Search Results

Search found 19863 results on 795 pages for 'python subprocess module'.

Page 416/795 | < Previous Page | 412 413 414 415 416 417 418 419 420 421 422 423  | Next Page >

  • Does urllib2.urlopen() actually fetch the page?

    - by beagleguy
    hi all, I was condering when I use urllib2.urlopen() does it just to header reads or does it actually bring back the entire webpage? IE does the HTML page actually get fetch on the urlopen call or the read() call? handle = urllib2.urlopen(url) html = handle.read() The reason I ask is for this workflow... I have a list of urls (some of them with short url services) I only want to read the webpage if I haven't seen that url before I need to call urlopen() and use geturl() to get the final page that link goes to (after the 302 redirects) so I know if I've crawled it yet or not. I don't want to incur the overhead of having to grab the html if I've already parsed that page. thanks!

    Read the article

  • some register.inclusion_tag error in my code using django

    - by zjm1126
    my helloworld_tags: from django import template register = template.Library() def show_profile(): return {"eee": '333'} register.inclusion_tag("b.html")(show_profile) my view: def b(request): return render_to_response('b.html') my html: {% load helloworld_tags%} dsad {{ eee }} but only show 'dsad' ,not show 'dsad333' why?? thanks

    Read the article

  • Search for a String and replace it with a variable

    - by chrissygormley
    Hello, I am trying to use regular expression to search a document fo a UUID number and replace the end of it with a new number. The code I have so far is: read_file = open('test.txt', 'r+') write_file = open('test.txt', 'w') r = re.compile(r'(self.uid\s*=\s*5EFF837F-EFC2-4c32-A3D4\s*)(\S+)') for l in read_file: m1 = r.match(l) if m1: new=(str,m1.group(2)) new?????? This where I get stuck. The file test.txt has the below UUID stored in it: self.uid = '5EFF837F-EFC2-4c32-A3D4-D15C7F9E1F22' I want to replace the part D15C7F9E1F22. I have also tried this: r = re.compile(r'(self.uid\s*=\s*)(\S+)') for l in fp: m1 = r.match(l) new=map(int,m1.group(2).split("-") new[4]='RHUI5345JO' But I cannot seem to match the string. Thanks in advance for any help.

    Read the article

  • Creating form object for variable kind of form.

    - by Bunny Rabbit
    i want to create a form for users to submit questions in django ..so far the models i have created are class Question(models.Model): statement=models.CharField(max_length=100) class Choice(models.Model): statement=models.CharField(max_length=100) value=models.IntegerField() question=models.ForeignKey(Question) Now i want to write a Form class for creating a above form but the problem is the number of choices are variable,a user can decide how many choices a question must have .How do i do that in django?

    Read the article

  • Find next lower item in a sorted list

    - by Sebastian
    Hey guys, let's say I have a sorted list of Floats. Now I'd like to get the index of the next lower item of a given value. The usual for-loop aprroach has a complexity of O(n). Since the list is sorted there must be a way to get the index with O(log n). My O(n) approach: index=0 for i,value in enumerate(mylist): if value>compareValue: index=i-1 Is there a datatype for solving that problem in O(log n)? best regards Sebastian

    Read the article

  • cx_Oracle and output variables

    - by Tim
    I'm trying to do this again an Oracle 10 database: cursor = connection.cursor() lOutput = cursor.var(cx_Oracle.STRING) cursor.execute(""" BEGIN %(out)s := 'N'; END;""", {'out' : lOutput}) print lOutput.value but I'm getting DatabaseError: ORA-01036: illegal variable name/number Is it possible to define PL/SQL blocks in cx_Oracle this way?

    Read the article

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • SQLAlchemy Expression Language problem

    - by Torkel
    I'm trying to convert this to something sqlalchemy expression language compatible, I don't know if it's possible out of box and are hoping someone more experienced can help me along. The backend is PostgreSQL and if I can't make it as an expression I'll create a string instead. SELECT DISTINCT date_trunc('month', x.x) as date, COALESCE(b.res1, 0) AS res1, COALESCE(b.res2, 0) AS res2 FROM generate_series( date_trunc('year', now() - interval '1 years'), date_trunc('year', now() + interval '1 years'), interval '1 months' ) AS x LEFT OUTER JOIN( SELECT date_trunc('month', access_datetime) AS when, count(NULLIF(resource_id != 1, TRUE)) AS res1, count(NULLIF(resource_id != 2, TRUE)) AS res2 FROM tracking_entries GROUP BY date_trunc('month', access_datetime) ) AS b ON (date_trunc('month', x.x) = b.when) First of all I got a class TrackingEntry mapped to tracking_entries, the select statement within the outer joined can be converted to something like (pseudocode):: from sqlalchemy.sql import func, select from datetime import datetime, timedelta stmt = select([ func.date_trunc('month', TrackingEntry.resource_id).label('when'), func.count(func.nullif(TrackingEntry.resource_id != 1, True)).label('res1'), func.count(func.nullif(TrackingEntry.resource_id != 2, True)).label('res2') ], group_by=[func.date_trunc('month', TrackingEntry.access_datetime), ]) Considering the outer select statement I have no idea how to build it, my guess is something like: outer = select([ func.distinct(func.date_trunc('month', ?)).label('date'), func.coalesce(?.res1, 0).label('res1'), func.coalesce(?.res2, 0).label('res2') ], from_obj=[ func.generate_series( datetime.now(), datetime.now() + timedelta(days=365), timedelta(days=1) ).label(x) ]) Then I suppose I have to link those statements together without using foreign keys: outer.outerjoin(stmt???).??(func.date_trunc('month', ?.?), ?.when) Anyone got any suggestions or even better a solution?

    Read the article

  • Application closes on Nokia E71 when using urllib.urlopen

    - by sammr
    Hello, Im running the following code on my Nokia E71. But after the text input, the program closes abruptly. I have a GPRS connection on my phone,but i still seem to be having some problem with urllib.urlopen The code is as follows : import appuifw,urllib amountInDollars = appuifw.query(u"Enter amount in Dollars","text") data=urllib.urlopen("http://www.google.com").read() appuifw.note(u"Hey","info") Any way to fix this problem ? Thank You

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • Moving a turtle to the center of a circle.

    - by Maggie
    I've just started using the turtle graphics program, but I can't figure out how to move the turtle automatically to the center of a circle (no matter where the circle is located) without it drawing any lines. I thought I could use the goto.() function but it's too specific and I need something general.

    Read the article

  • Use Regular expression with fileinput

    - by chrissygormley
    Hello, I am trying to replace a variable stored in another file using regular expression. The code I have tried is: r = re.compile(r"self\.uid\s*=\s*('\w{12})'") for line in fileinput.input(['file.py'], inplace=True): print line.replace(r.match(line), sys.argv[1]), The format of the variable in the file is: self.uid = '027FC8EBC2D1' I am trying to pass in a parameter in this format and use regular expression to verify that the sys.argv[1] is correct format and to find the variable stored in this file and replace it with the new variable. Can anyone help. Thanks for the help.

    Read the article

  • Can you change/redirect a django form's function by passing in your own function?

    - by Derek
    I'm dealing with django-paypal and want to change the button src images. So I went the the conf.py file in the source and edited the src destination. However, I really want to leave the source alone, and I noticed that the class PayPalPaymentsForm(forms.Form): has def get_image(self): return { (True, self.SUBSCRIBE): SUBSCRIPTION_SANDBOX_IMAGE, (True, self.BUY): SANDBOX_IMAGE, (True, self.DONATE): DONATION_SANDBOX_IMAGE, (False, self.SUBSCRIBE): SUBSCRIPTION_IMAGE, (False, self.BUY): IMAGE, (False, self.DONATE): DONATION_IMAGE, }[TEST, self.button_type] which handles all the image src destinations. Since changing this def in the source is worse than changing conf, I was wondering if there was a way to pass in customized defs you make like passing in initial arguments in forms? This way no source code is changed, and I can customize the get_image def as much as I need. passing in def something like this? def get_image(self): .... .... paypal = { 'amount': 10, 'item_name': 'test1', 'item_number': 'test1_slug', # PayPal wants a unique invoice ID 'invoice': str(uuid.uuid4()), } form = PayPalPaymentsForm(initial=paypal, get_image) Thanks!

    Read the article

  • How would make this run with an if statement and one for loop?

    - by Nick Jacobs
    I'm trying to get this to run by using an if statment, a for loop, and a list. The list is part of the parameters. I am not sure how to write the if statement and have the program loop through all of the different words and set everything how it is supposed to be. newSndIdx=0; for i in range (8700, 12600+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (15700, 17600+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (18750, 22350+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (23700, 27250+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (106950, 115300+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx+=1

    Read the article

  • remove border of a gtk.button

    - by spanctus
    Hi, I want to remove the border of the gtk.button, but i Don't know how to do it. I tried with : button = gtk.Button() button.set_style("inner-border",0) but i have an error : the property doesn't exist. I tried too to create a new gtk.Style and use it for the button, but same error. Anyone has an idea ? Thanks

    Read the article

  • How to give points for each indices of list

    - by Eric Jung
    def voting_borda(rank_ballots): '''(list of list of str) -> tuple of (str, list of int) The parameter is a list of 4-element lists that represent rank ballots for a single riding. The Borda Count is determined by assigning points according to ranking. A party gets 3 points for each first-choice ranking, 2 points for each second-choice ranking and 1 point for each third-choice ranking. (No points are awarded for being ranked fourth.) For example, the rank ballot shown above would contribute 3 points to the Liberal count, 2 points to the Green count and 1 point to the CPC count. The party that receives the most points wins the seat. Return a tuple where the first element is the name of the winning party according to Borda Count and the second element is a four-element list that contains the total number of points for each party. The order of the list elements corresponds to the order of the parties in PARTY_INDICES.''' #>>> voting_borda([['GREEN','NDP', 'LIBERAL', 'CPC'], ['GREEN','CPC','LIBERAL','NDP'], ['LIBERAL','NDP', 'CPC', 'GREEN']]) #('GREEN',[4, 6, 5, 3]) list_of_party_order = [] for sublist in rank_ballots: for party in sublist[0]: if party == 'GREEN': GREEN_COUNT += 3 elif party == 'NDP': NDP_COUNT += 3 elif party == 'LIBERAL': LIBERAL_COUNT += 3 elif party == 'CPC': CPC_COUNT += 3 for party in sublist[1]: if party == 'GREEN': GREEN_COUNT += 2 elif party == 'NDP': NDP_COUNT += 2 elif party == 'LIBERAL': LIBERAL_COUNT += 2 elif party == 'CPC': CPC_COUNT += 2 for party in sublist[2]: if party == 'GREEN': GREEN_COUNT += 1 elif party == 'NDP': NDP_COUNT += 1 elif party == 'LIBERAL': LIBERAL_COUNT += 1 elif party == 'CPC': CPC_COUNT += 1 I don't know how I would give points for each indices of the list MORE SIMPLY. Can someone please help me? Without being too complicated. Thank you!

    Read the article

  • Assigning a material in Blender with a script

    - by Narcolapser
    Question: How do you assign a material with a script to an object in blender? Info: I have this script to import a proprietary model type of mine that is basically a star map with object consisting of a single vertex. in order to make them look like stars and be visible they are all going to have a halo material assigned to them. I'm figuring out how to make this material and give it the values just fine, but I can't seem to get it to assign. I tried the most obvious thing which was: objectName.setMaterial(materialName) but that did nothing. and when i would take an object that had a material and call the getMaterial function on it, it would return nothing. there is something I'm missing here, can some one shed some light on it? Thanks. ~TA

    Read the article

  • how to model a follower stream in appengine?

    - by molicule
    I am trying to design tables to buildout a follower relationship. Say I have a stream of 140char records that have user, hashtag and other text. Users follow other users, and can also follow hashtags. I am outlining the way I've designed this below, but there are two limitaions in my design. I was wondering if others had smarter ways to accomplish the same goal. The issues with this are The list of followers is copied in for each record If a new follower is added or one removed, 'all' the records have to be updated. The code class HashtagFollowers(db.Model): """ This table contains the followers for each hashtag """ hashtag = db.StringProperty() followers = db.StringListProperty() class UserFollowers(db.Model): """ This table contains the followers for each user """ username = db.StringProperty() followers = db.StringListProperty() class stream(db.Model): """ This table contains the data stream """ username = db.StringProperty() hashtag = db.StringProperty() text = db.TextProperty() def save(self): """ On each save all the followers for each hashtag and user are added into a another table with this record as the parent """ super(stream, self).save() hfs = HashtagFollowers.all().filter("hashtag =", self.hashtag).fetch(10) for hf in hfs: sh = streamHashtags(parent=self, followers=hf.followers) sh.save() ufs = UserFollowers.all().filter("username =", self.username).fetch(10) for uf in ufs: uh = streamUsers(parent=self, followers=uf.followers) uh.save() class streamHashtags(db.Model): """ The stream record is the parent of this record """ followers = db.StringListProperty() class streamUsers(db.Model): """ The stream record is the parent of this record """ followers = db.StringListProperty() Now, to get the stream of followed hastags indexes = db.GqlQuery("""SELECT __key__ from streamHashtags where followers = 'myusername'""") keys = [k,parent() for k in indexes[offset:numresults]] return db.get(keys) Is there a smarter way to do this?

    Read the article

  • Making only one task run at a time in celerybeat

    - by Noufal Ibrahim
    I have a task which I execute once a minute using celerybeat. It works fine. Sometimes though, the task takes a few seconds more than a minute to run because of which two instances of the task run. This leads to some race conditions that mess things up. I can (and probably should) fix my task to work properly but I wanted to know if celery has any builtin ways to ensure this. My cursory Google searches and RTFMs yielded no results.

    Read the article

  • Error while exiting cherrypy server

    - by Vijayendra Bapte
    Guys, I am getting following error while exiting cherrypy server. What is this error about? 2009-11-04 09:32:35,015 WARNING Error in atexit._run_exitfuncs: 2009-11-04 09:32:35,015 WARNING 2009-11-04 09:32:35,015 WARNING Traceback (most recent call last): 2009-11-04 09:32:35,015 WARNING File "atexit.pyc", line 24, in _run_exitfuncs 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 1486, in shutdown 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 746, in flush 2009-11-04 09:32:35,015 WARNING IOError: [Errno 9] Bad file descriptor 2009-11-04 09:32:35,015 WARNING Error in sys.exitfunc: 2009-11-04 09:32:35,015 WARNING Traceback (most recent call last): 2009-11-04 09:32:35,015 WARNING File "atexit.pyc", line 24, in _run_exitfuncs 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 1486, in shutdown 2009-11-04 09:32:35,015 WARNING File "logging\__init__.pyc", line 746, in flush 2009-11-04 09:32:35,015 WARNING IOError 2009-11-04 09:32:35,015 WARNING : 2009-11-04 09:32:35,015 WARNING [Errno 9] Bad file descriptor 2009-11-04 09:32:35,015 WARNING

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Removing the port number from URL

    - by DrewSSP
    I'm new to anything related to servers and am trying to deploy a django application. Today I bought a domain name for the app and am having trouble configuring it so that the base URL does not need the port number at the end of it. I have to type www.trackthecharts.com:8001 to see the website when I only want to use www.trackethecharts.com. I think the problem is somewhere in my nginx, gunicorn or supervisor configuration. gunicorn_config.py command = '/opt/myenv/bin/gunicorn' pythonpath = '/opt/myenv/top-chart-app/' bind = '162.243.76.202:8001' workers = 3 root@django-app:~# nginx config server { server_name 162.243.76.202; access_log off; location /static/ { alias /opt/myenv/static/; } location / { proxy_pass http://127.0.0.1:8001; proxy_set_header X-Forwarded-Host $server_name; proxy_set_header X-Real-IP $remote_addr; add_header P3P 'CP="ALL DSP COR PSAa PSDa OUR NOR ONL UNI COM NAV"'; } } supervisor config [program:top_chart_gunicorn] command=/opt/myenv/bin/gunicorn -c /opt/myenv/gunicorn_config.py djangoTopChartApp.wsgi autostart=true autorestart=true stderr_logfile=/var/log/supervisor_gunicorn.err.log stdout_logfile=/var/log/supervisor_gunicorn.out.log Thanks for taking a look.

    Read the article

< Previous Page | 412 413 414 415 416 417 418 419 420 421 422 423  | Next Page >