Search Results

Search found 13488 results on 540 pages for 'calculator date calculation'.

Page 403/540 | < Previous Page | 399 400 401 402 403 404 405 406 407 408 409 410  | Next Page >

  • How to match this with a regex?

    - by andrei miko
    I just wanna use a regex to match something from my products file. I have them in this way "Something here","a link here","website here","date here(eg. 11/12/2012)","description1 here","**description2 here**","some other text here","here also", and so on ... I wanna match with a regex only description 2. I tried this: (?<=[0-9][0-9][0-9][0-9]).*(?=",") but it wasn't good because it was getting me description1, description2 and some quotes also. Thanks in advance.

    Read the article

  • Using new Image().src for click tracking

    - by razass
    I am attempting to figure out why this click tracker isn't working. The code was written by another developer so I am not entirely sure if this ever did work. function trackSponsor(o, p) { (new Image()).src = PATH_BASE + 'click/' + p + '/' + o + "?_cache=" + (+(new Date())); return false; } From what I can gather is that when this function is called it 'creates a new image' to fire a php script asynchronously. According to Firebug, the request is made however it is 'aborted' ~30ms in. The odd thing is that it will 'sometimes' work as in 1 in every 10+ regardless of the browser. I would much rather fix this so that it works instead of re-writing it as an ajax request. Any help is appreciated. Thanks in advance.

    Read the article

  • Android strace in Real device

    - by Martin Solac
    I have the following situation, I want to monitor the system calls on Android phones so I made an script to do that. With Android Emulator works perfectly (writes the traces of the application in a specific file on my Ubuntu). The problem is when I attach a real phone to analyze it, it says the following in the result file: ptrace attach failed: Operation not permitted I'm using this code to get it, but I don't understand why it works on the emulator and not in the rooted real device. This is the comand I use in perl: system("$dirTools/adb -s $Device shell strace -p $PID[1]>$dirRecordDataSet/$Date/$appName &"); Any suggestion? Thanks in advance

    Read the article

  • What to Learn: Rails 1.2.4 -> Rails 3

    - by Saterus
    I've recently convinced my management that our outdated version of Rails is slowing us down enough to warrant an upgrade. The approach we're taking is to start a fresh project with current technology rather than a painful upgrade. Our requirements for the project have changed and this will be much easier. The biggest problem is actually that my knowledge of Rails is out of date. I've dealt only with Rails 1.2.4 while the rest of the world has moved on long ago. What topics have I missed by being buried in my work instead of keeping up with the current Rails fashion? I'm hesitant to dig through blogs at random because I'm not sure how much has changed between the intervening versions of Rails. It's no use to learn Rails 2.1-2.3 specific stuff that is no longer useful for Rails 3.

    Read the article

  • how to fetch a range of files from an FTP server using C#

    - by user260076
    hello all, i'm stuck at a point where i am using a wildcard parameter with the FtpWebRequest object as suck FtpWebRequest reqFTP = (FtpWebRequest)FtpWebRequest.Create(new Uri("ftp://" + ftpServerIP + "/" + WildCard)); now this works fine, however i now want to fetch a specific range of files. say the file naming structure is *YYYYMMDD.* and i need to fetch all the files prior to today's date. i've been searching for a wildcard pattern for that with no good results, one that will work in a simple file listing. and it doesn't look like i can use regex here. any thoughts ?

    Read the article

  • Customising Symfony Admin Generator Form

    - by Rich
    Hi, I've generated the backend of my application, and am now just 'jazzing' the forms up (adding correct labels, validation rules etc). One thing I'd like to do is add a map (Google) which updates the marker as an address is entered into the form, then allows the user to drag it to correct the lat/lng should it be a little off. My question is, how can I customise the output of the form - I've read the docs (1.0,1.1,1.2 also) and it all seems very confusing. Customising forms not generated with the admin generator I know how to do using renderRow(); etc; but finding a way to add a little bit of HTML to the forms is making my eyes hurt! There's so much out of date stuff on the web regarding Symfony it's hard to know what to trust! If anyone can point me in the right direction that'd be great. Best Regards, Rich

    Read the article

  • Converting datetime.ctime() values to Unicode

    - by Malcolm
    I would like to convert datetime.ctime() values to Unicode. Using Python 2.6.4 running under Windows I can set my locale to Spanish like below: import locale locale.setlocale(locale.LC_ALL, 'esp' ) Then I can pass %a, %A, %b, and %B to ctime() to get day and month names and abbreviations. import datetime dateValue = datetime.date( 2010, 5, 15 ) dayName = dateValue.strftime( '%A' ) dayName 's\xe1bado' How do I convert the 's\xe1bado' value to Unicode? Specifically what encoding do I use? I'm thinking I might do something like the following, but I'm not sure this is the right approach. codePage = locale.getdefaultlocale()[ 1 ] dayNameUnicode = unicode( dayName, codePage ) dayNameUnicode u's\xe1bado' Malcolm

    Read the article

  • XML file creation Using XDocument

    - by Pramodh
    i've a list (List< string) "sampleList" which contains Data1 Data2 Data3... How to create an XML file using XDocument by iterating the items in the list in c sharp. The file structure is like <file> <name="samplee"/> <date=" "/> <info> <data value="Data1"/> <data value="Data2"/> <data value="Data3"/> </info> </file please help me to do this

    Read the article

  • Group MySQL Data into Arbitrarily Sized Time Buckets

    - by Eric J.
    How do I count the number of records in a MySQL table based on a timestamp column per unit of time where the unit of time is arbitrary? Specifically, I want to count how many record's timestamps fell into 15 minute buckets during a given interval. I understand how to do this in buckets of 1 second, 1 minute, 1 hour, 1 day etc. using MySQL date functions, e.g. SELECT YEAR(datefield) Y, MONTH(datefield) M, DAY(datefield) D, COUNT(*) Cnt FROM mytable GROUP BY YEAR(datefield), MONTH(datefield), DAY(datefield) but how can I group by 15 minute buckets?

    Read the article

  • In Ruby Compare 2 lines in a log file which BOTH contain the SAME "WORD" but ONLY print out the line

    - by kamal
    here are sample lines Apr 9 11:53:26 skip [2244]: [2244] ab-cd-ef:cc [INFO] A recoverable error has occurred some other log lines .. .... Apr 9 12:53:26 skip [2244]: [2244] ab-cd-ef:cc [INFO] A recoverable error has occurred now the LATEST line would have to be one with the latest Date String, and THAT is the one that needs to be printed, plus the NEXT time the parser runs on the log file, somehow the previous LATEST line has to be compared with the Existing latest one, and it CAN e the case, that NOTHING Changed and the OLD line is STILL the latest one, OR there is a NEW line, but ONLY the NEW log line should be printed and NOT if there is NO NEW log Entry.

    Read the article

  • How do I do a join in ActiveRecord after records have been returned?

    - by Russ Bradberry
    I am using ActiveRecord in Rails 3 to pull data from two different tables in two different databases. These databases can not join on each other, but I have the need to do a simple join after-the-fact. I would like to preserve the relation so that I can chain it down the line. here is a simplified version of what I am doing browsers = Browser.all # <-- this is fairly small and can reside in memory events = Event.where(:row_date=>Date.today).select(:name, :browser_id) So as you can see, I want to join browsers in on the events relation, where browser_id should equal browsers.name. events is a relation and I can still add clauses to it down the line, so I dont want to run the query on the db just yet. How would I accomplish this?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to model dependency injection in UML ?

    - by hjo1620
    I have a Contract class. The contract is valid 1 Jan 2010 - 31 Dec 2010. It can be in state Active or Passive, depending on which date I ask the instance for it's state. ex. if I ask 4 July 2010, it's in state Active, but if I ask 1 Jan 2011, it's in state Passive. Instances are created using constructor dependency injection, i.e. they are either Active or Passive already when created, null is not allowed as a parameter for the internal state member. One initial/created vertex is drawn in UML. I have two arrows, leading out from the initial vertex, one leading to state Active and the other to state Passive. Is this a correct representation of dependency injection in UML ? This is related to http://stackoverflow.com/questions/2779922/how-model-statemachine-when-state-is-dependent-on-a-function which initiated the question on how to model DI in general, in UML.

    Read the article

  • How to query_posts after the current timestamp and sort reverse chronologically?

    - by Jody Heavener
    I am using the following code in Wordpress to query events (custom post type) and order them by date chronologically.. query_posts( array( 'post_type' => 'events', 'showposts' => 10, 'orderby' => 'meta_value_num','meta_key' => '_ecmb_datetime' ) ); Where the meta key _ecmb_datetime is, this is the timestamp of the event. I don't want to show events that have already happened, so my question is how do I only show events happening after my current time, and how do I sort reverse chronologically? Any help is greatly appreciated

    Read the article

  • Passing values from action class to model class in symfony

    - by THOmas
    I have a action class for saving some data to a database.In action class iam getting a id through url.I have to save the id in table. I am getting the id by $request-getParameter('id') I used this code for saving $this-form-bind($request-getParameter('question_answers')); if ($this-form-isValid()) { $this-form-save(); $this-redirect('@homepage'); } in model class i used a override save method to save extra field public function save(Doctrine_Connection $conn = null) { if ($this-isNew()) { $now=date('Y-m-d H:i:s', time()); $this->setPostedAt($now); } return parent::save($conn); so i want to get the id value here . So how can i pass id value from action class to model class is any-other way to save the id in action class itself Thanks in advance

    Read the article

  • Is there a method I can use across controllers and if so, how do I use it?

    - by Angela
    I have several controllers that take an instance of different classes each (Email, Call, Letter, etc) and they all have to go through this same substitution: @email.message.gsub!("{FirstName}", @contact.first_name) @email.message.gsub!("{Company}", @contact.company_name) @email.message.gsub!("{Colleagues}", @colleagues.to_sentence) @email.message.gsub!("{NextWeek}", (Date.today + 7.days).strftime("%A, %B %d")) @email.message.gsub!("{ContactTitle}", @contact.title ) So, for example, @call.message for Call, @letter.message for Letter, etcetera. This isn't very dry. I'd like to have something like def messagesub(asset) @asset.message.gsub.... end or something like that so I can just use messagesub method in each controller.

    Read the article

  • Add column from another table matching results from first MySQL query

    - by Nemi
    This is my query for available rooms in choosen period: SELECT rooms.room_id FROM rooms WHERE rooms.room_id NOT IN ( SELECT reservations.room_id FROM reservations WHERE ( reservations.arrivaldate >= $arrival_datetime AND reservations.departuredate <= $departure_datetime) OR ( reservations.arrivaldate <= $arrival_datetime AND reservations.departuredate >= $arrival_datetime ) OR ( reservations.arrivaldate <= $departure_datetime AND reservations.departuredate >= $departure_datetime ) ); How to add average room price column for selected period(from $arrival_datetime to $departure_datetime) from another table (room_prices_table), for every room_id returned from above query. So I need to look in columns whos name is same as room_id... room_prices_table: date room0001 room0002 room0003 ... Something like SELECT AVG(room0003) FROM room_prices_table WHERE datum IS BETWEEN $arrival_datetime AND $departure_datetime ??

    Read the article

  • Cannot execute cut-n-paste VBScripts

    - by IcedDante
    I have been going mad trying to figure out why my scripts weren't working, until I started copying and pasting sample source code directly from a few websites only to have it fail there as well. I am getting the following error in my VBScripts: C:\temp\vbs\script.vbs(19, 53) Microsoft VBScript compilation error: Expected statement' For a line of code that looks like this: wdoc.Application.Selection.Find.Execute Replace:=wdReplaceAll This is interfacing with Microsft Word in Office 2007 to conduct a search and replace. Index 53 point directly to the := part of the assignment. Since this type of syntax doesn't work on my machine and I am using it from several websites, I was wondering if the cscript.exe I use is out of date. Am I not calling cscript properly?

    Read the article

  • Remove year component from NSDateFormatter style

    - by JK
    I would like to present a date in the kCFDateFormatterFullStyle, but without the year. Is there any way to remove the year component from this style? My app requires localization so practically I cannot programmatically set the format string for all locales. I have come accross a solution which removes the "y" characters from the format string returned by the built in styles. Unfortunately, this is not acceptable as the year components are not represented by "y" in some other languages like Japanese. Any suggestions to get the kCFDateFormatterFullStyle without the year would be great! Thanks.

    Read the article

  • List hits per hour from a MySQL table

    - by Axel
    I am trying to work out the hits per hour from a database. Data basically is stored as follows (with other columns) : Table Name: Hits ============================ VisitorIP TIMESTAMP ---------------------------- 15.215.65.65 123456789 I want to display total hits per hour (within the last 6 hours ) including the hours that has no hits. Example of the output: // Assuming now : 21:00 21:00 - 0 hits 20:00 - 1 hits 19:00 - 4 hits 18:00 - 0 hits 17:00 - 2 hits 16:00 - 3 hits i would love to get the data as array, Please note that the stored date is in UNIX time stamp format. and there may be some hours without any hits! Thanks

    Read the article

  • git, how to I go back to origin master after pulling a branch

    - by fishtoprecords
    This has to be a FAQ, but I can't find it googling. Another person created a branch, commit'd to it, and pushed it to github using git push origin newbranch I successfully pulled it down using git pull origin newbranch Now, I want to go back to the origin master version. Nothing I do seems to cause the files in the origin master to replace those in the newbranch. git checkout master git checkout origin master git pull git pull origin HEAD etc git pull origin master returns: * branch master -> FETCH_HEAD Already up-to-date. This can't be hard, but I sure can't figure it out. 'git branch' returns * master and 'git branch -r' return origin/HEAD origin/experimental origin/master

    Read the article

  • Storing day and month (without year)

    - by Sasha
    I'm having trouble with figuring out the best way to store some data in my database. I've got to store DD/MM dates in a database, but I'm not sure of the best way to store this so that it can be easily sorted and searched. Basically a user will be able to save important dates in the format DD/MM, which they will be reminded of closer to the day. The DATE data type doesn't seem completely appropriate as it includes year, but I can't think of another way of storing this data. It would be possible to include a specific year to the end of all occasions, but this almost doesn't seem right.

    Read the article

  • a query is inserted from PHPMYAdmin but not from PHP

    - by iyad al aqel
    i'm writing a php code to insert form values in a forum values $dbServer = mysql_connect("localhost" , "root", "") ; if(!$dbServer) die ("Unable to connect"); mysql_select_db("kfumWonder"); $name= $_POST['name'] ; $password= md5($_POST['password']); $email= $_POST['email'] ; $major= $_POST['major'] ; $dateOfBirth=$_POST['dateOfBirth'] ; $webSite = $_POST['website']; $joinDate= date("Y m d") ; $query = "INSERT INTO user (name, password, email, major, dob, website, join_date) Values ('$name', '$password', '$email', '$major', '$dateOfBirth', '$webSite' , '$joinDate')" ; //echo $query ; $result = mysql_query($query) ; if (! $result ) echo " no results " ; this works perfectly fine when i took the printed query and run it in PHPMyAdmin but when i run this code nothing happens , any ideas !?

    Read the article

  • How do I use dependencies in a makefile without calling a target?

    - by rassie
    I'm using makefiles to convert an internal file format to an XML file which is sent to other colleagues. They would make changes to the XML file and send it back to us (Don't ask, this needs to be this way ;)). I'd like to use my makefile to update the internal files when this XML changes. So I have these rules: %.internal: $(DATAFILES) # Read changes from XML if any # Create internal representation here %.xml: %.internal # Convert to XML here Now the XML could change because of the workflow described above. But since no data files have changed, make would tell me that file.internal is up-to-date. I would like to avoid making %.internal target phony and a circular dependency on %.xml obviously doesn't work. Any other way I could force make to check for changes in the XML file and re-build %.internal?

    Read the article

  • Suggest resources for learning Scheme.

    - by EmFi
    I'll be starting a new job soon where Scheme is heavily used. I currently do not know Scheme, but my employer assures me that is not a problem. Regardless I'd like to hit the ground running and have a working knowledge of the language before my start date. So I'm looking for good resources from which to learn Scheme. I have had minimal exposure to functional languages. Really only a small chunk of a course devoted to Haskell. But I have a strong background in procedural and OO and procedural languages. Before it gets requested by a commenter, I am competent with the following languages: C, C++, C#, Java, Perl, Python, and Ruby.

    Read the article

< Previous Page | 399 400 401 402 403 404 405 406 407 408 409 410  | Next Page >