Search Results

Search found 35363 results on 1415 pages for 'long click'.

Page 411/1415 | < Previous Page | 407 408 409 410 411 412 413 414 415 416 417 418  | Next Page >

  • jQuery AJAX chained calls + Celery in Django

    - by user1029968
    Currently clicking one of the links in my application, triggers AJAX call (GET) that - if succeeds - triggers the second one and this second one - if succeeds - calls the third one. This way user can be informed which part of process started when clicking the link is currently ongoing. So in the template file in Django project, click callback body for link mentioned looks like below: $("#the-link").click(function(item)) { // CALL 1 $.ajax({ url: {% url ajax_call_1 %}, data: { // something } }) .done(function(call1Result) { // CALL 2 $.ajax({ url: {% url ajax_call_1 %}, data: { // call1Result passed here to CALL 2 } }) .done(function(call2Result) { // CALL 3 $.ajax({ url: {%url ajax_call_3 %}, data: { // call2Result passed here to CALL 3 } }) .done(function(call3Result) { // expected result if everything went fine console.log("wow, it worked!"); console.log(call3Result); }) .fail(function(errorObject) { console.log("call3 failed"); console.log(errorObject); } }) .fail(function(errorObject)) { console.log("call2 failed"); console.log(errorObject); } }) .fail(function(errorObject) { console.log("call1 failed"); console.log(errorObject); }); }); This works fine for me. The thing is, I'd like to prevent interrupting the following calls if the user closes the browser and the calls are not finished (as it will take some time to finish all three), as there is some additional logic in Django view functions called in each GET request. For example, if user clicks the link and closes the browser during CALL 1, is it possible to somehow go on with the following CALL 2 and CALL 3? I know that normally I'd be able to use Celery Task to process the function but is it still possible here with the chained calls mentioned? Any help is much appreciated!

    Read the article

  • Export GridView to Excel (not working)

    - by Chiramisu
    I've spent the last two days trying to get some bloody data to export to Excel. After much research I determined that the best and most common way is using HttpResponse headers as shown in my code below. After stepping through countless times in debug mode, I have confirmed that the data is in fact there and both filtered and sorted the way I want it. However, it does not download as an Excel file, or do anything at all for that matter. I suspect this may have something to do with my UpdatePanel or perhaps the ImageButton not posting back properly, but I'm not sure. What am I doing wrong? Please help me to debug this issue. I will be eternally grateful. Thank you. :) Markup <asp:UpdatePanel ID="statusUpdatePanel" runat="server" UpdateMode="Conditional"> <Triggers> <asp:AsyncPostBackTrigger ControlID="btnExportXLS" EventName="Click" /> </Triggers> <ContentTemplate> <asp:GridView ID="GridView1" runat="server" AllowPaging="True" PageSize="10" AllowSorting="True" DataSourceID="GridView1SDS" DataKeyNames="ID"> </asp:GridView> <span><asp:ImageButton ID="btnExportXLS" runat="server" /></span> </ContentTemplate> </asp:UpdatePanel> Codebehind Protected Sub ExportToExcel() Handles btnExportXLS.Click Dim dt As New DataTable() Dim da As New SqlDataAdapter(SelectCommand, ConnectionString) da.Fill(dt) Dim gv As New GridView() gv.DataSource = dt gv.DataBind() Dim frm As HtmlForm = New HtmlForm() frm.Controls.Add(gv) Dim sw As New IO.StringWriter() Dim hw As New System.Web.UI.HtmlTextWriter(sw) Response.ContentType = "application/vnd.ms-excel" Response.AddHeader("content-disposition", "attachment;filename=Report.xls") Response.Charset = String.Empty gv.RenderControl(hw) Response.Write(sw.ToString()) Response.End() End Sub

    Read the article

  • Call ASP.NET 2.0 Server side code from Javascript

    - by Kannabiran
    I'm struggling with this for the past 3 days. I need to call asp.net serverside code from Javascript when the user closes the browser. I'm using the following code to accomplish this. In my asp.net form I have various validation controls. Even if there are some validation errors, When I close the form the server side code works perfectly in my development box(windows 7). But the same code doesnt work in my production environment(windows server). Does it have something to do with the Validation summary or Validation controls. The button control has Causes validation set to false. So even if there is a validation error still my form will post back. Am I correct? I suspect the form is not getting post back to the server when there is a validation error. But i'm disabling all the validation controls in the javascript before calling the button click event. Can someone throw some light on this issue. There are few blogs which suggests to use JQUERY, AJAX (Pagemethods and script manager). function ConfirmClose(e) { var evtobj = window.event ? event : e; if (evtobj == e) { //firefox if (!evtobj.clientY) { evtobj.returnValue = message; } } else { //IE if (evtobj.clientY < 0) { DisablePageValidators(); document.getElementById('<%# buttonBrowserCloseClick.ClientID %>').click(); } } } function DisablePageValidators() { if ((typeof (Page_Validators) != "undefined") && (Page_Validators != null)) { var i; for (i = 0; i < Page_Validators.length; i++) { ValidatorEnable(Page_Validators[i], false); } } } //HTML <div style="display:none" > <asp:Button ID="buttonBrowserCloseClick" runat="server" onclick="buttonBrowserCloseClick_Click" Text="Button" Width="141px" CausesValidation="False" /> //Server Code protected void buttonBrowserCloseClick_Click(object sender, EventArgs e) { //Some C# code goes here }

    Read the article

  • wsdl xml parsing , maxlength problem after encoding of text

    - by MichaelD
    We are working together with another firm. our application communicates with the other application through WCF on our side and a custom implemented java wsdl handler on the other side. They specify the wsdl format and one of the rules is that a specific string cannot contain more then 15 characters. (normally it's 60, but i take 15 for easy example reasons) When we try to send the following string to them we get an error that the string is too long according to the wsdl: "example & test" this is a string of 14 characters, so it should be allowed the microsoft wcf parser translates this to "example &amp; test" . This encoded string is 18 characters long. Now what is the standaard behavior to check a maxlength defined in a message? Is it the encoded message or the decoded message? I would think it's the decoded message , but i ain't sure. If it is the encoded message, how should we handle this so we would know how we have to split the string?

    Read the article

  • How to produce 64 bit masks?

    - by egiakoum1984
    Based on the following simple program the bitwise left shit operator works only for 32 bits. Is it true? #include <iostream> #include <stdlib.h> using namespace std; int main(void) { long long currentTrafficTypeValueDec; int input; cout << "Enter input:" << endl; cin >> input; currentTrafficTypeValueDec = 1 << (input - 1); cout << currentTrafficTypeValueDec << endl; cout << (1 << (input - 1)) << endl; return 0; } The output of the program: Enter input: 30 536870912 536870912 Enter input: 62 536870912 536870912 How could I produce 64-bit masks?

    Read the article

  • jquery pass value class

    - by mckenzie
    $(".hidee2").click(function() { var type = $(".st").val(); } <form action="" method="POST"><input type="hidden" class="st" value="st"><div class="button">Room Status : Accepting Reservation <br /><span><span><a class="hidee2">Book Now!</a></span></span></div></form> <form action="" method="POST"><input type="hidden" class="st" value="st2"><div class="button">Room Status : Accepting Reservation <br /><span><span><a class="hidee2">Book Now!</a></span></span></div></form> <form action="" method="POST"><input type="hidden" class="st" value="st3"><div class="button">Room Status : Accepting Reservation <br /><span><span><a class="hidee2">Book Now!</a></span></span></div></form> How do i get which book now! link user click? because i need to pass over the st value? is there any way to achieve this using jquery? currently, only st value is passed over

    Read the article

  • How accurately (in terms of time) does Windows play audio?

    - by MusiGenesis
    Let's say I play a stereo WAV file with 317,520,000 samples, which is theoretically 1 hour long. Assuming no interruptions of the playback, will the file finish playing in exactly one hour, or is there some occasional tiny variation in the playback speed such that it would be slightly more or slightly less (by some number of milliseconds) than one hour? I am trying to synchronize animation with audio, and I am using a System.Diagnostics.Stopwatch to keep the frames matching the audio. But if the playback speed of WAV audio in Windows can vary slightly over time, then the audio will drift out of sync with the Stopwatch-driven animation. Which leads to a second question: it appears that a Stopwatch - while highly granular and accurate for short durations - runs slightly fast. On my laptop, a Stopwatch run for exactly 24 hours (as measured by the computer's system time and a real stopwatch) shows an elapsed time of 24 hours plus about 5 seconds (not milliseconds). Is this a known problem with Stopwatch? (A related question would be "am I crazy?", but you can try it for yourself.) Given its usage as a diagnostics tool, I can see where a discrepancy like this would only show up when measuring long durations, for which most people would use something other than a Stopwatch. If I'm really lucky, then both Stopwatch and audio playback are driven by the same underlying mechanism, and thus will stay in sync with each other for days on end. Any chance this is true?

    Read the article

  • jQuery Swapping Elements

    - by zuk1
    Ok let me make an example: <head> <script type="text/javascript"> $(document).ready(function(){ $("#options_2").hide(); $("#options_3").hide(); }); </script> </head> <body> <div id="options_1">option 1</div> <div id="options_2">option 2</div> <div id="options_3">option 3</div> <a href="" class="selected">choose option 1</a> <a href="">choose option 2</a> <a href="">choose option 3</a> </body> As you can see only option 1 is visible by default, and the link you click to show option 1 has the class="selected" by default, showing the user that that option is currently selected. I basically want it so that when they click "choose option 2" the options 1 div hides itself and the options 2 div shows itself, and then gives the second link the selected class and removes the class from the image link. It basically just tabs using links and divs but due to the format I have to display it in I cannot use any of the tabs plugins I have found online.

    Read the article

  • How do I know which Object I clicked?

    - by Nick
    Here's the deal: I'm working on a personal portfolio in AS3 and I've run into a problem which I can't seem to find a logical answer to. I want everything (well, most of it) to be editable with an XML file, including my menu. My menu is just a Sprite with some text on it and a Tweener-tween, no big deal. But, I forgot to think of a way how I can determine which menu-item I have clicked. This is in my Main.as private function xmlLoaded(e:Event):void { xml = e.target.xml; menu = new Menu(xml); menu.x = 0; menu.y = stage.stageHeight / 2 - menu.height / 2; addChild(menu); } In Menu.as public function Menu(xml:XML) { for each (var eachMenuItem:XML in xml.menu.item) { menuItem = new MenuItem(eachMenuItem); menuItem.y += yPos; addChild(menuItem); yPos += menuItem.height + 3; } } and in my MenuItem.as, everything works - I have a fancy tween when I hover over it, but when I click a menu-item, I want something to appear ofcourse. How do I know which one I clicked? I've tried with pushing everything in an array, but that didn't work out well (or maybe I'm doing it wrong). Also tried a global counter, but that's not working either because the value will always be amount of items in my XML file. Also tried e.currentTarget in my click-function, but when I trace that, all of them are "Object Sprite".. I need something so I can give each a unique "name"? Thanks in advance!

    Read the article

  • How can I prevent a page to jump to top position after failed validation?

    - by Slauma
    I have a simple aspx page with a few TextBoxes and a submit button. Some fields are required and below the button is a ValidationSummary. The complete form is larger than screen height so one has to scroll down to reach the submit button. If I don't fill all required fields and click on submit validation fails as expected and the validation summary displays some info messages below the button. Validation happens on the client and no postback occurs. So this all works as wished. But disturbing is that the page moves ("jumps") to top position when I click on the submit button. To see the validation summary one has to move down the page again. I've tried to set the ShowSummary property to false (which doesn't make much sense): The validation still works (no postback) but in this case the page does not move to top position. So the problem seems to depend on rendering the validation texts. Is there a way to prevent this page jump? Thank you in advance!

    Read the article

  • Unsupported smapling rate in flex/actionscript

    - by Rajeev
    In action script i need Loading configuration file /opt/flex/frameworks/flex-config.xml t3.mxml(10): Error: unsupported sampling rate (24000Hz) [Embed(source="music.mp3")] t3.mxml(10): Error: Unable to transcode music.mp3. [Embed(source="music.mp3")] The code is <?xml version="1.0"?> <!-- embed/EmbedSound.mxml --> <mx:Application xmlns:mx="http://www.adobe.com/2006/mxml"> <mx:Script> <![CDATA[ import flash.media.*; [Embed(source="sample.mp3")] [Bindable] public var sndCls:Class; public var snd:Sound = new sndCls() as Sound; public var sndChannel:SoundChannel; public function playSound():void { sndChannel=snd.play(); } public function stopSound():void { sndChannel.stop(); } ]]> </mx:Script> <mx:HBox> <mx:Button label="play" click="playSound();"/> <mx:Button label="stop" click="stopSound();"/> </mx:HBox> </mx:Application>

    Read the article

  • JAVA Procedure Error

    - by Sam....
    java.sql.SQLException: [Microsoft][SQLServer 2000 Driver for JDBC][SQLServer]Procedure 'STP_Insert_tblReceipt' expects parameter '@CPVFlag', which was not supplied. I m getting error at This Point when trying to call procedure... Everything is perfect ,,,Count of Question marks are similar to parameter provided cs = conn.prepareCall("{call STP_Insert_tblReceipt(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?)}"); // cs = conn.prepareCall("{call STP_Receipt_Form_Insertion_Trial(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?)}"); cs.setLong(1, Long.parseLong(txtMobileNo.getText())); cs.setString(2, String.valueOf(cboDistributor.getSelectedItem())); cs.setLong(3, Long.parseLong(txtBoxNo.getText())); cs.setInt(4, Integer.parseInt(txtFileNo.getText())); cs.setString(5, pickUp_date); cs.setString(6, rec_date); cs.setString(7, String.valueOf(cmbCtrlNo.getSelectedItem())); cs.setString(8, UserName); cs.setString(9, rec_date); cs.setString(10, RegionLocation); cs.setString(11, txtRemark.getText().trim()); cs.setString(12, txtSimNo.getText().trim()); cs.setInt(13, 2); cs.setString(14, String.valueOf(cmbAryanRegion.getSelectedItem())); cs.setString(15, String.valueOf(cboPickUpType.getSelectedItem())); cs.setString(16, String.valueOf(txtCafNo.getText())); cs.setString(17, distributorId); //cs.setString(18, circleName); cs.setString(18, cboCircle.getSelectedItem().toString()); cs.registerOutParameter(19, java.sql.Types.INTEGER); cs.setString(20, auditorName); cs.setString(21, retailerName); cs.setString(22, retailerCode); cs.setInt(23, mappedFlag); //cs.setString(24, distCode); cs.setString(24, cboDistCode.getSelectedItem().toString()); //cs.setString(25, zoneName); cs.setString(25, cboZone.getSelectedItem().toString()); cs.setString(26, comment); **cs.setInt(27, 1);** **this is for CPV Flag** After this cs.execute();

    Read the article

  • MVC Html.ActionLink with post funtionality?

    - by Levitikon
    I'm checking to see if anyone has written an MVC extension for Html.ActionLink that you can pass in Post parameters like such: <% Html.ActionLink("Click me", "Index", "Home", new { MyRouteValue = "123" }, null, new { postParam1 = "a", postParam2 = "b" }); %> That would render the link like normal but having an onClick event that submits an also rendered form with an Action url for the Action, Controller, and Route Values with additional hidden inputs from the Post Parameters like such: <a href="#" onClick="$('#theform').submit(); return false;">Click me</a> <form id="theform" action="/Home/Index/123" method="post"> <input type="hidden" name="postParam1" value="a"> <input type="hidden" name="postParam2" value="b"> </form> I'm looking to redirect users to various pages with potentially a lot of data. Not only from page to page, but from email to page also. This would be highly reusable and I think would clean up a lot of code, and would save a bunch of time writing this if its already floating around out there. I hate recreating the wheel when I don't have to. Thanks!

    Read the article

  • how to determine xpaths for ajax element.

    - by Anjali
    I need to detemine xpath for element 'mainForm:queryConfigure:fetchReport'. <span id="mainForm:queryConfigure:j_id18"> <table id="mainForm:queryConfigure:j_id19" class="showReportTable" align="center"> <tbody> <tr> <td> <input id="mainForm:queryConfigure:fetchReport" type="image" src="images/show_report.gif" name="mainForm:queryConfigure:fetchReport"/> </td> </tr> </tbody> </table> </span> i tried selenium.click("//input[@id='mainForm:queryConfigure:fetchReport'][@type='image'][@src='images/show_report.gif']"); AND selenium.click("//input[@id='mainForm:queryConfigure:fetchReport']"); One more case: <div class="tabUnselectedText" align="center"> <a href="javascript:renderPage('mainForm:consoleBeanId.1','Notifications' , 'notifications.faces');">Notifications</a> </div>

    Read the article

  • Uncrackable anti-piracy protection/DRM even possible? [closed]

    - by some guy
    I hope that this is programming-related enough. You have probably heard about Ubisofts recent steps against piracy. (New DRM requires a constant connection to the Ubisoft server) Many people including me see this as intolerable because the only ones suffering from it at the end are the paying customers. Now to the actual question(s): Ubisoft justified this by calling this mechanism "Uncrackable, only playable by the paying customers". Is a so called uncrackable DRM even possible? You can reverse-engineer and modify everything, even if it takes long. Isn't Ubisoft already lying by calling something not crackable? I mean, hey - With the game you get all its content (textures, models, you know) and some anti-piracy mechanism hardcoded into it. How could that be "uncrackable"? You can just patch the unwanted mechanisms out ---- "Pirates" play the cracked game without problems and the paying customers are the idiots by having constant problems with the game and being unable to play it without a (working) internet connection. What are the points Ubisoft sees in this? If they are at least a bit intelligent and informed they know their anti-piracy protection won't last long. All they get is lower sales, angry customers and happy pirates and crackers.

    Read the article

  • How can i change a jquery plugin's option value with my value?

    - by Pandiya Chendur
    I have just jquery pagination plugin to work... But what happens is when i click page number 2 i get the first page and when i click 3 i get second page and so on.... My initial page my current page value changes to 0 instead 1 this causes the problem... My plugin has this, jQuery.fn.pagination = function(maxentries, opts){ opts = jQuery.extend({ items_per_page:10, num_display_entries:10, current_page:0, num_edge_entries:0, link_to:"#", prev_text:"Prev", next_text:"Next", ellipse_text:"...", prev_show_always:true, next_show_always:true, callback:function(){return false;} },opts||{}); current_page is set to 0 ... I have modified the current page value in my jquery function but it doesn't seem to work.... <script type="text/javascript"> var itemsPerPage = 5; var maxNumberOfElementsHere = 17; $(document).ready(function() { getRecordspage(1, itemsPerPage); $(".pager").pagination(maxNumberOfElementsHere, { callback: getRecordspage, current_page: 1, // Look here i have changed this but it doesn't work... items_per_page: itemsPerPage, num_display_entries: 5, next_text: 'Next', prev_text: 'Prev', num_edge_entries: 1 }); }); </script>

    Read the article

  • Widget host app with custom view - onClick is not triggered in the app widget.

    - by Dennis K
    I'm writing an app that will host widgets. The app has custom view (which probably is the source of issue). I obtain AppWidgetHostView like this private AppWidgetHostView widget; ... AppWidgetProviderInfo appWidgetInfo = mAppWidgetManager.getAppWidgetInfo(appWidgetId); widget = mAppWidgetHost.createView(this, appWidgetId, appWidgetInfo); widget.setAppWidget(appWidgetId, appWidgetInfo); mView.addWidget(widget, appWidgetInfo); mView.addWidget() basically just remembers this AppWidgetHostView instance and then draws it directly onto canvas. Visually everything is fine - I can see the actual widget. But the issue is with reacting on UI events. Please advise what needs to be done in the parent view in order to correctly trigger handlers in the widgets like onClick(). Notes: I used standard widgets which normally react on click events. None worked. I also created my own test widget with listener (via views.setOnClickPendingIntent(R.id.appwidget_text, pending);) and onClick() is successfully triggered if the widget is added on Homescreen, but doesn't work in my app. mView correctly detects click event and I tried to call widget.performClick() there, which returns false meaning onClickListener is not registered in the widget. But according to source mAppWidgetHost.createView() would call updateAppWidget which would register its onClick listener.. Please advise where to look at. Thanks

    Read the article

  • GSM Cell Towers Location & Triangulation Algorithm (Similar to OpenCellID / Skyhook / Google's MyLocation)

    - by ranabra
    Hi all, assuming I have a Fingerprint DB of Cell towers. The data (including Long. & Lat. CellID, signal strength, etc) is achieved by 'wardriving', similar to OpenCellID.org. I would like to be able to get the location of the client mobile phone without GPS (similar to OpenCellID / Skyhook Wireless/ Google's 'MyLocation'), which sends me info on the Cell towers it "sees" at the moment: the Cell tower connected to, and another 6 neighboring cell towers (assuming GSM). I have read and Googled it for a long time and came across several effective theories, such as using SQL 2008 Spatial capabilities, or using an euclidean algorithm, or Markov Model. However, I am lacking a practical solution, preferably in C# or using SQL 2008 :) The location calculation will be done on the server and not on the client mobile phone. the phone's single job is to send via HTTP/GPRS, the tower it's connected to and other neighboring cell towers. Any input is appreciated, I have read so much and so far haven't really advanced much. Thanx

    Read the article

  • Setting acquired location to a text view: How to maintain?

    - by Mark
    Hi, I have built an app for the Motorola Droid which should automatically update a server with the phone's location. After the user performs a particular task on the main activity screen, an alarm is set to update the user's location periodically, using a service. The alarm is explicitly stopped when the user completes another task. Thing is, I have set up a location manager within the main activity's onCreate() method which is supposed to place the first acquired lat/long into two textview fields. Even though the manifest is set up for acquiring coarse and fine coords and I'm using requestLocationUpdates (String provider, long minTime, float minDistance, LocationListener listener), with minTime and minDistance set to zero, I'm not seeing the coords coming up on the screen. With that, I'm not recording any locations on the server. When I seed the textviews with sample coords, they are being recorded fine on the server. I am not at a computer that can run the IDE, so don't currently have the code, but am desperate for some help on this. One other thing is that the main activity screen calls a photography app before the user manually clicks "send data". I'm suspicious that I may need to override the main activity's onResume() method to do this location acquisition. Please help, thanks. Mark.

    Read the article

  • How to store unlimited characters in Oracle 11g?

    - by vicky21
    We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

    Read the article

  • Problems updating a textBox ASP.NET

    - by Roger Filipe
    Hello, I'm starting in asp.net and am having some problems that I do not understand. The problem is this, I am building a site for news. Every news has a title and body. I have a page where I can insert news, this page uses a textbox for each of the fields (title and body), after clicking the submit button everything goes ok and saves the values in the database. And o have another page where I can read the news, I use labels for each of the camps, these labels are defined in the Page_Load. Now I'm having problems on the page where I can edit the news. I am loading two textboxes (title and body) in the Page_Load, so far so good, but then when I change the text and I click the submit button, it ignores the changes that I made in the text and saves the text loaded in Page_Load. This code doesn't show any database connection but you can understand what i'm talking about. protected void Page_Load(object sender, EventArgs e) { textboxTitle.Text = "This is the title of the news"; textboxBody.Text = "This is the body of the news "; } I load the page, make the changes in the text , and then click submit. protected void btnSubmit_Click(object sender, EventArgs e) { String title = textboxTitle.Text; String body = textboxBody.Text; Response.Write("Title: " + title + " || "); Response.Write("Body: " + body ); } Nothing happens, the text in the textboxes is always the one I loaded in the page_load, how do I update the Text in the textboxes?

    Read the article

  • IKImageView, Buttons work intermittently in 10.5 but ok in 10.6

    - by markhunte
    Hi all, In IB,I have connected some buttons to a IKImageView. Using its received Action 'ZoomIn:', 'ZoomOut:','ZoomImageToActualSize:' When I build for 10.6 I have no issues these work as expected. But in 10.5 (ppc), they sometimes work as expected and sometimes do not. I have even tried it programatically. But I get the same results. It is intermittent with each build after I have made some small change in IB that I need. But not changes that should affect how the view acts. The only buttons that seem to work through out are 'ZoomImageToFit' and the rotate ones. When the do not work as expected, I see no change to the current image in the view, but when my app (/s, I have had this issue before in different apps) changes the image The view reflects the last request from a button. So for example when it does not work. An image is displayed, I click the 'ZoomImageToActualSize:' button, nothing happens. I load a new image and it is displayed at Actual size. Example when it does work. An image is displayed, I click the 'ZoomImageToActualSize:' button, It is displayed at Actual size. By the way, I know I can reset the view default , before I load a new image. Also if I run the 10.5 app in 10.6, it works ok, but as above I get intermittent results with the same build on multible 10.5 machines. Does anyone know what is going on, is this a known bug? Thanks for any help. MH

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • jQuery removing elements from DOM put still reporting as present

    - by RyanP13
    Hi, I have an address finder system whereby a user enters a postcode, if postcode is validated then an address list is returned and displayed, they then select an address line, the list dissappears and then the address line is split further into some form inputs. The issue i am facing is when they have been through the above process then cleared the postcode form field, hit the find address button and the address list re-appears. Event though the list and parent tr have been removed from the DOM it is still reporting it is present as length 1? My code is as follows: jQuery // when postcode validated display box var $addressList = $("div#selectAddress > ul").length; // if address list present show the address list if ($addressList != 0) { $("div#selectAddress").closest("tr").removeClass("hide"); } // address list hidden by default // if coming back to modify details then display address inputs var $customerAddress = $("form#detailsForm input[name*='customerAddress']"); var $addressInputs = $.cookies.get('cpqbAddressInputs'); if ($addressInputs) { if ($addressInputs == 'visible') { $($customerAddress).closest("tr").removeClass("hide"); } } else { $($customerAddress).closest("tr").addClass("hide"); } // Need to change form action URL to call post code web service $("input.findAddress").live('click', function(){ var $postCode = encodeURI($("input#customerPostcode").val()); if ($postCode != "") { var $formAction = "customerAction.do?searchAddress=searchAddress&custpc=" + $postCode; $("form#detailsForm").attr("action", $formAction); } else { alert($addressList);} }); // darker highlight when li is clicked // split address string into corresponding inputs $("div#selectAddress ul li").live('click', function(){ $(this).removeClass("addressHover"); //$("li.addressClick").removeClass("addressClick"); $(this).addClass("addressClick"); var $splitAddress = $(this).text().split(","); $($customerAddress).each(function(){ var $inputCount = $(this).index("form#detailsForm input[name*='customerAddress']"); $(this).val($splitAddress[$inputCount]); }); $($customerAddress).closest("tr").removeClass("hide"); $.cookies.set('cpqbAddressInputs', 'visible'); $(this).closest("tr").fadeOut(250, function() { $(this).remove(); }); });

    Read the article

  • Multiple dispatching issue

    - by user1440263
    I try to be synthetic: I'm dispatching an event from a MovieClip (customized symbol in library) this way: public function _onMouseDown(e:MouseEvent){ var obj = {targetClips:["tondo"],functionString:"testFF"}; dispatchEvent(new BridgeEvent(BridgeEvent.BRIDGE_DATA,obj)); } The BridgeEvent class is the following: package events { import flash.events.EventDispatcher; import flash.events.Event; public class BridgeEvent extends Event { public static const BRIDGE_DATA:String = "BridgeData"; public var data:*; public function BridgeEvent(type:String, data:*) { this.data = data; super(type, true); } } } The document class listens to the event this way: addEventListener(BridgeEvent.BRIDGE_DATA,eventSwitcher); In eventSwitcher method I have a simple trace("received"). What happens: when I click the MovieClip the trace action gets duplicated and the output window writes many "received" (even if the click is only one). What happens? How do I prevent this behaviour? What is causing this? Any help is appreciated. [SOLVED] I'm sorry, you will not believe this. A colleague, to make me a joke, converted the MOUSE_DOWN handler to MOUSE_OVER.

    Read the article

< Previous Page | 407 408 409 410 411 412 413 414 415 416 417 418  | Next Page >