Search Results

Search found 15187 results on 608 pages for 'boost python'.

Page 405/608 | < Previous Page | 401 402 403 404 405 406 407 408 409 410 411 412  | Next Page >

  • Moving a turtle to the center of a circle.

    - by Maggie
    I've just started using the turtle graphics program, but I can't figure out how to move the turtle automatically to the center of a circle (no matter where the circle is located) without it drawing any lines. I thought I could use the goto.() function but it's too specific and I need something general.

    Read the article

  • Removing the port number from URL

    - by DrewSSP
    I'm new to anything related to servers and am trying to deploy a django application. Today I bought a domain name for the app and am having trouble configuring it so that the base URL does not need the port number at the end of it. I have to type www.trackthecharts.com:8001 to see the website when I only want to use www.trackethecharts.com. I think the problem is somewhere in my nginx, gunicorn or supervisor configuration. gunicorn_config.py command = '/opt/myenv/bin/gunicorn' pythonpath = '/opt/myenv/top-chart-app/' bind = '162.243.76.202:8001' workers = 3 root@django-app:~# nginx config server { server_name 162.243.76.202; access_log off; location /static/ { alias /opt/myenv/static/; } location / { proxy_pass http://127.0.0.1:8001; proxy_set_header X-Forwarded-Host $server_name; proxy_set_header X-Real-IP $remote_addr; add_header P3P 'CP="ALL DSP COR PSAa PSDa OUR NOR ONL UNI COM NAV"'; } } supervisor config [program:top_chart_gunicorn] command=/opt/myenv/bin/gunicorn -c /opt/myenv/gunicorn_config.py djangoTopChartApp.wsgi autostart=true autorestart=true stderr_logfile=/var/log/supervisor_gunicorn.err.log stdout_logfile=/var/log/supervisor_gunicorn.out.log Thanks for taking a look.

    Read the article

  • Use Regular expression with fileinput

    - by chrissygormley
    Hello, I am trying to replace a variable stored in another file using regular expression. The code I have tried is: r = re.compile(r"self\.uid\s*=\s*('\w{12})'") for line in fileinput.input(['file.py'], inplace=True): print line.replace(r.match(line), sys.argv[1]), The format of the variable in the file is: self.uid = '027FC8EBC2D1' I am trying to pass in a parameter in this format and use regular expression to verify that the sys.argv[1] is correct format and to find the variable stored in this file and replace it with the new variable. Can anyone help. Thanks for the help.

    Read the article

  • Assigning a material in Blender with a script

    - by Narcolapser
    Question: How do you assign a material with a script to an object in blender? Info: I have this script to import a proprietary model type of mine that is basically a star map with object consisting of a single vertex. in order to make them look like stars and be visible they are all going to have a halo material assigned to them. I'm figuring out how to make this material and give it the values just fine, but I can't seem to get it to assign. I tried the most obvious thing which was: objectName.setMaterial(materialName) but that did nothing. and when i would take an object that had a material and call the getMaterial function on it, it would return nothing. there is something I'm missing here, can some one shed some light on it? Thanks. ~TA

    Read the article

  • how to model a follower stream in appengine?

    - by molicule
    I am trying to design tables to buildout a follower relationship. Say I have a stream of 140char records that have user, hashtag and other text. Users follow other users, and can also follow hashtags. I am outlining the way I've designed this below, but there are two limitaions in my design. I was wondering if others had smarter ways to accomplish the same goal. The issues with this are The list of followers is copied in for each record If a new follower is added or one removed, 'all' the records have to be updated. The code class HashtagFollowers(db.Model): """ This table contains the followers for each hashtag """ hashtag = db.StringProperty() followers = db.StringListProperty() class UserFollowers(db.Model): """ This table contains the followers for each user """ username = db.StringProperty() followers = db.StringListProperty() class stream(db.Model): """ This table contains the data stream """ username = db.StringProperty() hashtag = db.StringProperty() text = db.TextProperty() def save(self): """ On each save all the followers for each hashtag and user are added into a another table with this record as the parent """ super(stream, self).save() hfs = HashtagFollowers.all().filter("hashtag =", self.hashtag).fetch(10) for hf in hfs: sh = streamHashtags(parent=self, followers=hf.followers) sh.save() ufs = UserFollowers.all().filter("username =", self.username).fetch(10) for uf in ufs: uh = streamUsers(parent=self, followers=uf.followers) uh.save() class streamHashtags(db.Model): """ The stream record is the parent of this record """ followers = db.StringListProperty() class streamUsers(db.Model): """ The stream record is the parent of this record """ followers = db.StringListProperty() Now, to get the stream of followed hastags indexes = db.GqlQuery("""SELECT __key__ from streamHashtags where followers = 'myusername'""") keys = [k,parent() for k in indexes[offset:numresults]] return db.get(keys) Is there a smarter way to do this?

    Read the article

  • Do Django Models inherit managers? (Mine seem not to)

    - by Zach
    I have 2 models: class A(Model): #Some Fields objects = ClassAManager() class B(A): #Some B-specific fields I would expect B.objects to give me access to an instance of ClassAManager, but this is not the case.... >>> A.objects <app.managers.ClassAManager object at 0x103f8f290> >>> B.objects <django.db.models.manager.Manager object at 0x103f94790> Why doesn't B inherit the objects attribute from A?

    Read the article

  • Making only one task run at a time in celerybeat

    - by Noufal Ibrahim
    I have a task which I execute once a minute using celerybeat. It works fine. Sometimes though, the task takes a few seconds more than a minute to run because of which two instances of the task run. This leads to some race conditions that mess things up. I can (and probably should) fix my task to work properly but I wanted to know if celery has any builtin ways to ensure this. My cursory Google searches and RTFMs yielded no results.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Error while exiting cherrypy server

    - by Vijayendra Bapte
    Guys, I am getting following error while exiting cherrypy server. What is this error about? 2009-11-04 09:32:35,015 WARNING Error in atexit._run_exitfuncs: 2009-11-04 09:32:35,015 WARNING 2009-11-04 09:32:35,015 WARNING Traceback (most recent call last): 2009-11-04 09:32:35,015 WARNING File "atexit.pyc", line 24, in _run_exitfuncs 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 1486, in shutdown 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 746, in flush 2009-11-04 09:32:35,015 WARNING IOError: [Errno 9] Bad file descriptor 2009-11-04 09:32:35,015 WARNING Error in sys.exitfunc: 2009-11-04 09:32:35,015 WARNING Traceback (most recent call last): 2009-11-04 09:32:35,015 WARNING File "atexit.pyc", line 24, in _run_exitfuncs 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 1486, in shutdown 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 746, in flush 2009-11-04 09:32:35,015 WARNING IOError 2009-11-04 09:32:35,015 WARNING : 2009-11-04 09:32:35,015 WARNING [Errno 9] Bad file descriptor 2009-11-04 09:32:35,015 WARNING

    Read the article

  • Unit Testing Private Method in Resource Managing Class (C++)

    - by BillyONeal
    I previously asked this question under another name but deleted it because I didn't explain it very well. Let's say I have a class which manages a file. Let's say that this class treats the file as having a specific file format, and contains methods to perform operations on this file: class Foo { std::wstring fileName_; public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it //Long method to figure out what checksum it is. //Return the checksum. } }; Let's say I'd like to be able to unit test the part of this class that calculates the checksum. Unit testing the parts of the class that load in the file and such is impractical, because to test every part of the getChecksum() method I might need to construct 40 or 50 files! Now lets say I'd like to reuse the checksum method elsewhere in the class. I extract the method so that it now looks like this: class Foo { std::wstring fileName_; static int calculateChecksum(const std::vector<unsigned char> &fileBytes) { //Long method to figure out what checksum it is. } public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it return calculateChecksum( something ); } void modifyThisFileSomehow() { //Perform modification int newChecksum = calculateChecksum( something ); //Apply the newChecksum to the file } }; Now I'd like to unit test the calculateChecksum() method because it's easy to test and complicated, and I don't care about unit testing getChecksum() because it's simple and very difficult to test. But I can't test calculateChecksum() directly because it is private. Does anyone know of a solution to this problem?

    Read the article

  • Using sqlalchemy to query using multiple column where in clause

    - by crunkchitis
    I'm looking to execute this query using sqlalchemy. SELECT name, age, favorite_color, favorite_food FROM kindergarten_classroom WHERE (favorite_color, favorite_food) IN (('lavender','lentil soup'),('black','carrot juice')); I only want kids that like (lavender AND lentil soup) OR (black and carrot juice). This is similar, but doesn't get me all of the way there: Sqlalchemy in clause

    Read the article

  • Iterating dictionary indexes in django templates

    - by unclaimedbaggage
    Hi folks...I have a dictionary with embedded objects, which looks something like this: notes = { 2009: [<Note: Test note>, <Note: Another test note>], 2010: [<Note: Third test note>, <Note: Fourth test note>], } I'm trying to access each of the note objects inside a django template, and having a helluva time navigating to them. In short, I'm not sure how to extract by index in django templating. Current template code is: <h3>Notes</h3> {% for year in notes %} {{ year }} # Works fine {% for note in notes.year %} {{ note }} # Returns blank {% endfor %} {% endfor %} If I replace {% for note in notes.year %} with {% for note in notes.2010 %} things work fine, but I need that '2010' to be dynamic. Any suggestions much appreciated.

    Read the article

  • SQLAlchemy introspection of ORM classes/objects

    - by Adam Batkin
    I am looking for a way to introspect SQLAlchemy ORM classes/entities to determine the types and other constraints (like maximum lengths) of an entity's properties. For example, if I have a declarative class: class User(Base): __tablename__ = "USER_TABLE" id = sa.Column(sa.types.Integer, primary_key=True) fullname = sa.Column(sa.types.String(100)) username = sa.Column(sa.types.String(20), nullable=False) password = sa.Column(sa.types.String(20), nullable=False) created_timestamp = sa.Column(sa.types.DateTime, nullable=False) I would want to be able to find out that the 'fullname' field should be a String with a maximum length of 100, and is nullable. And the 'created_timestamp' field is a DateTime and is not nullable.

    Read the article

  • any faster alternative??

    - by kaushik
    cost=0 for i in range(12): cost=cost+math.pow(float(float(q[i])-float(w[i])),2) cost=(math.sqrt(cost)) Any faster alternative to this? i am need to improve my entire code so trying to improve each statements performance. thanking u

    Read the article

  • any faster alternative??

    - by kaushik
    I have to read a file from a particular line number and i know the line number say "n": i have been thinking of two choice: 1)for i in range(n) fname.readline() k=readline() print k 2)i=0 for line in fname: dictionary[i]=line i=i+1 but i want to know faster alternative as i might have to perform this on different files 20000 times. is there is any other better alternatives?? thanking u

    Read the article

  • Matching First Alphanumeric Character skipping (The |An? )

    - by TheLizardKing
    I have a list of artists, albums and tracks that I want to sort using the first letter of their respective name. The issue arrives when I want to ignore "The ", "A ", "An " and other various non-alphanumeric characters (Talking to you "Weird Al" Yankovic and [dialog]). Django has a nice start '^(An?|The) +' but I want to ignore those and a few others of my choice. I am doing this in Django, using a MySQL db with utf8_bin collation. EDIT Well my fault for not mentioning this but the database I am accessing is pretty much ready only. It's created and maintained by Amarok and I can't alter it without a whole mess of issues. That being said the artist table has The Chemical Brothers listed as The Chemical Brothers so I think I am stuck here. It probably will be slow but that's not so much of a concern for me as it's a personal project.

    Read the article

  • Is there a functional way to do this?

    - by Ishpeck
    def flattenList(toFlatten): final=[] for el in toFlatten: if isinstance(el, list): final.extend(flattenList(el)) else: final.append(el) return final When I don't know how deeply the lists will nest, this is the only way I can think to do this. 2

    Read the article

  • Filtering with joined tables

    - by viraptor
    I'm trying to get some query performance improved, but the generated query does not look the way I expect it to. The results are retrieved using: query = session.query(SomeModel). options(joinedload_all('foo.bar')). options(joinedload_all('foo.baz')). options(joinedload('quux.other')) What I want to do is filter on the table joined via 'first', but this way doesn't work: query = query.filter(FooModel.address == '1.2.3.4') It results in a clause like this attached to the query: WHERE foos.address = '1.2.3.4' Which doesn't do the filtering in a proper way, since the generated joins attach tables foos_1 and foos_2. If I try that query manually but change the filtering clause to: WHERE foos_1.address = '1.2.3.4' AND foos_2.address = '1.2.3.4' It works fine. The question is of course - how can I achieve this with sqlalchemy itself?

    Read the article

  • build an API service in Django

    - by Peter
    Hi all, I want to build an API service using Django. A basic workflow goes like this: First, an http request goes to http://mycompany.com/create.py?id=001&callback=http://callback.com. It will create a folder on the server with name 001. Second, if the folder does not exist, it will be created. You get response immediately in XML format. It will look like: <?xml version="1.0" encoding="UTF-8"?> <response> <status> <statusCode>0</statusCode> <message>Success</message> </status> <group id="001"/> </response> Finally, the server will do its job (i.e. creating the folder). After it is done, the server does a callback to the URL provided. Currently, I use return render_to_response('create.xml', {'statusCode': statusCode, 'statusMessage': statusMessage, 'groupId': groupId, }, mimetype = 'text/xml') to send the XML response back. I have an XML template which has statusCode, statusMessage, groupId placeholders. <?xml version="1.0" encoding="UTF-8"?> <response> <status> <statusCode>{{ statusCode }}</statusCode> <message>{{ statusMessage }}</message> </status> {% if not statusCode %} <group id="{{ groupId }}"/> {% endif %} </response> But in this way I have to put step 3 before step 2, because otherwise step 3 will not be executed if it is after return statement. Can somebody give me some suggestions how to do this? Thanks.

    Read the article

  • MUD (game) design concept question about timed events.

    - by mudder
    I'm trying my hand at building a MUD (multiplayer interactive-fiction game) I'm in the design/conceptualizing phase and I've run into a problem that I can't come up with a solution for. I'm hoping some more experienced programmers will have some advice. Here's the problem as best I can explain it. When the player decides to perform an action he sends a command to the server. the server then processes the command, determines whether or not the action can be performed, and either does it or responds with a reason as to why it could not be done. One reason that an action might fail is that the player is busy doing something else. For instance, if a player is mid-fight and has just swung a massive broadsword, it might take 3 seconds before he can repeat this action. If the player attempts to swing again to soon, the game will respond indicating that he must wait x seconds before doing that. Now, this I can probably design without much trouble. The problem I'm having is how I can replicate this behavior from AI creatures. All of the events that are being performed by the server ON ITS OWN, aka not as an immediate reaction to something a player has done, will have to be time sensitive. Some evil monster has cast a spell on you but must wait 30 seconds before doing it again... I think I'll probably be adding all these events to some kind of event queue, but how can I make that event queue time sensitive?

    Read the article

  • google contacts api service account oauth2.0 sub user

    - by user3709507
    I am trying to use the Google Contacts API to connect to a user's contact information, on my Google apps domain. Generating an access_token using the gdata api's ContactsService clientlogin function while using the API key for my project works fine, but I would prefer to not store the user's credentials, and from the information I have found that method uses OAuth1.0 So, to use OAuth2.0 I have: Generated a Service Account in the developer's console for my project Granted access to the service account for the scope of https://www.google.com/m8/feeds/ in the Google apps domain admin panel Attempted to generate credentials using SignedJwtAssertionCredentials: credentials = SignedJwtAssertionCredentials( service_account_name=service_account_email, private_key=key_from_p12_file, scope='https://www.google.com/m8/feeds/', sub=user_email') The problem I am running into is that attempting to generate an access token using this method fails. It succeeds in generating the token when I remove the sub parameter, but then that token fails when I try to fetch the user's contacts. Does anyone know why this might be happening?

    Read the article

< Previous Page | 401 402 403 404 405 406 407 408 409 410 411 412  | Next Page >