Search Results

Search found 44058 results on 1763 pages for 'function module'.

Page 410/1763 | < Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417  | Next Page >

  • Global javascript variable not accessible in jquery change event

    - by Dan
    I have to be missing something simple, but I'm really not sure what. I'm not a JS veteran, so this may be an easy answer - sure hope so :). I have a button that, when clicked, gets JSON data. When a drop-down is changed, I check to see if there is data, if there is, I want to clear it out as the drop-down indicates what data to retrieve when the button is clicked The Code: var selected, $locDialog; var locations = []; $(function() { // Save the selected Name selected = $("#selected option:selected").val(); // Setup Dialog for Locations $locDialog = $('#location-dialog').dialog({ autoOpen: false }); // If user changes the selected // 1. Prompt for confirmation // 2. If users confirms, clear data $('#selected').change(function() { if (locations) { var confirmed = confirm("Oh Rly?"); if (confirmed) { // Clear data var locations; } } }); // When user clicks "Location" Button.. $('.loc-select button').click(function() { if (!locations) { $.getJSON("/Controller/JSONAction", { selectedId: selected, pageNum: 1, pageSize: 100 }, function(data) { locations = data; $.each(locations, function(index, loc) { var $tr = $('<tr/>') .append($('<td/>') .append('<input type="checkbox" name="TEST-'+index+'" value="'+loc.Id+'"/>')) .append('<td>' + loc.Name + '</td>'); $("#location-dialog table tbody").append($tr); }); }); } $locDialog.dialog('open'); return false; }); }); Here's the thing, Inside the .click(...) callback, I can see locations is []. Now, when I am in the .change(...) callback, I see locations is undefined. Any help/insight, as always, is appreciated!

    Read the article

  • Des decryption returns empty

    - by Nilambari
    Hi, I am using Des.php for decryption. For few texts descript function returns Correct output in readable text format. For few... it just returns blank(empty.) After debugging in Des.php, i found that function _unpad($text) is returning false. The input $text is also still encoded. What could be the reason? Whenever decrypt function calls for _unpad($text) function, i am getting empty as results. Des.php resource: here

    Read the article

  • onPageLoad is not working properly in Firefox Extension Development

    - by Tharaka Deshan
    I am new to Firefox Extension Development and doing my 1st program. Simply I needed to pop up a alert once it loaded the page. My code was like this: var myExtension = { init: function() { if(gBrowser) gBrowser.addEventListener("DOMContentLoaded", this.onPageLoad, false); }, onPageLoad: function(aEvent) { alert("Loaded"); } } window.addEventListener("load", function load(event){ window.removeEventListener("load", load, false); myExtension.init(); },false); But I am getting the alert box for couple of times. Then I found about "#document" and then I added a IF condition: onPageLoad: function(aEvent) { if (aEvent.originalTarget.nodeName == '#document') { alert("Loaded"); } } Unfortunately still I am getting the same. Please advise me on this.

    Read the article

  • how to clear the 'double right click ' on google-map-v3..

    - by zjm1126
    this is my code, and I can't remove the mousedown eventlistener : //*********** double right click ********/ var c =0 ; function time(event){ if(event.button == 2){ c++; setTimeout(cc, 600); } if (c >1){ alert('ok i get it') } } //$('#map_canvas')[0].mousedown(time); $('#map_canvas')[0].addEventListener('mousedown', time, false); //$("map_canvas").unbind() //$('map_canvas')[0].onmousedown=function(){};//this can't be clear the event $('map_canvas')[0].removeEventListener('mousedown', time, false); function cc(){ c=0; } //*********** double right click ********/

    Read the article

  • Display data requested by an ajax.load() call once complete, not during the call.

    - by niczoom
    My jQuery code (using ajax) request's data from a php script (pgiproxy.php) using the following function: function grabPage($pageURL) { $homepage = file_get_contents($pageURL); echo $homepage; } I then extract the html code i need from the returned data using jQuery and insert it into a div called #BFX, as follows: $("#btnNewLoadMethod1").click(function(){ $('#temp1').load('pgiproxy.php', { data : $("#formdata").serialize(), mode : "graph"} , function() { $('#temp').html( $('#temp1').find('center').html() ); $('#BFX').html( $('#temp').html() ); }); }); This works fine. I get the html data (which is a gif image) i need displayed on screen in the correct div. The problem is i can see the html data loading into the div (dependant on network speed), but what I want is to insert the extracted html code into #BFX ONLY when the ajax request has fully completed.

    Read the article

  • Check to see if CallResponder is processing

    - by Travesty3
    I'm using Flash Builder 4.6. As a simple example, say I have the following application: <?xml version="1.0" encoding="utf-8"?> <s:Application xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:sdk="services.sdk.*"> <fx:Script> <![CDATA[ private function btnGetValue_clickHandler():void { getValueResult.token = sdk.getValue(); } private function getValueResultHandler():void { // ... } ]]> </fx:Script> <fx:Declarations> <sdk:SDK id="sdk" fault="{Alert.show(event.fault.faultString +'\n\n'+ event.fault.faultDetail, 'SDK ERROR');}" showBusyCursor="false"/> <s:CallResponder id="getValueResult" result="getValueResultHandler()"/> </fx:Declarations> <s:Button id="btnGetValue" click="btnGetValue_clickHandler()" label="Get Value" /> </s:Application> So when you click on the button, it calls a PHP file and when it gets a result, it calls getValueResultHandler(). Easy enough. But what if the response from the PHP file takes a second or two and the user clicks the button rapidly? Then the result handler function may not get called every time, since the call responder gets a new token before it received the last response. Is there a standard way of resolving this issue? I came up with the following workaround, and it works fine, but it seems like this issue would be common enough to have a more built-in solution. My workaround is: var getValueResultProcessing:Boolean = false; private function btnGetValue_clickHandler():void { var interval:uint = setInterval(function():void { if (!getValueResultProcessing) { getValueResultProcessing = true; getValueResult.token = sdk.getValue(); clearInterval(interval); } }, 100); getValueResult.token = sdk.getValue(); } private function getValueResultHandler():void { getValueResultProcessing = false; // ... } Any better way of resolving this issue?

    Read the article

  • Trigger the change event of a textbox in jQuery

    - by Danny Chen
    I have an asp:TextBox with asp:RegularExpressionValidator to validate if it's a number. Obviously an onchange event will be attached to this textbox while rendering. Also I add a change event at $(document).ready to make some calculation when the value is changed. <asp:TextBox id="myText" runat="server" /> <asp:regularexpressionvalidator id="myRev" ControlToValidate="myText" runat="server">*</asp:regularexpressionvalidator> $(document).ready(function(){ $('[id$=myText]').bind('change',function(){ //do something }).change(); //force the change event at the very beginning }); My function will be executed later than the .net generated js because of the register time. But the .net js throws an error. I traced in the js: function ValidatorOnChange(event) { ... } and found that all of event.fromElement,event.toElement,event.srcElement are null which causes the exception. Did I do something wrong? Any solutions? Thanks.

    Read the article

  • Help using Lisp debugger

    - by Joel
    I'm trying understand how to interpret the output of, and use, the Lisp debugger. I've got a pretty simple Backtrace for the evaluation of my function, but I cann't seem to work out how to use it to find out in which Lisp 'form' in my function the exception occurred. I'd appreciate any clues as to what I should be doing, to find the source of the error. I've attached a screen shot (if it's too small to read I can re-post it in parts), with the debug output, the function and the repl (please ignore my very wrong function, I'm just interested in learning how to use the debugger properly). In addition, I hit 'v' on the first frame to go to the source, but this resulted in the error at the bottom of the screen.

    Read the article

  • Javascript storing properties and functions in variables

    - by richard
    Hello, I'm having trouble with my programming style and I hope to get some feedback here. I recently bought Javascript: The Good Parts and while I find this a big help, I'm still having trouble designing this application. Especially when it comes to writing function and methods. Example: I have a function that let's the user switches games in my app. This function updates game-specific information in the current view. var games = { active: Titanium.App.Properties.getString('active_game'), gameswitcher_positions: { 'Game 1': 0, 'Game 2': 1, 'Game 3': 2, 'Game 4': 3, 'Game 5': 4 }, change: function(game) { if (active_game !== game) { gameswitcher.children[this.gameswitcher_positions[this.active]].backgroundImage = gameswitcher.children[this.gameswitcher_positions[this.active]].backgroundImage.replace('_selected', ''); gameswitcher.children[this.gameswitcher_positions[game]].backgroundImage = gameswitcher.children[this.gameswitcher_positions[game]].backgroundImage.replace('.png', '_selected.png'); events.update(game); this.active = game; } }, init: function() { gameswitcher.children[this.gameswitcher_positions[this.active]].backgroundImage = gameswitcher.children[this.gameswitcher_positions[this.active]].backgroundImage.replace('.png', '_selected.png'); events.update(this.active); } }; gameswitcher is a container view which contains buttons to switch games. I am not satisfied with this approach but I cannot think of a better one. Should I place the gameswitcher_positions outside of the variable in a seperate variable instead of as a property? And what about the active game? Please give me feedback, what am I doing wrong?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Simple Modal Window + jQuery Cookie

    - by w00t
    I use this plugin jQuery Simple Modal Window to display a modal window. I also use jQuery Cookie Plugin (jquery.cookie.js) to set cookies. How can I mix jQuery Simple Modal Window and jQuery Cookie? It`s necessary that after clicking on the "Continue" button, the cookies were set and the modal window in the future doesnt appear to users. I'm sorry, I'm just the beginner. This is my code: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title></title> <script type="text/javascript" src="js/jquery.js"></script> <script type="text/javascript" src="js/jquery.cookie.js"></script> <script type="text/javascript"> $(document).ready(function() { //Put in the DIV id you want to display launchWindow('#alert'); //if close button is clicked $('.window .close').click(function (e) { $('#mask').hide(); $('.window').hide(); }); }); //if close button is clicked $('.window .close').click(function (e) { //Cancel the link behavior e.preventDefault(); $('#mask').hide(); $('.window').hide(); }); //if mask is clicked $('#mask').click(function () { $(this).hide(); $('.window').hide(); }); function launchWindow(id) { //Get the screen height and width var maskHeight = $(document).height(); var maskWidth = $(window).width(); //Set heigth and width to mask to fill up the whole screen $('#mask').css({'width':maskWidth,'height':maskHeight}); //transition effect $('#mask').fadeIn(1000); $('#mask').fadeTo("slow",0.95); //Get the window height and width var winH = $(window).height(); var winW = $(window).width(); //Set the popup window to center $(id).css('top', winH/2-$(id).height()/2); $(id).css('left', winW/2-$(id).width()/2); //transition effect $(id).fadeIn(2000); } </script> <script type="text/javascript"> $(function() { $('#button').click(function(e) { $.cookie('the_cookie', '1', { expires: 999 }); }); }); </script> </head> <body> <!-- Start alert block --> <div id='boxes'> <div id='alert' class='window'> some text... <input type="button" id="button" value="" class='close warn_buttons'/> </div> <!-- Mask --> <div id='mask'></div> </div> <!-- End alert block --> </body> </html>

    Read the article

  • jQuery replacement for javascript confirm

    - by dcp
    Let's say I want to prompt the user before allowing them to save a record. So let's assume I have the following button defined in the markup: <asp:Button ID="btnSave" runat="server" OnClick="btnSave_Click"></asp:Button> To force a prompt with normal javascript, I could wire the OnClick event for my save button to be something like this (I could do this in Page_Load): btnSave.Attributes.Add("onclick", "return confirm('are you sure you want to save?');"); The confirm call will block until the user actually presses on of the Yes/No buttons, which is the behavior I want. For the jquery dialog that is the equivalent, I tried something like this (see below). But the problem is that unlike javascript confirm(), it's going to get all the way through this function (displayYesNoAlert) and then proceed into my btnSave_OnClick method on the C# side. I need a way to make it "block", until the user presses the Yes or No button, and then return true or false so the btnSave_OnClick will be called or not called depending on the user's answer. Currently, I just gave up and went with javascript's confirm, I just wondered if there was a way to do it. function displayYesNoAlert(msg, closeFunction) { dialogResult = false; // create the dialog if it hasn't been instantiated if (!$("#dialog-modal").dialog('isOpen') !== true) { // add a div to the DOM that will store our message $("<div id=\"dialog-modal\" style='text-align: left;' title='Alert!'>").appendTo("body"); $("#dialog-modal").html(msg).dialog({ resizable: true, modal: true, position: [300, 200], buttons: { 'Yes': function () { dialogResult = true; $(this).dialog("close"); }, 'No': function () { dialogResult = false; $(this).dialog("close"); } }, close: function () { if (closeFunction !== undefined) { closeFunction(); } } }); } $("#dialog-modal").html(msg).dialog('open'); }

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • (Ordered) Set Partitions in fixed-size Blocks

    - by Eugen
    Here is a function I would like to write but am unable to do so. Even if you don't / can't give a solution I would be grateful for tips. For example, I know that there is a correlation between the ordered represantions of the sum of an integer and ordered set partitions but that alone does not help me in finding the solution. So here is the description of the function I need: The Task Create an efficient* function List<int[]> createOrderedPartitions(int n_1, int n_2,..., int n_k) that returns a list of arrays of all set partions of the set {0,...,n_1+n_2+...+n_k-1} in number of arguments blocks of size (in this order) n_1,n_2,...,n_k (e.g. n_1=2, n_2=1, n_3=1 -> ({0,1},{3},{2}),...). Here is a usage example: int[] partition = createOrderedPartitions(2,1,1).get(0); partition[0]; // -> 0 partition[1]; // -> 1 partition[2]; // -> 3 partition[3]; // -> 2 Note that the number of elements in the list is (n_1+n_2+...+n_n choose n_1) * (n_2+n_3+...+n_n choose n_2) * ... * (n_k choose n_k). Also, createOrderedPartitions(1,1,1) would create the permutations of {0,1,2} and thus there would be 3! = 6 elements in the list. * by efficient I mean that you should not initially create a bigger list like all partitions and then filter out results. You should do it directly. Extra Requirements If an argument is 0 treat it as if it was not there, e.g. createOrderedPartitions(2,0,1,1) should yield the same result as createOrderedPartitions(2,1,1). But at least one argument must not be 0. Of course all arguments must be = 0. Remarks The provided pseudo code is quasi Java but the language of the solution doesn't matter. In fact, as long as the solution is fairly general and can be reproduced in other languages it is ideal. Actually, even better would be a return type of List<Tuple<Set>> (e.g. when creating such a function in Python). However, then the arguments wich have a value of 0 must not be ignored. createOrderedPartitions(2,0,2) would then create [({0,1},{},{2,3}),({0,2},{},{1,3}),({0,3},{},{1,2}),({1,2},{},{0,3}),...] Background I need this function to make my mastermind-variation bot more efficient and most of all the code more "beautiful". Take a look at the filterCandidates function in my source code. There are unnecessary / duplicate queries because I'm simply using permutations instead of specifically ordered partitions. Also, I'm just interested in how to write this function. My ideas for (ugly) "solutions" Create the powerset of {0,...,n_1+...+n_k}, filter out the subsets of size n_1, n_2 etc. and create the cartesian product of the n subsets. However this won't actually work because there would be duplicates, e.g. ({1,2},{1})... First choose n_1 of x = {0,...,n_1+n_2+...+n_n-1} and put them in the first set. Then choose n_2 of x without the n_1 chosen elements beforehand and so on. You then get for example ({0,2},{},{1,3},{4}). Of course, every possible combination must be created so ({0,4},{},{1,3},{2}), too, and so on. Seems rather hard to implement but might be possible. Research I guess this goes in the direction I want however I don't see how I can utilize it for my specific scenario. http://rosettacode.org/wiki/Combinations

    Read the article

  • adding a div with data()

    - by Dizzy Bryan High
    Hi people am generating a list of flash swfs, the information comes from an ajax call which returns a json object which i loop through to create the rows of data using my makeAppRow function. makeAppRow = function(myData){ var myStr = '<div class="fileEntry">' myStr = myStr +'<div class="appDate">'+dateFormat(myData.date_swf, "dS mmmm, yyyy, h:MM TT")+'</div>' myStr = myStr +'<div class="appName">'+myData.name_swf+'</div>' myStr = myStr +'<div class="appOptions" data>' myStr = myStr +'<div class="gotoAppBtn" data-options="'+myData+'">Open App</div>' myStr = myStr +'</div>' myStr = myStr +'</div>' $('#appData').append(myStr); } I need the json data to be attached to the gotoAppBtn so that when its clicked i can read in the data from the attached json object and use it in my click function, as you can see ive been trying to embed the data using the html5 data but i cant get it to work. <div class="gotoAppBtn" data-options="'+myData+'">Open App</div> i have a function so that when the button is clicked it loads in an swf. $('.gotoAppBtn').live('click', function(){ //alert('button clicked') var myData = $(this).data("options") alert('../userfiles/'+myData.id_ugp+'/'+myData.id_swf+'/'+myData.launchfile_swf+'') console.log(myData); var flashvars = {}; var params = {}; params.menu = "false"; params.quality = "best"; params.scale = "noscale"; var attributes = {}; attributes.id = "flashAppDisplay"; attributes.name = "flashAppDisplay"; swfobject.embedSWF( '../userfiles/'+myData.id_ugp+'/'+myData.id_swf+'/'+myData.launchfile_swf+'', 'flashAppDisplay', myData.width_swf, myData.height_swf, myData.version_swf ,"../FAVideo/expressInstall.swf", flashvars, params, attributes) }); but the data does not seem to be there, any pointers on where i am going wrong, or a better way to achive this???

    Read the article

  • JSP functions - How to declare long as parameter in TLD

    - by Spines
    I'm getting an error WARNING: Method "pl" for function "pl" not found, I think its because I'm not declaring the parameters right. <function-signature>java.lang.String pl(java.lang.Long, java.lang.String)</function-signature> is what I have in the TLD. and public static String pl(long num, String str) is what I have in the .java file.

    Read the article

  • Adding some delay in an recursive loop and breaking out of it on mouseover

    - by Moak
    I have created a loop function loopThem(){ $$('#main-nav a').each(function(i, n) { i.up("#main-nav").down("li.active").removeClassName("active"); i.up("li").addClassName("active"); var target = i.readAttribute("href"); i.up(".home-top").down("li.visible").removeClassName("visible"); i.up(".home-top").down(target).addClassName("visible"); }); loopThem(); } This function is called when the dom is loaded document.observe("dom:loaded", function() { loopThem(); }); It does what I want as far as rotating through a set of banners, however it does so at light speed How Can I A add a delay between the changing? B stop the loop from continuing once I mouse over?

    Read the article

  • is it possible if callback in array_filter receive parameter ?

    - by justjoe
    i got this multiple array name $files[], who consist keys and values as below : [0] = Array ( [name] = index1.php [path] = http://localhost/php/gettingstarted/ [number] = 1 ) [1] = Array ( [name] = index10.php [path] = http://localhost/php/gettingstarted/ [number] = 2 ) [2] = Array ( [name] = index11.php [path] = http://localhost/php/gettingstarted/ [number] = 3 ) and i use this code to create new array consist of 'name' keys only. but it failed array_filter($files, "is_inarr_key('name')"); function is_inarr_key($array, $key) { //TODO : remove every array except those who got the same $key } and i got this error array_filter() [function.array-filter]: The second argument, 'is_inarr_key('name')', should be a valid callback in C:\xampp\htdocs\php\gettingstarted\index.php on line 15 so the queastion : 1. is it possible to make call-back function on array_filter has ability to receive parameter ? What is general rule of thumb on how to use callback in anyPHP built-in function ?

    Read the article

  • Content pulled in via jQuery AJAX is not associating with previous functions

    - by Jarsen
    I'm using the jquery .load() function to pull in data to populate a div with. The content I'm pulling in has CSS selectors that should match up with jQuery click functions I've written. However, when I load in the data, although the correct CSS selectors are there, when I click on areas that should invoke a response from jQuery, nothing happens. Do I need to do some sort of reload? Here's the code I've got for the jQuery AJAX: $(document).ready(function() { // AJAX functionality for drupal nodes $(".ajax_node").click(function() { var ajax_src = $(this).attr("href"); // we're gonna load the href // empty target div and load in content // the space in the string before the #id is necessary $("#ajax_area").empty().load(ajax_src + " #ajax_wrapper"); return false; // stops the link from following through }); // General AJAX fucntionality $(".ajax").click(function() { var ajax_src = $(this).attr("href"); $("#ajax_area").empty().load(ajax_src); return false; }); });

    Read the article

  • Somewhat lost with jquery + php + json

    - by Luis Armando
    I am starting to use the jquery $.ajax() but I can't get back what I want to...I send this: $(function(){ $.ajax({ url: "graph_data.php", type: "POST", data: "casi=56&nada=48&nuevo=98&perfecto=100&vales=50&apenas=70&yeah=60", dataType: "json", error: function (xhr, desc, exceptionobj) { document.writeln("El error de XMLHTTPRequest dice: " + xhr.responseText); }, success: function (json) { if (json.error) { alert(json.error); return; } var output = ""; for (p in json) { output += p + " : " + json[p] + "\n"; } document.writeln("Results: \n\n" + output); } }); }); and my php is: <?php $data = $_POST['data']; function array2json($data){ $json = $data; return json_encode($json); } ?> and when I execute this I come out with: Results: just like that I used to have in the php a echo array2json statement but it just gave back gibberish...I really don't know what am I doing wrong and I've googled for about 3 hours just getting basically the same stuff. Also I don't know how to pass parameters to the "data:" in the $.ajax function in another way like getting info from the web page, can anyone please help me? Edit I did what you suggested and it prints the data now thank you very much =) however, I was wondering, how can I send the data to the "data:" part in jQuery so it takes it from let's say user input, also I was checking the php documentation and it says I'm allowed to write something like: json_encode($a,JSON_HEX_TAG|JSON_HEX_APOS|JSON_HEX_QUOT|JSON_HEX_AMP) however, if I do that I get an error saying that json_encode accepts 1 parameter and I'm giving 2...any idea why? I'm using php 5.2

    Read the article

  • PHP fsockopen doesnt return anything

    - by Industrial
    Hi! I am modifying a PHP db wrapper for the redis database. Here's how my function looks: public function connect() { $sock = @fsockopen('localhost', '6379', $errno, $errstr, 2); if ($sock === FALSE) { return FALSE; } else { stream_set_timeout($sock, 2); return $sock; } } What I want to do is to call this function from another part in my wrapper: if ($this->connect() !== FALSE) { // Do stuff } How can I get my connect function to send a FALSE when the fsockopen isn't working? Thanks!

    Read the article

  • binding an object to the global scope

    - by elduderino
    I have the following code: var myVar = (function (window) { myobj = {}; myobj.boo = function() { alert('hi'); }; window.myVar = myobj; })(window); myVar.boo(); Why don't I get back the alert when I call myVar.boo() ? I've created an anonymous self-executing function and fed in the window object. Inside that I have another object with a method assigned to it. I then assign the global myVar variable to this obj. This should provide an alias to the my myobj object. However when I call the function I get an Cannot call method 'boo' of undefined error

    Read the article

  • jQuery Validation - Highlighting Radio Labels

    - by Michael
    I'm trying to use jQuery validation to highlight the labels for my radio buttons only, and not the labels for my other inputs. I have a label for my radio button set called 'type'. I can't seem to get it to work! $(document).ready(function(){ $("#healthForm").validate({ highlight: function(element, errorClass) { $(element).addClass(errorClass) $(element.form).find("label[for='type']") .addClass("radioerror"); }, unhighlight: function(element, errorClass) { $(element).removeClass(errorClass) $(element.form).find("label[for='type']") .removeClass("radioerror"); }, errorPlacement: function(error, element) { } }); });

    Read the article

  • Dynamically writing out li with jquery. Element is not clickable after being written

    - by estern
    I have have a a function that when a checkbox is checked i dynamically write out an li into a ol that is empty. Code: $(":checkbox").click(function() { var checkedState = $(this).is(':checked'); if (checkedState == true) { var productName = $(this).attr("title"); $("#selectedProductsList").append("<li class=\"productList " + this + "\"><p class=\"removeIcon\"><img src=\"images/remove-icon.png\" alt=\"Remove Product\" /></p><span class=\"productName\">"+ productName +"</span></li>"); }; }); Then when that writes out there is a remove icon that will remove the item from the ol when clicked. This remove icon has a class of removeIcon which can be seen in the dynamic li above. I have a function that processes the remove call and then does some actions: Code: $('.removeIcon').click(function() { alert("starting"); }); Right now i have the remove action just trying to alert a message that it got called. But it seems that it is not getting into the function. Is there a certain way that i need to access these dynamic li's other then the .click method? I saw this post: Dynamically Inserted DOM Elements are not Clickable using $.click() Where they added .live vs .click but this doesn't seem to work either. Any ideas?

    Read the article

< Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417  | Next Page >