Search Results

Search found 30071 results on 1203 pages for 'numbers table'.

Page 41/1203 | < Previous Page | 37 38 39 40 41 42 43 44 45 46 47 48  | Next Page >

  • How computer multiplies 2 numbers?

    - by ckv
    How does a computer perform a multiplication on 2 numbers say 100 * 55. My guess was that the computer did repeated addition to achieve multiplication. Of course this could be the case for integer numbers. However for floating point numbers there must be some other logic. Note: This was asked in an interview.

    Read the article

  • Can I split a single SQL 2008 DB Table into multiple filegroups, based on a discriminator column?

    - by Pure.Krome
    Hi folks, I've got a SQL Server 2008 R2 database which has a number of tables. Two of these tables contains a lot of large data .. mainly because one of them is VARBINARY(MAX) and the sister table is GEOGRAPHY. (Why two tables? Read Below if you're interested***) The data in these tables are geospatial shapes, such as zipcode boundaries. Now, the first 70K odd rows are for DataType = 1 the rest 5mil rows are for DataType = 2 Now, is it possible to split the table data into two files? so all rows that are for DataType != 2 goes into File_A and DataType = 2 goes into File_B? This way, when I backup the DB, I can skip adding File_B so my download is waaaaay smaller? Is this possible? I guessing you might be thinking - why not keep them as TWO extra tables? Mainly because in the code, the data is conceptually the same .. it's just happens that I want to split the storage of this model data. It really messes up my model if I now how two aggregates in my model, instead of one. ***Entity Framework doesn't like Tables with GEOGRAPHY, so i have to create a new table which transforms the GEOGRAPHY to VARBINARY, and then drop that into EF.

    Read the article

  • Sorting a list of numbers with modified cost

    - by David
    First, this was one of the four problems we had to solve in a project last year and I couldn’t find a suitable algorithm so we handle in a brute force solution. Problem: The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. We need to design an algorithm that given a list of numbers, determine the optimal (in terms of cost) sequence of moves to rearrange the sequence. Attempts: Part of our investigation was around NP-Completeness, we make it a decision problem and try to find a suitable transformation to any of the problems listed in Garey and Johnson’s book: Computers and Intractability with no results. There is also no direct reference (from our point of view) to this kind of variation in Donald E. Knuth’s book: The art of Computer Programing Vol. 3 Sorting and Searching. We also analyzed algorithms to sort linked lists but none of them gives a good idea to find de optimal sequence of movements. Note that the idea is not to find an algorithm that orders the sequence, but one to tell me the optimal sequence of movements in terms of cost that organizes the sequence, you can make a copy and sort it to analyze the final position of the elements if you want, in fact we may assume that the list contains the numbers from 1 to n, so we know where we want to put each number, we are just concerned with minimizing the total cost of the steps. We tested several greedy approaches but all of them failed, divide and conquer sorting algorithms can’t be used because they swap with no cost portions of the list and our dynamic programing approaches had to consider many cases. The brute force recursive algorithm takes all the possible combinations of movements from i to j and then again all the possible moments of the rest of the element’s, at the end it returns the sequence with less total cost that sorted the list, as you can imagine the cost of this algorithm is brutal and makes it impracticable for more than 8 elements. Our observations: n movements is not necessarily cheaper than n+1 movements (unlike swaps in arrays that are O(1)). There are basically two ways of moving one element from position i to j: one is to move it directly and the other is to move other elements around i in a way that it reaches the position j. At most you make n-1 movements (the untouched element reaches its position alone). If it is the optimal sequence of movements then you didn’t move the same element twice.

    Read the article

  • Comparisons of Javascript 'data grids'?

    - by Joe
    I've found plenty of questions between here and StackExchange of people asking for the 'best' data grid / data table, or one that has a particular feature, and plenty of lists out there (of various ages) listing the various data grid implementations ... but is anyone aware of any matrix of what features the various solutions implement? (eg, allow shift-click to select multiple; support checkboxes for selection; can update a regular table in-place; allow editing of cells; support websql or indexeddb for local caching; which browsers they support; infinite scroll; etc.) There's a generic 'javascript framework' comparison on wikipedia, which would be the sort of thing I'm looking for, but it doesn't go into detail on data grids. (which makes sense, as so many are extensions, not core features of those frameworks, and in the case of jQuery, there's lots of 'em.)

    Read the article

  • HTML Table: How to resize data cells when already specified "colspan"?

    - by Jenny
    I have tabular data to display, which has a meaning to both rows and columns. Columns are time blocks, rows are days. A particular datacell is confined to a single day, but can be in multiple time block. To show this, I am using the colspan tag. <div id = "GuideTable"> <table> <tr> <td colspan = 3> </td></tr></table> </div> Or Whatever. I'm trying to apply CSS formating to the entire table, and for changing colors, etc, things are fine, but wanting to have a consistent width is where I am running into problems. Right now, each data cell's width seems tied to the maximum width in its column (everything auto lines up). Some columns are itty bitty, others are huge. I'm trying to make columns consistently sized (even if that means every column is as big as the biggest column needs to be), but setting an individual datacells width (either via css or in the tag itself) is getting me nowhere. I'm thinking maybe the colspan tag is overriding my manual width? If that's the case, how can I change the width of a column as a whole, especially since they aren't explicitly defined? (CAN you explicitly define columns?) Examples of the CSS I'm using: #GuideTable td{ background:#ffffff; border-style: solid; border-width: 1px; width: 100px; }

    Read the article

  • Convert String containing several numbers into integers

    - by GobiasKoffi
    I realize that this question may have been asked several times in the past, but I am going to continue regardless. I have a program that is going to get a string of numbers from keyboard input. The numbers will always be in the form "66 33 9" Essentially, every number is separated with a space, and the user input will always contain a different amount of numbers. I'm aware that using 'sscanf' would work if the amount of numbers in every user-entered string was constant, but this is not the case for me. Also, because I'm new to C++, I'd prefer dealing with 'string' variables rather than arrays of chars.

    Read the article

  • When empty field comes, removed the row in the Grouped Table view in iPhone?

    - by Pugal Devan
    Hi friends, I have displayed the datas in grouped table view. The data's are displayed in the table view from XML parsing. I have 2 section of the table view, the section one has three rows and section two has two rows. section 1 -> 3 Rows section 2 - > 2 Rows. Now i want to check, if anyone of the string is empty then i should remove the empty cells, so i have faced some problems, if i have removed any empty cell, then it will changed the index number. So how can i check, anyone of the field is empty?, Because some times more number of empty field will come, so that the index position will be change. So please send me any sample code or link for that? How can i achieve this? Sample code, - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { if (section == 0) { if([userEmail isEqualToString:@" "] || [phoneNumber isEqualToString:@" "] || [firstName isEqualToString:@" "]) { return 2; } else { return 3; } } if (section == 1) { if(![gradYear isEqualToString:@" "] || ![graduate isEqualToString:@" "]) { return 1; } else { return 2; } return 0; } Please Help me out!!! Thanks.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Create numbers within an array that add up to a set amount

    - by RussellDias
    I'm fairly new to PHP - programming in general. So basically what I need to accomplish is, create an array of x amount of numbers (created randomly) who's value add up to n: Lets say, I have to create 4 numbers that add up to 30. I just need the first random dataset. The 4 and 30 here are variables which will be set by the user. Essentially something like x = amount of numbers; n = sum of all x's combined; create x random numbers which all add up to n; $row = array(5, 7, 10, 8) // these add up to 30 Also, no duplicates are allowed. I need the values with an array. I have been messing around with it sometime, however, my knowledge is fairly limited. Any help will be greatly appreciated. Cheers

    Read the article

  • Scaling range of values with negative numbers

    - by Pradeep Kumar
    How can I scale a set of values to fit a new range if they include negative numbers? For example, I have a set of numbers (-10, -9, 1, 4, 10) which have to scaled to a range [0 1], such that -10 maps to 0, and 10 maps to 1. The regular method for an arbitrary number 'x' would be: (x - from_min) * (to_max - to_min) / (from_max - from_min) + to_min but this does not work for negative numbers. Any help is appreciated. Thanks!!

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • Neighbour table overflow on Linux hosts related to bridging and ipv6

    - by tim
    Note: I already have a workaround for this problem (as described below) so this is only a "want-to-know" question. I have a productive setup with around 50 hosts including blades running xen 4 and equallogics providing iscsi. All xen dom0s are almost plain Debian 5. The setup includes several bridges on every dom0 to support xen bridged networking. In total there are between 5 and 12 bridges on each dom0 servicing one vlan each. None of the hosts has routing enabled. At one point in time we moved one of the machines to a new hardware including a raid controller and so we installed an upstream 3.0.22/x86_64 kernel with xen patches. All other machines run debian xen-dom0-kernel. Since then we noticed on all hosts in the setup the following errors every ~2 minutes: [55888.881994] __ratelimit: 908 callbacks suppressed [55888.882221] Neighbour table overflow. [55888.882476] Neighbour table overflow. [55888.882732] Neighbour table overflow. [55888.883050] Neighbour table overflow. [55888.883307] Neighbour table overflow. [55888.883562] Neighbour table overflow. [55888.883859] Neighbour table overflow. [55888.884118] Neighbour table overflow. [55888.884373] Neighbour table overflow. [55888.884666] Neighbour table overflow. The arp table (arp -n) never showed more than around 20 entries on every machine. We tried the obvious tweaks and raised the /proc/sys/net/ipv4/neigh/default/gc_thresh* values. FInally to 16384 entries but no effect. Not even the interval of ~2 minutes changed which lead me to the conclusion that this is totally unrelated. tcpdump showed no uncommon ipv4 traffic on any interface. The only interesting finding from tcpdump were ipv6 packets bursting in like: 14:33:13.137668 IP6 fe80::216:3eff:fe1d:9d01 > ff02::1:ff1d:9d01: HBH ICMP6, multicast listener reportmax resp delay: 0 addr: ff02::1:ff1d:9d01, length 24 14:33:13.138061 IP6 fe80::216:3eff:fe1d:a8c1 > ff02::1:ff1d:a8c1: HBH ICMP6, multicast listener reportmax resp delay: 0 addr: ff02::1:ff1d:a8c1, length 24 14:33:13.138619 IP6 fe80::216:3eff:fe1d:bf81 > ff02::1:ff1d:bf81: HBH ICMP6, multicast listener reportmax resp delay: 0 addr: ff02::1:ff1d:bf81, length 24 14:33:13.138974 IP6 fe80::216:3eff:fe1d:eb41 > ff02::1:ff1d:eb41: HBH ICMP6, multicast listener reportmax resp delay: 0 addr: ff02::1:ff1d:eb41, length 24 which placed the idea in my mind that the problem maybe related to ipv6, since we have no ipv6 services in this setup. The only other hint was the coincidence of the host upgrade with the beginning of the problems. I powered down the host in question and the errors were gone. Then I subsequently took down the bridges on the host and when i took down (ifconfig down) one particularly bridge: br-vlan2159 Link encap:Ethernet HWaddr 00:26:b9:fb:16:2c inet6 addr: fe80::226:b9ff:fefb:162c/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:120 errors:0 dropped:0 overruns:0 frame:0 TX packets:9 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:5286 (5.1 KiB) TX bytes:726 (726.0 B) eth0.2159 Link encap:Ethernet HWaddr 00:26:b9:fb:16:2c inet6 addr: fe80::226:b9ff:fefb:162c/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:1801 errors:0 dropped:0 overruns:0 frame:0 TX packets:20 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:126228 (123.2 KiB) TX bytes:1464 (1.4 KiB) bridge name bridge id STP enabled interfaces ... br-vlan2158 8000.0026b9fb162c no eth0.2158 br-vlan2159 8000.0026b9fb162c no eth0.2159 The errors went away again. As you can see the bridge holds no ipv4 address and it's only member is eth0.2159 so no traffic should cross it. Bridge and interface .2159 / .2157 / .2158 which are in all aspects identical apart from the vlan they are connected to had no effect when taken down. Now I disabled ipv6 on the entire host via sysctl net.ipv6.conf.all.disable_ipv6 and rebooted. After this even with bridge br-vlan2159 enabled no errors occur. Any ideas are welcome.

    Read the article

  • show/hide html table columns using css

    - by Art Peterson
    I want to display a basic html table with controls to toggle showing/hiding of additional columns: <table id="mytable"> <tr> <th>Column 1</th> <th class="col1">1a</th> <th class="col1">1b</th> <th>Column 2</th> <th class="col2">2a</th> <th class="col2">2b</th> </tr> <tr> <td>100</td> <td class="col1">40</td> <td class="col1">60</td> <td>200</td> <td class="col2">110</td> <td class="col2">90</td> </tr> </table> So Column 1 and Column 2 will be the only columns displayed by default - but when you click on the Column 1 I want 1a and 1b to toggle, and same with Column 2 with 2a and 2b. I may end up with more columns and lots of rows - so any javascript looping approaches have been too slow to work with when I tested. The only approach that seems to be fast enough is to set up some css like this: table.hide1 .col1 { display: none; } table.hide2 .col2 { display: none; } table.hide3 .col3 { display: none; } table.show1 .col1 { display: table-cell; } table.show2 .col2 { display: table-cell; } table.show3 .col3 { display: table-cell; } And then set up onClick function calls on the table header cells that will trigger a toggle - and determine which css class to set "mytable" to that will create the toggle effect that I'm looking for. Is there an easy way to set this up so that the code can work for n # of columns?

    Read the article

  • Writing A Transact SQL (TSQL) Procedure For SQL Server 2008 To Delete Rows From Table Safely

    In this post, we will show and explain a small TSQL Sql Server 2008 procedure that deletes all rows in a table that are older than some specified date.  That is, say the table has 10,000,000 rows in it the accumulated over the past 2 years.  Say you want to delete all but [...]...Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • SQL SERVER Force Index Scan on Table Use No Index to Retrieve the Data Query Hint

    Recently I received the following two questions from readers and both the questions have very similar answers.Question 1: I have a unique requirement where I do not want to use any index of the table; how can I achieve this?Question 2: Currently my table uses clustered index and does seek operation; how can I convert [...]...Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Modifying Contiguous Time Periods in a History Table

    Alex Kuznetsov is credited with a clever technique for creating a history table for SQL that is designed to store contiguous time periods and check that these time periods really are contiguous, using nothing but constraints. This is now increasingly useful with the DATE data type in SQL Server. The modification of data in this type of table isn't always entirely intuitive so Alex is on hand to give a brief explanation of how to do it.

    Read the article

  • BizTalk: Repeating structures with the Table Looping and Tab

    How to use the Table looping functoid in conjunction with the Table extractor functoid.  read moreBy BiZTech KnowDid you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Using jQuery to customize the styles in table cells

    - by Chris Hammond
    Originally posted on ChrisHammond.com I was trying to do some work with the Form and List module in DotNetNuke today and I needed to apply some custom styles to the LIST view of a module, without going in and creating a full XSL template for the module to use, I wanted to style the default table based grid view. In order to customize this view though I needed to do some custom jQuery that runs after the table is loaded, the jQuery then goes through and looks for columns, and based on the number of...(read more)

    Read the article

  • Comment rechercher une valeur dans une table qui contient des paliers, par Claude Leloup

    Rechercher dans une table une valeur qui ne s'y trouve pas nécessairement et choisir selon les circonstances : la valeur immédiatement supérieure (ou éventuellement égale) ou la valeur immédiatement inférieure. Access offre plusieurs voies pour atteindre ce but. Dans ce tutoriel, nous utiliserons uniquement des fonctions intégrées sans recourir à du code VBA. Nous aborderons l'utilisation des fonctions intégrées au moyen de quelques exemples pour illustrer la recherche d'une date, d'une heure, d'un texte ou d'une valeur numérique dans une table.

    Read the article

  • SQL SERVER Create Primary Key with Specific Name when Creating Table

    It is interesting how sometimes the documentation of simple concepts is not available online. I had received email from one of the reader where he has asked how to create Primary key with a specific name when creating the table itself. He said, he knows the method where he can create the table and then [...]...Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Copy Table to Another Database

    - by Derek Dieter
    There are few methods of copying a table to another database, depending on your situation. Same SQL Server Instance If trying to copy a table to a database that is on the same instance of SQL Server, The easiest solution is to use a SELECT INTO while using the fully qualifed database names.SELECT * INTO Database2.dbo.TargetTable FROM Database1.dbo.SourceTableThis will [...]

    Read the article

  • Ok to use table for calculator? [closed]

    - by max
    I'm a php/mysql guy, and have been trying to brush up on my frontend skills. So this weekend I made a four function calculator in javascript. But when I started to work on the presentation, I found myself adding extraneous markup just to achieve what a table tag naturally does. Just so we're on the same page, this is the intended layout: 789+ 456- 123x c0=/ It it possible to generate this grid using neither a table, nor extraneous markup? Thank you.

    Read the article

< Previous Page | 37 38 39 40 41 42 43 44 45 46 47 48  | Next Page >