewhere that can help determine the browser and apply a class or id to the body element of the (X)HTML? Thanks, I'm just wondering what everyone uses and whether there is accepted method of doing this? I know that we can get the user.agent and parse that string, but I'm not sure if that is that is an acceptable way to do browser detection. Also, I'm not trying to debate feature detection here, I've read multiple answers for that on StackOverflow, all I'm asking for is what you guys have done. [UPDATE] So thanks to faunzy on GitHub, I've sort of understand a bit about checking the user agent in Rails, but still not sure if this is the best way to go about it in Rails 3. But here is what I've gotten so far: def users_browser user_agent = request.env['HTTP_USER_AGENT'].downcase @users_browser ||= begin if user_agent.index('msie') && !user_agent.index('opera') && !user_agent.index('webtv') 'ie'+user_agent[user_agent.index('msie')+5].chr elsif user_agent.index('gecko/') 'gecko' elsif user_agent.index('opera') 'opera' elsif user_agent.index('konqueror') 'konqueror' elsif user_agent.index('ipod') 'ipod' elsif user_agent.index('ipad') 'ipad' elsif user_agent.index('iphone') 'iphone' elsif user_agent.index('chrome/') 'chrome' elsif user_agent.index('applewebkit/') 'safari' elsif user_agent.index('googlebot/') 'googlebot' elsif user_agent.index('msnbot') 'msnbot' elsif user_agent.index('yahoo! slurp') 'yahoobot' #Everything thinks it's mozilla, so this goes last elsif user_agent.index('mozilla/') 'gecko' else 'unknown' end end return @users_browser end

    Read the article

  • methods of metaclasses on class instances.

    - by Stefano Borini
    I was wondering what happens to methods declared on a metaclass. I expected that if you declare a method on a metaclass, it will end up being a classmethod, however, the behavior is different. Example >>> class A(object): ... @classmethod ... def foo(cls): ... print "foo" ... >>> a=A() >>> a.foo() foo >>> A.foo() foo However, if I try to define a metaclass and give it a method foo, it seems to work the same for the class, not for the instance. >>> class Meta(type): ... def foo(self): ... print "foo" ... >>> class A(object): ... __metaclass__=Meta ... def __init__(self): ... print "hello" ... >>> >>> a=A() hello >>> A.foo() foo >>> a.foo() Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'A' object has no attribute 'foo' What's going on here exactly ? edit: bumping the question

    Read the article

  • Hidden youtube player loses its methods

    - by zaius
    I'm controlling a embedded youtube chromeless player with javascript, and I want to hide it occasionally by setting display: none. However, when I show the player again, it loses its youtube methods. For example: <script> swfobject.embedSWF("http://www.youtube.com/apiplayer?enablejsapi=1&playerapiid=player", "player", "425", "356", "8", null, null, {allowScriptAccess: "always"}, {id: 'player'} ); var player = null; function onYouTubePlayerReady(playerId) { player = document.getElementById(playerId); player.addEventListener('onStateChange', 'playerStateChanged'); } function hidePlayer() { player.pauseVideo(); player.style.display = 'none'; } function showPlayer() { player.style.display = 'block'; player.playVideo(); } </script> <a href="#" onClick="hidePlayer();">hide</a> <a href="#" onClick="showPlayer();">show</a> <div id="player"></div> Calling hidePlayer followed by showPlayer gives this error on the playVideo call: Uncaught TypeError: Object #<an HTMLObjectElement> has no method 'playVideo' The only solution I can find is to use visibility: hidden, but that is messing with my page layout. Any other solutions out there?

    Read the article

  • java : how to handle the design when template methods throw exception when overrided method not throw

    - by jiafu
    when coding. try to solve the puzzle: how to design the class/methods when InputStreamDigestComputor throw IOException? It seems we can't use this degisn structure due to the template method throw exception but overrided method not throw it. but if change the overrided method to throw it, will cause other subclass both throw it. So can any good suggestion for this case? abstract class DigestComputor{ String compute(DigestAlgorithm algorithm){ MessageDigest instance; try { instance = MessageDigest.getInstance(algorithm.toString()); updateMessageDigest(instance); return hex(instance.digest()); } catch (NoSuchAlgorithmException e) { LOG.error(e.getMessage(), e); throw new UnsupportedOperationException(e.getMessage(), e); } } abstract void updateMessageDigest(MessageDigest instance); } class ByteBufferDigestComputor extends DigestComputor{ private final ByteBuffer byteBuffer; public ByteBufferDigestComputor(ByteBuffer byteBuffer) { super(); this.byteBuffer = byteBuffer; } @Override void updateMessageDigest(MessageDigest instance) { instance.update(byteBuffer); } } class InputStreamDigestComputor extends DigestComputor{ // this place has error. due to exception. if I change the overrided method to throw it. evey caller will handle the exception. but @Override void updateMessageDigest(MessageDigest instance) { throw new IOException(); } }

    Read the article

  • JavaScript: Very strange behavior with assigning methods in a loop

    - by Andrey
    Consider this code below: <a href="javascript:void(-1)" id="a1">a1</a> <a href="javascript:void(-1)" id="a2">a2</a> <script type="text/javascript"> var buttons = [] buttons.push("a1") buttons.push("a2") var actions = [] for (var i in buttons) { actions[buttons[i]] = function() { alert(i) } } var elements = document.getElementsByTagName("a") for (var k = 0; k < elements.length; k++) { elements[k].onclick = actions[elements[k].id] } </script> Basically, it shows two anchors, a1 and a2, and I expect to see "1" and "2" popping up in an alert when clicking on corresponding anchor. It doesn't happen, I get "2" when clicking on either. After spending an hour meditating on the code, I decided that it probably happens because dynamic onclick methods for both anchors keep the last value of "i". So I change that loop to for (var i in buttons) { var local_i = i.toString() actions[buttons[i]] = function() { alert(local_i) } } hoping that each dynamic function will get its own copy of "i" with immediate value. But after this change I get "1" popping up when I click on either link. What am I doing wrong? It's a huge show stopper for me.

    Read the article

  • Delegate Methods Not Firing on Search Results Table

    - by Slinky
    All, I have a UITableView w/detail, with a Search bar, created from code. Works fine on selected items except it doesn't work when an item is clicked from the search results; no delegate methods fire. Never seen this type of behavior before so I don't know where the issue lies. I get the same behavior with standard table cells as well as custom table cells. Appreciate any guidance on this and thanks. Just Hangs Here //ViewController.h @interface SongsViewController : UITableViewController <UISearchBarDelegate,UISearchDisplayDelegate> { NSMutableArray *searchData; UISearchBar *searchBar; UISearchDisplayController *searchDisplayController; UITableViewCell *customSongCell; } //ViewController.m -(void)viewDidLoad { [super viewDidLoad]; CGRect screenRect = [[UIScreen mainScreen] bounds]; CGFloat screenWidth = screenRect.size.width; searchBar = [[UISearchBar alloc] initWithFrame:CGRectMake(0, 0, screenWidth, 88)]; [searchBar setShowsScopeBar:YES]; [searchBar setScopeButtonTitles:[[NSArray alloc] initWithObjects:@"Title",@"Style", nil]]; searchDisplayController = [[UISearchDisplayController alloc] initWithSearchBar:searchBar contentsController:self]; searchDisplayController.delegate = self; searchDisplayController.searchResultsDataSource = self; self.tableView.tableHeaderView = searchBar; //Load custom table cell UINib *songCellNib = [UINib nibWithNibName:@"SongItem" bundle:nil]; //Register this nib, which contains the cell [[self tableView] registerNib:songCellNib forCellReuseIdentifier:@"SongItemCell"]; // create a filtered list that will contain products for the search results table. SongStore *ps = [SongStore defaultStore]; NSArray *songObjects = [ps allSongs]; self.filteredListContent = [NSMutableArray arrayWithCapacity: [songObjects count]]; self.masterSongArr = [[NSMutableArray alloc] initWithArray:[ps allSongs]]; [self refreshData]; [self.tableView reloadData]; self.tableView.scrollEnabled = YES; }

    Read the article

  • Doxygen including methods twice doc files

    - by Maarek
    I'm having this issue where doxygen is adding the method twice in the documentation file. Is there a setting that stops auto-generation of documentation for methods within the .m file. For example in the documentation I'll see something like whats below where the first definition of + (Status *)registerUser is from the header XXXXXX.h file where the second is from XXXXXX.m. Header documentation : /** @brief Test Yada Yada @return <#(description)#> */ + (Status *)registerUser; Output: + (Status *) registerUser Test Yada Yada. Returns: <#(description)#> + (Status *) registerUser <#(brief description)#> <#(comprehensive description)#> registerUser Returns: <#(description)#> Definition at line 24 of file XXXXXX.m. Here are the build related configuration options. I've tried playing with them. EXTRACT_ALL with YES and NO... Hiding uncodumented Members and Classes. #--------------------------------------------------------------------------- # Build related configuration options #--------------------------------------------------------------------------- EXTRACT_ALL = NO EXTRACT_PRIVATE = NO EXTRACT_STATIC = NO EXTRACT_LOCAL_CLASSES = YES EXTRACT_LOCAL_METHODS = NO EXTRACT_ANON_NSPACES = NO HIDE_UNDOC_MEMBERS = YES HIDE_UNDOC_CLASSES = YES HIDE_FRIEND_COMPOUNDS = NO HIDE_IN_BODY_DOCS = NO INTERNAL_DOCS = NO CASE_SENSE_NAMES = NO HIDE_SCOPE_NAMES = NO SHOW_INCLUDE_FILES = YES FORCE_LOCAL_INCLUDES = NO INLINE_INFO = YES SORT_MEMBER_DOCS = YES SORT_BRIEF_DOCS = NO SORT_MEMBERS_CTORS_1ST = NO SORT_GROUP_NAMES = NO SORT_BY_SCOPE_NAME = NO

    Read the article

  • Exceptions over remote methods

    - by Andrei Vajna II
    What are the best practices for exceptions over remote methods? I'm sure that you need to handle all exceptions at the level of a remote method implementation, because you need to log it on the server side. But what should you do afterwards? Should you wrap the exception in a RemoteException (java) and throw it to the client? This would mean that the client would have to import all exceptions that could be thrown. Would it be better to throw a new custom exception with fewer details? Because the client won't need to know all the details of what went wrong. What should you log on the client? I've even heard of using return codes(for efficiency maybe?) to tell the caller about what happened. The important thing to keep in mind, is that the client must be informed of what went wrong. A generic answer of "Something failed" or no notification at all is unacceptable. And what about runtime (unchecked) exceptions?

    Read the article

  • C++ Virtual Methods for Class-Specific Attributes or External Structure

    - by acanaday
    I have a set of classes which are all derived from a common base class. I want to use these classes polymorphically. The interface defines a set of getter methods whose return values are constant across a given derived class, but vary from one derived class to another. e.g.: enum AVal { A_VAL_ONE, A_VAL_TWO, A_VAL_THREE }; enum BVal { B_VAL_ONE, B_VAL_TWO, B_VAL_THREE }; class Base { //... virtual AVal getAVal() const = 0; virtual BVal getBVal() const = 0; //... }; class One : public Base { //... AVal getAVal() const { return A_VAL_ONE }; BVal getBVal() const { return B_VAL_ONE }; //... }; class Two : public Base { //... AVal getAVal() const { return A_VAL_TWO }; BVal getBVal() const { return B_VAL_TWO }; //... }; etc. Is this a common way of doing things? If performance is an important consideration, would I be better off pulling the attributes out into an external structure, e.g.: struct Vals { AVal a_val; VBal b_val; }; storing a Vals* in each instance, and rewriting Base as follows? class Base { //... public: AVal getAVal() const { return _vals->a_val; }; BVal getBVal() const { return _vals->b_val; }; //... private: Vals* _vals; }; Is the extra dereference essentially the same as the vtable lookup? What is the established idiom for this type of situation? Are both of these solutions dumb? Any insights are greatly appreciated

    Read the article

  • JSF getter methods called BEFORE beforePhase fires

    - by Bill Leeper
    I got a recommendation to put all data lookups in the beforePhase for a given page, however, now that I am doing some deeper analysis it appears that some getter methods are being called before the beforePhase is fired. It became very obvious when I added support for a url parameter and I was getting NPEs on objects that are initialized in the beforePhase call. Any thoughts? Something I have set wrong. I have this in my JSP page: <f:view beforePhase="#{someController.beforePhaseSummary}"> That is only the 5th line in the JSP file and is right after the taglibs. Here is the code that is in the beforePhaseSummary method: public void beforePhaseSummary(PhaseEvent event) { logger.debug("Fired Before Phase Summary: " + event.getPhaseId()); if (event.getPhaseId() == PhaseId.RENDER_RESPONSE) { HttpServletRequest request = (HttpServletRequest)FacesContext.getCurrentInstance().getExternalContext().getRequest(); if (request.getParameter("application_id") != null) { loadApplication(Long.parseLong(request.getParameter("application_id"))); } /* Do data fetches here */ } } The logging output above indicates that an event is fired. The servlet request is used to capture the url parameters. The data fetches gather data. However, the logging output is below: 2010-04-23 13:44:46,968 [http-8080-4] DEBUG ...SomeController 61 - Get Permit 2010-04-23 13:44:46,968 [http-8080-4] DEBUG ...SomeController 107 - Getting UnsubmittedCount 2010-04-23 13:44:46,984 [http-8080-4] DEBUG ...SomeController 61 - Get Permit 2010-04-23 13:44:47,031 [http-8080-4] DEBUG ...SomeController 133 - Fired Before Phase Summary: RENDER_RESPONSE(6) The logs indicate 2 calls to the getPermit method and one to getUnsubmittedCount before the beforePhase is fired.

    Read the article

  • Common methods/implementation across multiple WCF Services

    - by Rob
    I'm looking at implementing some WCF Services as part of an API for 3rd parties to access data within a product I work on. There are currently a set of services exposed as "classic" .net Web Services and I need to emulate the behaviour of these, at least in part. The existing services all have an AcquireAuthenticationToken method that takes a set of parameters (username, password, etc) and return a session token (represented as a GUID), which is then passed in on calls to any other method (There's also a ReleaseAuthenticationToken method, no guesses needed as to what that does!). What I want to do is implement multiple WCF services, such as: ProductData UserData and have both of these services share a common implementation of Acquire/Release. From the base project that is created by VS2k8, it would appear I will start with, per service: public class ServiceName : IServiceName { } public interface IServiceName { } Therefore my questions would be: Will WCF tolerate me adding a base class to this, public class ServiceName : ServiceBase, IServiceName, or does the fact that there's an interface involved mean that won't work? If "No it won't work" to Question 1, could I change IServiceName so it extends another interface, IServiceBase, thus forcing the presence of Acquire/Release methods, but then having to supply the implementation in each service. Are 1 and 2 both really bad ideas and there's actually a much better solution that, knowing next to nothing about WCF, I just haven't thought of?

    Read the article

  • What are various methods for discovering test cases

    - by NativeByte
    All, I am a developer but like to know more about testing process and methods. I believe this helps me write more solid code as it improves the cases I can test using my unit tests before delivering product to the test team. I have recently started looking at Test Driven Development and Exploratory testing approach to software projects. Now it's easier for me to find test cases for the code that I have written. But I am curios to know how to discover test cases when I am not the developer for the functionality under test. Say for e.g. let's have a basic user registration form that we see on various websites. Assuming the person testing it is not the developer of the form, how should one go about testing the input fields on the form, what would be your strategy? How would you discover test cases? I believe this kind of testing benefits from exploratory testing approach, i may be wrong here though. I would appreciate your views on this. Thanks, Byte

    Read the article

  • Refactoring two methods down to one

    - by bflemi3
    I have two methods that almost do the same thing. They get a List<XmlNode> based on state OR state and schoolType and then return a distinct, ordered IEnumerable<KeyValuePair<string,string>>. I know they can be refactored but I'm struggling to determine what type the parameter should be for the linq statement in the return of the method (the last line of each method). I thank you for your help in advance. private IEnumerable<KeyValuePair<string, string>> getAreaDropDownDataSource() { StateInfoXmlDocument stateInfoXmlDocument = new StateInfoXmlDocument(); string schoolTypeXmlPath = string.Format(STATE_AND_SCHOOL_TYPE_XML_PATH, StateOfInterest, ConnectionsLearningSchoolType); var schoolNodes = new List<XmlNode>(stateInfoXmlDocument.SelectNodes(schoolTypeXmlPath).Cast<XmlNode>()); return schoolNodes.Select(x => new KeyValuePair<string, string>(x.Attributes["idLocation"].Value, x.Value)).OrderBy(x => x.Key).Distinct(); } private IEnumerable<KeyValuePair<string, string>> getStateOfInterestDropDownDataSource() { StateInfoXmlDocument stateInfoXmlDocument = new StateInfoXmlDocument(); string schoolTypeXmlPath = string.Format(SCHOOL_TYPE_XML_PATH, ConnectionsLearningSchoolType); var schoolNodes = new List<XmlNode>(stateInfoXmlDocument.SelectNodes(schoolTypeXmlPath).Cast<XmlNode>()); return schoolNodes.Select(x => new KeyValuePair<string, string>(x.Attributes["stateCode"].Value, x.Attributes["stateName"].Value)).OrderBy(x => x.Key).Distinct(); }

    Read the article

  • Running Java Program linking to thirdpary library (java -jar) issue ( Multiple methods tried )

    - by bamachrn
    This issue is related to running a Java program (jar) dependent on thirdparty jar library even after setting classpath and trying so many other methods by reading articles in Internet. I want to use a thirdparty Pack1.jar (it is not a part of jvm) as dependency of my programme. I do not know where the Pack1.jar file could be in the deployment machine and I want the deployer to specify the path for the thirdparty libraries I have tried the following alternatives in vain Setting the java.class.path programatically String class_path = args[0]; System.setProperty("java.class.path",class_path); Here I am assuming that deployer would supply the classpath as first argument while running the program Setting the CLASSPATH env_var to locate the thirdparty directory While running, using the classpath option java -classpath /path/to/Pack1.jar -jar Pack2.jar I think this would not work because documentation says that classpath is ignored when program is run with "java -jar" Setting the java.ext.dirs programatically. Setting the java.library.path programatically. I do not want to specify the Class-Path in manifest because that takes only relative path and I do not know where the thirdparty library would be kept in deployment machine But I am unable to get the jar running. How can I fix this problem any help please.

    Read the article

  • Call AsyncTask methods from another class/service (callbacks?)

    - by TiGer
    Hi, I was wondering if it's possible to call specific methods defined within the AsynTask class from another class and/or service ? In my specific case I have a Service playing some sounds, but the sound is selected from a List with available sounds... When a sounds is selected it is downloaded from my home server, this takes some time (not much, let's say around the 3-4 seconds, the sounds/effects aren't big in size)... So my problem at the moment is that I have a service to play those sounds, and when I select one I wanted to show a progressdialog... The way (if I understood correctly) is to use an AsyncTask, but the only thing the AsyncTask will do is telling my Service to play a specific sound from my server... So there is no "callback" from the service to the Asynctask... How can I achieve that ? How can I call a running AsyncTask, which sits in another class, and tell him all work is done and thus he can stop showing the ProgressDialog ? Or am I over-engineering it and there are other ways ? Thanks in advance...

    Read the article

  • [Scala] Using overloaded, typed methods on a collection

    - by stephanos
    I'm quite new to Scala and struggling with the following: I have database objects (type of BaseDoc) and value objects (type of BaseVO). Now there are multiple convert methods (all called 'convert') that take an instance of an object and convert it to the other type accordingly. For example: def convert(doc: ClickDoc): ClickVO = doc match { case null => null case _ => val result = new ClickVO result.x = doc.x result.y = doc.y result } Now I sometimes need to convert a list of objects. How would I do this - I tried: def convert[D <: MyBaseDoc, V <: BaseVO](docs: List[D]):List[V] = docs match { case List() => List() case xs => xs.map(doc => convert(doc)) } Which results in 'overloaded method value convert with alternatives ...'. I tried to add manifest information to it, but couldn't make it work. I couldn't even create one method for each because it'd say that they have the same parameter type after type erasure (List). Ideas welcome!

    Read the article

  • Problem with class methods in objective c

    - by Rajashekar
    Hi Guys i have a tableview controller like so, NSString *selectedindex; @interface ContactsController : UITableViewController { NSMutableArray *names; NSMutableArray *phonenumbers; NSMutableArray *contacts; DatabaseCRUD *sampledatabase; } +(NSString *) returnselectedindex; @end in the implementation file i have +(NSString *) returnselectedindex { return selectedindex; } when a row is selected in the tableview i put have the following code. selectedindex = [NSString stringWithFormat:@"%d", indexPath.row]; NSLog(@"selected row is %@",selectedindex); in a different class i am trying to access the selectedindex. like so selected = [ContactsController returnselectedindex]; NSLog(@"selected is %@",selected); it gives me a warning: 'ContactsController' may not respond to '+returnselectedindex' and crashes. i am not sure why. i have used class methods previously lot of times , and never had a problem. any help please. Thank You.

    Read the article

  • value types in the vm

    - by john.rose
    value types in the vm p.p1 {margin: 0.0px 0.0px 0.0px 0.0px; font: 14.0px Times} p.p2 {margin: 0.0px 0.0px 14.0px 0.0px; font: 14.0px Times} p.p3 {margin: 0.0px 0.0px 12.0px 0.0px; font: 14.0px Times} p.p4 {margin: 0.0px 0.0px 15.0px 0.0px; font: 14.0px Times} p.p5 {margin: 0.0px 0.0px 0.0px 0.0px; font: 14.0px Courier} p.p6 {margin: 0.0px 0.0px 0.0px 0.0px; font: 14.0px Courier; min-height: 17.0px} p.p7 {margin: 0.0px 0.0px 0.0px 0.0px; font: 14.0px Times; min-height: 18.0px} p.p8 {margin: 0.0px 0.0px 0.0px 36.0px; text-indent: -36.0px; font: 14.0px Times; min-height: 18.0px} p.p9 {margin: 0.0px 0.0px 12.0px 0.0px; font: 14.0px Times; min-height: 18.0px} p.p10 {margin: 0.0px 0.0px 12.0px 0.0px; font: 14.0px Times; color: #000000} li.li1 {margin: 0.0px 0.0px 0.0px 0.0px; font: 14.0px Times} li.li7 {margin: 0.0px 0.0px 0.0px 0.0px; font: 14.0px Times; min-height: 18.0px} span.s1 {font: 14.0px Courier} span.s2 {color: #000000} span.s3 {font: 14.0px Courier; color: #000000} ol.ol1 {list-style-type: decimal} Or, enduring values for a changing world. Introduction A value type is a data type which, generally speaking, is designed for being passed by value in and out of methods, and stored by value in data structures. The only value types which the Java language directly supports are the eight primitive types. Java indirectly and approximately supports value types, if they are implemented in terms of classes. For example, both Integer and String may be viewed as value types, especially if their usage is restricted to avoid operations appropriate to Object. In this note, we propose a definition of value types in terms of a design pattern for Java classes, accompanied by a set of usage restrictions. We also sketch the relation of such value types to tuple types (which are a JVM-level notion), and point out JVM optimizations that can apply to value types. This note is a thought experiment to extend the JVM’s performance model in support of value types. The demonstration has two phases.  Initially the extension can simply use design patterns, within the current bytecode architecture, and in today’s Java language. But if the performance model is to be realized in practice, it will probably require new JVM bytecode features, changes to the Java language, or both.  We will look at a few possibilities for these new features. An Axiom of Value In the context of the JVM, a value type is a data type equipped with construction, assignment, and equality operations, and a set of typed components, such that, whenever two variables of the value type produce equal corresponding values for their components, the values of the two variables cannot be distinguished by any JVM operation. Here are some corollaries: A value type is immutable, since otherwise a copy could be constructed and the original could be modified in one of its components, allowing the copies to be distinguished. Changing the component of a value type requires construction of a new value. The equals and hashCode operations are strictly component-wise. If a value type is represented by a JVM reference, that reference cannot be successfully synchronized on, and cannot be usefully compared for reference equality. A value type can be viewed in terms of what it doesn’t do. We can say that a value type omits all value-unsafe operations, which could violate the constraints on value types.  These operations, which are ordinarily allowed for Java object types, are pointer equality comparison (the acmp instruction), synchronization (the monitor instructions), all the wait and notify methods of class Object, and non-trivial finalize methods. The clone method is also value-unsafe, although for value types it could be treated as the identity function. Finally, and most importantly, any side effect on an object (however visible) also counts as an value-unsafe operation. A value type may have methods, but such methods must not change the components of the value. It is reasonable and useful to define methods like toString, equals, and hashCode on value types, and also methods which are specifically valuable to users of the value type. Representations of Value Value types have two natural representations in the JVM, unboxed and boxed. An unboxed value consists of the components, as simple variables. For example, the complex number x=(1+2i), in rectangular coordinate form, may be represented in unboxed form by the following pair of variables: /*Complex x = Complex.valueOf(1.0, 2.0):*/ double x_re = 1.0, x_im = 2.0; These variables might be locals, parameters, or fields. Their association as components of a single value is not defined to the JVM. Here is a sample computation which computes the norm of the difference between two complex numbers: double distance(/*Complex x:*/ double x_re, double x_im,         /*Complex y:*/ double y_re, double y_im) {     /*Complex z = x.minus(y):*/     double z_re = x_re - y_re, z_im = x_im - y_im;     /*return z.abs():*/     return Math.sqrt(z_re*z_re + z_im*z_im); } A boxed representation groups component values under a single object reference. The reference is to a ‘wrapper class’ that carries the component values in its fields. (A primitive type can naturally be equated with a trivial value type with just one component of that type. In that view, the wrapper class Integer can serve as a boxed representation of value type int.) The unboxed representation of complex numbers is practical for many uses, but it fails to cover several major use cases: return values, array elements, and generic APIs. The two components of a complex number cannot be directly returned from a Java function, since Java does not support multiple return values. The same story applies to array elements: Java has no ’array of structs’ feature. (Double-length arrays are a possible workaround for complex numbers, but not for value types with heterogeneous components.) By generic APIs I mean both those which use generic types, like Arrays.asList and those which have special case support for primitive types, like String.valueOf and PrintStream.println. Those APIs do not support unboxed values, and offer some problems to boxed values. Any ’real’ JVM type should have a story for returns, arrays, and API interoperability. The basic problem here is that value types fall between primitive types and object types. Value types are clearly more complex than primitive types, and object types are slightly too complicated. Objects are a little bit dangerous to use as value carriers, since object references can be compared for pointer equality, and can be synchronized on. Also, as many Java programmers have observed, there is often a performance cost to using wrapper objects, even on modern JVMs. Even so, wrapper classes are a good starting point for talking about value types. If there were a set of structural rules and restrictions which would prevent value-unsafe operations on value types, wrapper classes would provide a good notation for defining value types. This note attempts to define such rules and restrictions. Let’s Start Coding Now it is time to look at some real code. Here is a definition, written in Java, of a complex number value type. @ValueSafe public final class Complex implements java.io.Serializable {     // immutable component structure:     public final double re, im;     private Complex(double re, double im) {         this.re = re; this.im = im;     }     // interoperability methods:     public String toString() { return "Complex("+re+","+im+")"; }     public List<Double> asList() { return Arrays.asList(re, im); }     public boolean equals(Complex c) {         return re == c.re && im == c.im;     }     public boolean equals(@ValueSafe Object x) {         return x instanceof Complex && equals((Complex) x);     }     public int hashCode() {         return 31*Double.valueOf(re).hashCode()                 + Double.valueOf(im).hashCode();     }     // factory methods:     public static Complex valueOf(double re, double im) {         return new Complex(re, im);     }     public Complex changeRe(double re2) { return valueOf(re2, im); }     public Complex changeIm(double im2) { return valueOf(re, im2); }     public static Complex cast(@ValueSafe Object x) {         return x == null ? ZERO : (Complex) x;     }     // utility methods and constants:     public Complex plus(Complex c)  { return new Complex(re+c.re, im+c.im); }     public Complex minus(Complex c) { return new Complex(re-c.re, im-c.im); }     public double abs() { return Math.sqrt(re*re + im*im); }     public static final Complex PI = valueOf(Math.PI, 0.0);     public static final Complex ZERO = valueOf(0.0, 0.0); } This is not a minimal definition, because it includes some utility methods and other optional parts.  The essential elements are as follows: The class is marked as a value type with an annotation. The class is final, because it does not make sense to create subclasses of value types. The fields of the class are all non-private and final.  (I.e., the type is immutable and structurally transparent.) From the supertype Object, all public non-final methods are overridden. The constructor is private. Beyond these bare essentials, we can observe the following features in this example, which are likely to be typical of all value types: One or more factory methods are responsible for value creation, including a component-wise valueOf method. There are utility methods for complex arithmetic and instance creation, such as plus and changeIm. There are static utility constants, such as PI. The type is serializable, using the default mechanisms. There are methods for converting to and from dynamically typed references, such as asList and cast. The Rules In order to use value types properly, the programmer must avoid value-unsafe operations.  A helpful Java compiler should issue errors (or at least warnings) for code which provably applies value-unsafe operations, and should issue warnings for code which might be correct but does not provably avoid value-unsafe operations.  No such compilers exist today, but to simplify our account here, we will pretend that they do exist. A value-safe type is any class, interface, or type parameter marked with the @ValueSafe annotation, or any subtype of a value-safe type.  If a value-safe class is marked final, it is in fact a value type.  All other value-safe classes must be abstract.  The non-static fields of a value class must be non-public and final, and all its constructors must be private. Under the above rules, a standard interface could be helpful to define value types like Complex.  Here is an example: @ValueSafe public interface ValueType extends java.io.Serializable {     // All methods listed here must get redefined.     // Definitions must be value-safe, which means     // they may depend on component values only.     List<? extends Object> asList();     int hashCode();     boolean equals(@ValueSafe Object c);     String toString(); } //@ValueSafe inherited from supertype: public final class Complex implements ValueType { … The main advantage of such a conventional interface is that (unlike an annotation) it is reified in the runtime type system.  It could appear as an element type or parameter bound, for facilities which are designed to work on value types only.  More broadly, it might assist the JVM to perform dynamic enforcement of the rules for value types. Besides types, the annotation @ValueSafe can mark fields, parameters, local variables, and methods.  (This is redundant when the type is also value-safe, but may be useful when the type is Object or another supertype of a value type.)  Working forward from these annotations, an expression E is defined as value-safe if it satisfies one or more of the following: The type of E is a value-safe type. E names a field, parameter, or local variable whose declaration is marked @ValueSafe. E is a call to a method whose declaration is marked @ValueSafe. E is an assignment to a value-safe variable, field reference, or array reference. E is a cast to a value-safe type from a value-safe expression. E is a conditional expression E0 ? E1 : E2, and both E1 and E2 are value-safe. Assignments to value-safe expressions and initializations of value-safe names must take their values from value-safe expressions. A value-safe expression may not be the subject of a value-unsafe operation.  In particular, it cannot be synchronized on, nor can it be compared with the “==” operator, not even with a null or with another value-safe type. In a program where all of these rules are followed, no value-type value will be subject to a value-unsafe operation.  Thus, the prime axiom of value types will be satisfied, that no two value type will be distinguishable as long as their component values are equal. More Code To illustrate these rules, here are some usage examples for Complex: Complex pi = Complex.valueOf(Math.PI, 0); Complex zero = pi.changeRe(0);  //zero = pi; zero.re = 0; ValueType vtype = pi; @SuppressWarnings("value-unsafe")   Object obj = pi; @ValueSafe Object obj2 = pi; obj2 = new Object();  // ok List<Complex> clist = new ArrayList<Complex>(); clist.add(pi);  // (ok assuming List.add param is @ValueSafe) List<ValueType> vlist = new ArrayList<ValueType>(); vlist.add(pi);  // (ok) List<Object> olist = new ArrayList<Object>(); olist.add(pi);  // warning: "value-unsafe" boolean z = pi.equals(zero); boolean z1 = (pi == zero);  // error: reference comparison on value type boolean z2 = (pi == null);  // error: reference comparison on value type boolean z3 = (pi == obj2);  // error: reference comparison on value type synchronized (pi) { }  // error: synch of value, unpredictable result synchronized (obj2) { }  // unpredictable result Complex qq = pi; qq = null;  // possible NPE; warning: “null-unsafe" qq = (Complex) obj;  // warning: “null-unsafe" qq = Complex.cast(obj);  // OK @SuppressWarnings("null-unsafe")   Complex empty = null;  // possible NPE qq = empty;  // possible NPE (null pollution) The Payoffs It follows from this that either the JVM or the java compiler can replace boxed value-type values with unboxed ones, without affecting normal computations.  Fields and variables of value types can be split into their unboxed components.  Non-static methods on value types can be transformed into static methods which take the components as value parameters. Some common questions arise around this point in any discussion of value types. Why burden the programmer with all these extra rules?  Why not detect programs automagically and perform unboxing transparently?  The answer is that it is easy to break the rules accidently unless they are agreed to by the programmer and enforced.  Automatic unboxing optimizations are tantalizing but (so far) unreachable ideal.  In the current state of the art, it is possible exhibit benchmarks in which automatic unboxing provides the desired effects, but it is not possible to provide a JVM with a performance model that assures the programmer when unboxing will occur.  This is why I’m writing this note, to enlist help from, and provide assurances to, the programmer.  Basically, I’m shooting for a good set of user-supplied “pragmas” to frame the desired optimization. Again, the important thing is that the unboxing must be done reliably, or else programmers will have no reason to work with the extra complexity of the value-safety rules.  There must be a reasonably stable performance model, wherein using a value type has approximately the same performance characteristics as writing the unboxed components as separate Java variables. There are some rough corners to the present scheme.  Since Java fields and array elements are initialized to null, value-type computations which incorporate uninitialized variables can produce null pointer exceptions.  One workaround for this is to require such variables to be null-tested, and the result replaced with a suitable all-zero value of the value type.  That is what the “cast” method does above. Generically typed APIs like List<T> will continue to manipulate boxed values always, at least until we figure out how to do reification of generic type instances.  Use of such APIs will elicit warnings until their type parameters (and/or relevant members) are annotated or typed as value-safe.  Retrofitting List<T> is likely to expose flaws in the present scheme, which we will need to engineer around.  Here are a couple of first approaches: public interface java.util.List<@ValueSafe T> extends Collection<T> { … public interface java.util.List<T extends Object|ValueType> extends Collection<T> { … (The second approach would require disjunctive types, in which value-safety is “contagious” from the constituent types.) With more transformations, the return value types of methods can also be unboxed.  This may require significant bytecode-level transformations, and would work best in the presence of a bytecode representation for multiple value groups, which I have proposed elsewhere under the title “Tuples in the VM”. But for starters, the JVM can apply this transformation under the covers, to internally compiled methods.  This would give a way to express multiple return values and structured return values, which is a significant pain-point for Java programmers, especially those who work with low-level structure types favored by modern vector and graphics processors.  The lack of multiple return values has a strong distorting effect on many Java APIs. Even if the JVM fails to unbox a value, there is still potential benefit to the value type.  Clustered computing systems something have copy operations (serialization or something similar) which apply implicitly to command operands.  When copying JVM objects, it is extremely helpful to know when an object’s identity is important or not.  If an object reference is a copied operand, the system may have to create a proxy handle which points back to the original object, so that side effects are visible.  Proxies must be managed carefully, and this can be expensive.  On the other hand, value types are exactly those types which a JVM can “copy and forget” with no downside. Array types are crucial to bulk data interfaces.  (As data sizes and rates increase, bulk data becomes more important than scalar data, so arrays are definitely accompanying us into the future of computing.)  Value types are very helpful for adding structure to bulk data, so a successful value type mechanism will make it easier for us to express richer forms of bulk data. Unboxing arrays (i.e., arrays containing unboxed values) will provide better cache and memory density, and more direct data movement within clustered or heterogeneous computing systems.  They require the deepest transformations, relative to today’s JVM.  There is an impedance mismatch between value-type arrays and Java’s covariant array typing, so compromises will need to be struck with existing Java semantics.  It is probably worth the effort, since arrays of unboxed value types are inherently more memory-efficient than standard Java arrays, which rely on dependent pointer chains. It may be sufficient to extend the “value-safe” concept to array declarations, and allow low-level transformations to change value-safe array declarations from the standard boxed form into an unboxed tuple-based form.  Such value-safe arrays would not be convertible to Object[] arrays.  Certain connection points, such as Arrays.copyOf and System.arraycopy might need additional input/output combinations, to allow smooth conversion between arrays with boxed and unboxed elements. Alternatively, the correct solution may have to wait until we have enough reification of generic types, and enough operator overloading, to enable an overhaul of Java arrays. Implicit Method Definitions The example of class Complex above may be unattractively complex.  I believe most or all of the elements of the example class are required by the logic of value types. If this is true, a programmer who writes a value type will have to write lots of error-prone boilerplate code.  On the other hand, I think nearly all of the code (except for the domain-specific parts like plus and minus) can be implicitly generated. Java has a rule for implicitly defining a class’s constructor, if no it defines no constructors explicitly.  Likewise, there are rules for providing default access modifiers for interface members.  Because of the highly regular structure of value types, it might be reasonable to perform similar implicit transformations on value types.  Here’s an example of a “highly implicit” definition of a complex number type: public class Complex implements ValueType {  // implicitly final     public double re, im;  // implicitly public final     //implicit methods are defined elementwise from te fields:     //  toString, asList, equals(2), hashCode, valueOf, cast     //optionally, explicit methods (plus, abs, etc.) would go here } In other words, with the right defaults, a simple value type definition can be a one-liner.  The observant reader will have noticed the similarities (and suitable differences) between the explicit methods above and the corresponding methods for List<T>. Another way to abbreviate such a class would be to make an annotation the primary trigger of the functionality, and to add the interface(s) implicitly: public @ValueType class Complex { … // implicitly final, implements ValueType (But to me it seems better to communicate the “magic” via an interface, even if it is rooted in an annotation.) Implicitly Defined Value Types So far we have been working with nominal value types, which is to say that the sequence of typed components is associated with a name and additional methods that convey the intention of the programmer.  A simple ordered pair of floating point numbers can be variously interpreted as (to name a few possibilities) a rectangular or polar complex number or Cartesian point.  The name and the methods convey the intended meaning. But what if we need a truly simple ordered pair of floating point numbers, without any further conceptual baggage?  Perhaps we are writing a method (like “divideAndRemainder”) which naturally returns a pair of numbers instead of a single number.  Wrapping the pair of numbers in a nominal type (like “QuotientAndRemainder”) makes as little sense as wrapping a single return value in a nominal type (like “Quotient”).  What we need here are structural value types commonly known as tuples. For the present discussion, let us assign a conventional, JVM-friendly name to tuples, roughly as follows: public class java.lang.tuple.$DD extends java.lang.tuple.Tuple {      double $1, $2; } Here the component names are fixed and all the required methods are defined implicitly.  The supertype is an abstract class which has suitable shared declarations.  The name itself mentions a JVM-style method parameter descriptor, which may be “cracked” to determine the number and types of the component fields. The odd thing about such a tuple type (and structural types in general) is it must be instantiated lazily, in response to linkage requests from one or more classes that need it.  The JVM and/or its class loaders must be prepared to spin a tuple type on demand, given a simple name reference, $xyz, where the xyz is cracked into a series of component types.  (Specifics of naming and name mangling need some tasteful engineering.) Tuples also seem to demand, even more than nominal types, some support from the language.  (This is probably because notations for non-nominal types work best as combinations of punctuation and type names, rather than named constructors like Function3 or Tuple2.)  At a minimum, languages with tuples usually (I think) have some sort of simple bracket notation for creating tuples, and a corresponding pattern-matching syntax (or “destructuring bind”) for taking tuples apart, at least when they are parameter lists.  Designing such a syntax is no simple thing, because it ought to play well with nominal value types, and also with pre-existing Java features, such as method parameter lists, implicit conversions, generic types, and reflection.  That is a task for another day. Other Use Cases Besides complex numbers and simple tuples there are many use cases for value types.  Many tuple-like types have natural value-type representations. These include rational numbers, point locations and pixel colors, and various kinds of dates and addresses. Other types have a variable-length ‘tail’ of internal values. The most common example of this is String, which is (mathematically) a sequence of UTF-16 character values. Similarly, bit vectors, multiple-precision numbers, and polynomials are composed of sequences of values. Such types include, in their representation, a reference to a variable-sized data structure (often an array) which (somehow) represents the sequence of values. The value type may also include ’header’ information. Variable-sized values often have a length distribution which favors short lengths. In that case, the design of the value type can make the first few values in the sequence be direct ’header’ fields of the value type. In the common case where the header is enough to represent the whole value, the tail can be a shared null value, or even just a null reference. Note that the tail need not be an immutable object, as long as the header type encapsulates it well enough. This is the case with String, where the tail is a mutable (but never mutated) character array. Field types and their order must be a globally visible part of the API.  The structure of the value type must be transparent enough to have a globally consistent unboxed representation, so that all callers and callees agree about the type and order of components  that appear as parameters, return types, and array elements.  This is a trade-off between efficiency and encapsulation, which is forced on us when we remove an indirection enjoyed by boxed representations.  A JVM-only transformation would not care about such visibility, but a bytecode transformation would need to take care that (say) the components of complex numbers would not get swapped after a redefinition of Complex and a partial recompile.  Perhaps constant pool references to value types need to declare the field order as assumed by each API user. This brings up the delicate status of private fields in a value type.  It must always be possible to load, store, and copy value types as coordinated groups, and the JVM performs those movements by moving individual scalar values between locals and stack.  If a component field is not public, what is to prevent hostile code from plucking it out of the tuple using a rogue aload or astore instruction?  Nothing but the verifier, so we may need to give it more smarts, so that it treats value types as inseparable groups of stack slots or locals (something like long or double). My initial thought was to make the fields always public, which would make the security problem moot.  But public is not always the right answer; consider the case of String, where the underlying mutable character array must be encapsulated to prevent security holes.  I believe we can win back both sides of the tradeoff, by training the verifier never to split up the components in an unboxed value.  Just as the verifier encapsulates the two halves of a 64-bit primitive, it can encapsulate the the header and body of an unboxed String, so that no code other than that of class String itself can take apart the values. Similar to String, we could build an efficient multi-precision decimal type along these lines: public final class DecimalValue extends ValueType {     protected final long header;     protected private final BigInteger digits;     public DecimalValue valueOf(int value, int scale) {         assert(scale >= 0);         return new DecimalValue(((long)value << 32) + scale, null);     }     public DecimalValue valueOf(long value, int scale) {         if (value == (int) value)             return valueOf((int)value, scale);         return new DecimalValue(-scale, new BigInteger(value));     } } Values of this type would be passed between methods as two machine words. Small values (those with a significand which fits into 32 bits) would be represented without any heap data at all, unless the DecimalValue itself were boxed. (Note the tension between encapsulation and unboxing in this case.  It would be better if the header and digits fields were private, but depending on where the unboxing information must “leak”, it is probably safer to make a public revelation of the internal structure.) Note that, although an array of Complex can be faked with a double-length array of double, there is no easy way to fake an array of unboxed DecimalValues.  (Either an array of boxed values or a transposed pair of homogeneous arrays would be reasonable fallbacks, in a current JVM.)  Getting the full benefit of unboxing and arrays will require some new JVM magic. Although the JVM emphasizes portability, system dependent code will benefit from using machine-level types larger than 64 bits.  For example, the back end of a linear algebra package might benefit from value types like Float4 which map to stock vector types.  This is probably only worthwhile if the unboxing arrays can be packed with such values. More Daydreams A more finely-divided design for dynamic enforcement of value safety could feature separate marker interfaces for each invariant.  An empty marker interface Unsynchronizable could cause suitable exceptions for monitor instructions on objects in marked classes.  More radically, a Interchangeable marker interface could cause JVM primitives that are sensitive to object identity to raise exceptions; the strangest result would be that the acmp instruction would have to be specified as raising an exception. @ValueSafe public interface ValueType extends java.io.Serializable,         Unsynchronizable, Interchangeable { … public class Complex implements ValueType {     // inherits Serializable, Unsynchronizable, Interchangeable, @ValueSafe     … It seems possible that Integer and the other wrapper types could be retro-fitted as value-safe types.  This is a major change, since wrapper objects would be unsynchronizable and their references interchangeable.  It is likely that code which violates value-safety for wrapper types exists but is uncommon.  It is less plausible to retro-fit String, since the prominent operation String.intern is often used with value-unsafe code. We should also reconsider the distinction between boxed and unboxed values in code.  The design presented above obscures that distinction.  As another thought experiment, we could imagine making a first class distinction in the type system between boxed and unboxed representations.  Since only primitive types are named with a lower-case initial letter, we could define that the capitalized version of a value type name always refers to the boxed representation, while the initial lower-case variant always refers to boxed.  For example: complex pi = complex.valueOf(Math.PI, 0); Complex boxPi = pi;  // convert to boxed myList.add(boxPi); complex z = myList.get(0);  // unbox Such a convention could perhaps absorb the current difference between int and Integer, double and Double. It might also allow the programmer to express a helpful distinction among array types. As said above, array types are crucial to bulk data interfaces, but are limited in the JVM.  Extending arrays beyond the present limitations is worth thinking about; for example, the Maxine JVM implementation has a hybrid object/array type.  Something like this which can also accommodate value type components seems worthwhile.  On the other hand, does it make sense for value types to contain short arrays?  And why should random-access arrays be the end of our design process, when bulk data is often sequentially accessed, and it might make sense to have heterogeneous streams of data as the natural “jumbo” data structure.  These considerations must wait for another day and another note. More Work It seems to me that a good sequence for introducing such value types would be as follows: Add the value-safety restrictions to an experimental version of javac. Code some sample applications with value types, including Complex and DecimalValue. Create an experimental JVM which internally unboxes value types but does not require new bytecodes to do so.  Ensure the feasibility of the performance model for the sample applications. Add tuple-like bytecodes (with or without generic type reification) to a major revision of the JVM, and teach the Java compiler to switch in the new bytecodes without code changes. A staggered roll-out like this would decouple language changes from bytecode changes, which is always a convenient thing. A similar investigation should be applied (concurrently) to array types.  In this case, it seems to me that the starting point is in the JVM: Add an experimental unboxing array data structure to a production JVM, perhaps along the lines of Maxine hybrids.  No bytecode or language support is required at first; everything can be done with encapsulated unsafe operations and/or method handles. Create an experimental JVM which internally unboxes value types but does not require new bytecodes to do so.  Ensure the feasibility of the performance model for the sample applications. Add tuple-like bytecodes (with or without generic type reification) to a major revision of the JVM, and teach the Java compiler to switch in the new bytecodes without code changes. That’s enough musing me for now.  Back to work!

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • What to name 2 methods with same signatures

    - by coffeeaddict
    Initially I had a method in our DL that would take in the object it's updating like so: internal void UpdateCash(Cash Cash) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set captureID = @captureID, ac_code = @acCode, captureDate = @captureDate, errmsg = @errorMessage, isDebit = @isDebit, SourceInfoID = @sourceInfoID, PayPalTransactionInfoID = @payPalTransactionInfoID, CreditCardTransactionInfoID = @CreditCardTransactionInfoID where id = @cashID"; conn.AddParam("@captureID", cash.CaptureID); conn.AddParam("@acCode", cash.ActionCode); conn.AddParam("@captureDate", cash.CaptureDate); conn.AddParam("@errorMessage", cash.ErrorMessage); conn.AddParam("@isDebit", cyberCash.IsDebit); conn.AddParam("@PayPalTransactionInfoID", cash.PayPalTransactionInfoID); conn.AddParam("@CreditCardTransactionInfoID", cash.CreditCardTransactionInfoID); conn.AddParam("@sourceInfoID", cash.SourceInfoID); conn.AddParam("@cashID", cash.Id); conn.ExecuteNonQuery(); } } My boss felt that creating an object every time just to update one or two fields is overkill. But I had a couple places in code using this. He recommended using just UpdateCash and sending in the ID for CAsh and field I want to update. Well the problem is I have 2 places in code using my original method. And those 2 places are updating 2 completely different fields in the Cash table. Before I was just able to get the existing Cash record and shove it into a Cash object, then update the properties I wanted to be updated in the DB, then send back the cash object to my method above. I need some advice on what to do here. I have 2 methods and they have the same signature. I'm not quite sure what to rename these because both are updating 2 completely different fields in the Cash table: internal void UpdateCash(int cashID, int paypalCaptureID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set CaptureID = @paypalCaptureID where id = @cashID"; conn.AddParam("@captureID", paypalCaptureID); conn.ExecuteNonQuery(); } } internal void UpdateCash(int cashID, int PayPalTransactionInfoID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set PaymentSourceID = @PayPalTransactionInfoID where id = @cashID"; conn.AddParam("@PayPalTransactionInfoID", PayPalTransactionInfoID); conn.ExecuteNonQuery(); } } So I thought hmm, maybe change the names to these so that they are now unique and somewhat explain what field its updating: UpdateCashOrderID UpdateCashTransactionInfoID ok but that's not really very good names. And I can't go too generic, for example: UpdateCashTransaction(int cashID, paypalTransactionID) What if we have different types of transactionIDs that the cash record holds besides just the paypalTransactionInfoID? such as the creditCardInfoID? Then what? Transaction doesn't tell me what kind. And furthermore what if you're updating 2 fields so you have 2 params next to the cashID param: UpdateCashTransaction(int cashID, paypalTransactionID, someOtherFieldIWantToUpdate) see my frustration? what's the best way to handle this is my boss doesn't like my first route?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to unit test private methods in BDD / TDD?

    - by robert_d
    I am trying to program according to Behavior Driven Development, which states that no line of code should be written without writing failing unit test first. My question is, how to use BDD with private methods? How can I unit test private methods? Is there better solution than: - making private methods public first and then making them private when I write public method that uses those private methods; or - in C# making all private methods internal and using InternalsVisibleTo attribute. Robert

    Read the article

< Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >