Search Results

Search found 49465 results on 1979 pages for 'key value'.

Page 418/1979 | < Previous Page | 414 415 416 417 418 419 420 421 422 423 424 425  | Next Page >

• Hot to get custom http-header in asp.net?

  - by Sirius Lampochkin

  I have an asp.net appliction on the one server. There I've added code on server-side in Page_Load: Response.AddHeader("key", "password-key-from-hotel"); On the client side I have a form: $lt;form ... action="www.link-to-another-domaint" >   <input type="hidden" id="asd" value="fgh" > .... </form> <script type="text/javascript">   document.forms[0].submit(); </script> Then on the other domain - there is also my other application - I'm trying to get the hedaer "key" by this code: Request.Headers["key"].ToString(); But there is no such header. Is there is a desicion? Where is my mistake?

  Read the article

• SQL How to join multiplue columns with same name to one column

  - by Choi Shun Chi

  There is a super class account {User, TYPE} and subclasses saving{User, ID, balance,TYPE,interest,curency_TYPE} time{User,ID,balance,TYPE,interest,curency_TYPE,start_date,due_date,period} fore{User,ID,balance,interest,curency_TYPE} User and TYPE is the primary key of account and foreign key of three subclasses ID is primary key of three subclasses how to make a list of showing all IDs in one column?Also the same as balance and TYPE meet the problem I considered a.ID as saving, b.ID as time but it showing them separately

  Read the article

• mysql composite unique on FK's

  - by m2o

  I want to implement the following constraints in mysql: create table TypeMapping( ... constraint unique(server_id,type_id), constraint foreign key(server_id) references Server(id), constraint foreign key(type_id) references Type(id) ); This throws a 'ERROR 1062 (23000): Duplicate entry '3-4' for key 'server_id'' when I issue an insert/update that would break the constraint. Is this type of constraint even possible? If so how? Thank you.

  Read the article

• Dynamically removing records when certain columns = 0; data cleansing

  - by cdburgess

  I have a simple card table: CREATE TABLE `users_individual_cards` ( `id` int(11) NOT NULL AUTO_INCREMENT, `user_id` char(36) NOT NULL, `individual_card_id` int(11) NOT NULL, `own` int(10) unsigned NOT NULL, `want` int(10) unsigned NOT NULL, `trade` int(10) unsigned NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `user_id` (`user_id`,`individual_card_id`), KEY `user_id_2` (`user_id`), KEY `individual_card_id` (`individual_card_id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1; I have ajax to add and remove the records based on OWN, WANT, and TRADE. However, if the user removes all of the OWN, WANT, and TRADE cards, they go to zero but it will leave the record in the database. I would prefer to have the record removed. Is checking after each "update" to see if all the columns = 0 the only way to do this? Or can I set a conditional trigger with something like: //psuedo sql AFTER update IF (OWN = 0, WANT = 0, TRADE = 0) DELETE What is the best way to do this? Can you help with the syntax?

  Read the article

• NSFetchedResultsController sections localized sorted

  - by Gerd

  How could I use the NSFetchedResultsController with translated sort key and sectionKeyPath? Problem: I have ID in the property "type" in the database like typeA, typeB, typeC,... and not the value directly because it should be localized. In English typeA=Bird, typeB=Cat, typeC=Dog in German it would be Vogel, Katze, Hund. With a NSFetchedResultController with sort key and sectionKeyPath on "type" I receive the order and sections - typeA - typeB - typeC Next I translate for display and everything is fine in English: - Bird - Cat - Dog Now I switch to German and receive a wrong sort order - Vogel - Katze - Hund because it still sorts by typeA, typeB, typeC So I'm looking for a way to localize the sort for the NSFetchedResultsController. I tried the transient property approach, but this doesn't work for the sort key because the sort key need to be in the entity. I have no other idea. But I can't believe that's not possible to use NSFetchedResultsController on a derived attribute required for localization? There are related discussions like http://stackoverflow.com/questions/1384345/using-custom-sections-with-nsfetchedresultscontroller but the difference is that the custom section names and the sort key have probably the same order. Not in my case and this is the main difference. At the end I would need a sort order for the necessary NSSortDescriptor on a derived attribute, I guess. This sort order has also to serve for the sectionKeyPath. Thanks for any hint.

  Read the article

• C functions invoked as threads - Linux userland program

  - by Einar

  I'm writing a linux daemon in C which gets values from an ADC by SPI interface (ioctl). The SPI (spidev - userland) seems to be a bit unstable and freezes the daemon at random times. I need to have some better control of the calls to the functions getting the values, and I was thinking of making it as a thread which I could wait for to finish and get the return value and if it times out assume that it froze and kill it without this new thread taking down the daemon itself. Also I could do other things like resetting the ADC before restarting. Is this possible? Pseudo example of what I want to achieve: (function int get_adc_value(int adc_channel, float *value) ) pid = thread( get_adc_value(1,&value); //makes thread wait_until_finish(pid, timeout); //waits until function finishes/timesout if(timeout) kill pid, start over //if thread do not return in given time, kill it (it is frozen) else if return value sane, continue //if successful, handle return variable value and continue Thanks for any input on the matter, examples highly appreciated!

  Read the article

• PHP - While loop

  - by Karl Entwistle

  print "<ul>"; foreach ($arr as $value) { echo("<li>" . $value[storeid] . " " . ($value[dvdstock] + $value[vhsstock]) . "</li>"); } print "</ul>"; Will output •2 20 •2 10 •1 20 •1 20 •1 10 I was wondering how I would adapt this loop so it outputs the total values for each &value[storeid] •1 50 •2 30 Thanks very much :)

  Read the article

• Whats wrong with this function? .each related

  - by Ritz

  When I uncomment the alert the data is there... like: { 'Huishoudelijke hulp': 'Huishoudelijke hulp', 'Verpleging thuis': 'Verpleging thuis', 'Verzorging thuis': 'Verzorging thuis', '24 uurs zorg': '24 uurs zorg', 'Ondersteunende begeleiding': 'Ondersteunende begeleiding', } But instead of populating the key and the value it takes the whole var and start to create a key and value pair for each character. You can see this in action here: http://www.zorgzuster-zeeland.nl/site/static/calendar_test.php create a task in the calendar and then try to edit the task by clicking on it. It should populate the dropdown field properly. When i create a static var with the same values the dropdown works. static variable var zvmlist = { 'Huishoudelijke hulp': 'Huishoudelijke hulp', 'Verpleging thuis': 'Verpleging thuis', 'Verzorging thuis': 'Verzorging thuis', '24 uurs zorg': '24 uurs zorg', 'Ondersteunende begeleiding': 'Ondersteunende begeleiding', }; This is my function, anybody has a clue? $.get('get_zorgvormen.php', function(zvmlist) { //alert("Data Loaded: " + zvmlist); $.each(zvmlist, function(key, value) { var selected=''; if(key==eventdata.title){var selected='selected' } $('<option value="'+key+'" '+selected+'>'+value+'</option>').appendTo($('#calendar_edit_entry_form_title')); }); });

  Read the article

• Rewrite SQL Fulltext Function to return Table only

  - by Alex

  I have a MS SQL Fulltext Function like this: (...) RETURNS TABLE AS RETURN SELECT * FROM fishes INNER JOIN CONTAINSTABLE(fishes, *, @keywords, @limit) AS KEY_TBL ON fishes.id = KEY_TBL.[KEY] When I use this function in LINQ, it generates a special return type which includes all fields of my "fishes" table, plus Key and Rank. How could I rewrite above query, or change something in LINQ, to omit Key and Rank and just return my "fishes" results (and to have the fulltext search result objects be of type Fish, which is what I really care about, so I don't have to cast)?

  Read the article

• Mysql select - improve performance

  - by realshadow

  Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated.

  Read the article

• iOS - NSURLConnection - Connecting to server and get Nonce

  - by Satyam svv

  I'm writing iOS application. There's a server related to some real estate. I've to send the following request to server to get the Nonce. GET /ptest/login HTTP/1.1 Method: GET User-Agent: MRIS API Testing Tool/2.0 Rets-Version: RETS/1.7 Accept: */* Host: ptest.mris.com:6103 Connection: keep-alive I'm using ASI HTTP with following code to post: [self setRequest:[ASIHTTPRequest requestWithURL:[NSURL URLWithString:@"/ptest/login"]]]; [request addRequestHeader:@"User-Agent" value:@"CARETS-General/1.0"]; [request addRequestHeader:@"Rets-Version" value:@"1.7"]; [request addRequestHeader:@"Connection" value:@"keep-alive"]; [request addRequestHeader:@"Accept" value:@"*/*"]; [request addRequestHeader:@"Host" value:"ptest.mris.com:6103"]; [request setDelegate:self]; [request setDidFinishSelector:@selector(topSecretFetchComplete:)]; [request setDidFailSelector:@selector(topSecretFetchFailed:)]; [request startAsynchronous]; The response that I'm getting is Error: Unable to start HTTP connection Can some one point me how to establish successful connection?

  Read the article

• How do I join three tables with SQLalchemy and keeping all of the columns in one of the tables?

  - by jimka

  So, I have three tables: The class defenitions: engine = create_engine('sqlite://test.db', echo=False) SQLSession = sessionmaker(bind=engine) Base = declarative_base() class Channel(Base): __tablename__ = 'channel' id = Column(Integer, primary_key = True) title = Column(String) description = Column(String) link = Column(String) pubDate = Column(DateTime) class User(Base): __tablename__ = 'user' id = Column(Integer, primary_key = True) username = Column(String) password = Column(String) sessionId = Column(String) class Subscription(Base): __tablename__ = 'subscription' userId = Column(Integer, ForeignKey('user.id'), primary_key=True) channelId = Column(Integer, ForeignKey('channel.id'), primary_key=True) And the SQL commands that are executed to create them: CREATE TABLE subscription ( "userId" INTEGER NOT NULL, "channelId" INTEGER NOT NULL, PRIMARY KEY ("userId", "channelId"), FOREIGN KEY("userId") REFERENCES user (id), FOREIGN KEY("channelId") REFERENCES channel (id) ); CREATE TABLE user ( id INTEGER NOT NULL, username VARCHAR, password VARCHAR, "sessionId" VARCHAR, PRIMARY KEY (id) ); CREATE TABLE channel ( id INTEGER NOT NULL, title VARCHAR, description VARCHAR, link VARCHAR, "pubDate" TIMESTAMP, PRIMARY KEY (id) ); NOTE: I know user.username should be unique, need to fix that, and I'm not sure why SQLalchemy creates some row names with the double-quotes. And I'm trying to come up with a way to retrieve all of the channels, as well as an indication on what channels one particular user (identified by user.sessionId together with user.id) has a subscription on. For example, say we have four channels: channel1, channel2, channel3, channel4; a user: user1; who has a subscription on channel1 and channel4. The query for user1 would return something like: channel.id | channel.title | subscribed --------------------------------------- 1 channel1 True 2 channel2 False 3 channel3 False 4 channel4 True This is a best-case result, but since I have absolutely no clue as how to accomplish the subscribed column, I've been instead trying to get the particular users id in the rows where the user has a subscription and where a subscription is missing, just leave it blank. The database engine that I'm using together with SQLalchemy atm. is sqlite3 I've been scratching my head over this for two days now, I've no problem joining together all three by way of the subscription table but then all of the channels where the user does not have a subscription gets omitted. I hope I've managed to describe my problem sufficiently, thanks in advance.

  Read the article

• A scheme for expiring downloaded content?

  - by Chad Johnson

  I am going to offer a web API service that allows users to download and "rent" content for a monthly subscription fee. The API will either be open to everyone or possibly just select parties (not sure yet). Each developer must agree to a license, and they receive a developer key for their person. Each software application will have its own key as well. So then end-users will download the software which will interact with my service's API. Each user will have a key for each application as well (probably using OAuth). Content will be cached on first download and accessible offline via just the third-party application that cached the content. If a user cancels their subscription, I plan on doing the following: Deactivate the user's OAuth key for all applications. Do not allow the user's account to download new content via the API (and subsequently any software that uses the API). Now, the big question is: how do I make content expire if they cancel their subscription? If they cancel, they should not have access to content anymore. Here are ideas I've thought of (some of these are half-solutions, not yet fully fleshed out): Require that applications encrypt downloaded content using the user's OAuth key, making it available to only the application. This will prevent most users from going to the cache directory and just copying and keeping files. Update the user's key once a month, forcing content to re-cache on a monthly basic. Users could then access content for a month after they cancel their subscription. Require applications to "phone home" [to the service] periodically and check whether the user's subscription has terminated. If so, require in the API developer license that applications expire cache. If it is found that applications do not comply, their keys (and possibly keys for all developers) are permanently deactivated as a consequence. One major worry is that some applications may blatantly ignore constraints of the license. Is it generally acceptable to rely on applications abiding by the licensing constraints? Bad idea? Any other ideas? Maybe a way to make content auto-expire after x days? Something else? I'm open to out-of-the-box ideas.

  Read the article

• How to store an inventory using hashtables?

  - by Harm De Weirdt

  Hello everyone. For an assignment in collego we have to make a script in Perl that allows us to manage an inventory for an e-store. (The example given was Amazon) Users can make orders in a fully text-based environment and the inventory must be updated when an order is completed. Every item in the inventory has 3 to 4 attributes: a product code, a title, a price and for some an amount (MP3's for example do not have this attribute) Since this is my first encounter with Perl, i don't really know how to start. My main problem is how i should "implement" the inventory in the program. One of the functions of the program is searching trough the titles. Another is to make an order, where the user should give a product code. My first idea was a hashtable with the productcode as key. But if i wanted to search in the titles that could be a problem because of this: the hashkey would be something like DVD-123, the information belonging to that key could be "The Green Mask 12" (without the ") where the 12 indicates how many of this DVD are currently in stock. So i'd have to find a way to ignore the 12 in the end. Another solution was to use the title as Hashkey, but that would prove cumbersome too I think. Is there a way to make a hashtable with 2 key's, and when I give only one it returns an array with the other values? (Including the other key and the other information) That way I could use another key depending on what info I need from my inventory. We have to read the default inventory from a txt file looking like this: MP3-72|Lady Gaga - Kiss and Run (Fear of Commitment Monster)|0.99 CD-400|Kings of Leon - Only By The Night|14.50|2 MP3-401|Kings of Leon - Closer|0.85 DVD-144|Live Free or Die Hard|14.99|2 SOFT-864|Windows Vista|49.95 Any help would be appreciated very much :) PS: I am sorry for my bad grammar, English isn't my native language.

  Read the article

• mozilla browser hot keys? [closed]

  - by Roger22

  Hello, Where can i find the key combinations for some actions, in Mozilla Firefox? For example, Ctrl+L moves the cursor to the address bar. I wanna move the cursor in the Google search box, from the right-top position). Which key is associated with this? And some other key combinations? Thanks!

  Read the article

• Database Modelling - Conceptually different entities but with near identical fields

  - by Andrew Shepherd

  Suppose you have two sets of conceptual entities: MarketPriceDataSet which has multiple ForwardPriceEntries PoolPriceForecastDataSet which has multiple PoolPriceForecastEntry Both different child objects have near identical fields: ForwardPriceEntry has MarketPriceDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForwardPrice PoolPriceForecastEntry has PoolPriceForecastDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForecastPoolPrice If I modelled them as separate tables, the only difference would be the foreign key, and the name of the price field. There has been a debate as to whether the two near identical tables should be merged into one. Options I've thought of to model this is: Just keep them as two independent, separate tables Have both sets in the one table with an additional "type" field, and a parent_id equalling a foreign key to either parent table. This would sacrifice referential integrity checks. Have both sets in the one table with an additional "type" field, and create a complicated sequence of joining tables to maintain referential integrity. What do you think I should do, and why?

  Read the article

• Update JProgressBar from new Thread

  - by Dacto

  How can I update the JProgressBar.setValue(int) from another thread? My secondary goal is do it in the least amount of classes possible. Here is the code I have right now: **Part of the main class....** pp.addActionListener( new ActionListener(){ public void actionPerformed(ActionEvent event) { new Thread(new Task(sd.getValue())).start(); } }); public class Task implements Runnable{ int val; public Task(int value){ this.val = value; } @Override public void run() { for (int i=0; i<=value; i++){ //Progressively increment variable i pbar.setValue(i); //Set value pbar.repaint(); //Refresh graphics try{Thread.sleep(50);} //Sleep 50 milliseconds catch (InterruptedException err){} } } } pp is a JButton and starts the new thread when the JButton is clicked. pbar is the JProgressBar object from the Main class. How can I update its value?(progress) The code above in run() cannot see the pbar.

  Read the article

• Please help me to write the sql

  - by Lu Lu

  Hello everyone, I am a new with T-SQL. So, please help me to write the sql. I have table Price (Code column is primary column): Code Value A1 234 A2 525 A3 566 I will input a string and the sql need to return a table. Ex1: input 'A2' - return: Code Value A2 525 Ex2: input 'A1 A3' - return: Code Value A1 234 A3 566 Ex3: input 'A1 A3 A1' - return: Code Value A1 234 A3 566 Ex4: input 'A1 A4' - return: Code Value A1 234 Please help me. I am using SQL Server 2005. Tks.

  Read the article

• Kohana3 ORM save problem

  - by Bob0101

  Hi, Can anyone help me with Kohana ORM. I can take out name and value. I can give them new values and I try to save them back to base, but in phpmyadmin i can see still old values for these option attributes. What is wrong with this code (it works and echos right value but i can't see it in db): $option = ORM::factory('draft') ->where('user_id', '=', $user_id) ->find() ->draft_options ->where('name', '=', $_POST['name']) ->find(); $option->name = $_POST['name']; $option->value = $_POST['value']; $option->save(); if ($option->saved()) echo Kohana::debug($option->value);

  Read the article

• DataGridView Cell Validating only when 'Enter' is pressed

  - by Eldad

  Hi, I want to validate and commit the value entered in the DataGridViewCell ONLY when the user presses the 'Enter' key. If the users presses any other key or mouse button (Arrow keys, Pressing a different cell using the mouse...), I want the behavior to be similar to the 'ESC' key: Move the focus to the new cell and revert the edited cell value to its previous value.

  Read the article

• Matching strings

  - by Joy

  Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

  Read the article

• Disable Internet Explorer 8 Developer Tools

  - by Steve Brouillard

  Is there a way to either disable Internet Explorer 8 Developer Tools, or at least change the shortcut key mapping? I'm working on an ASP.NET AJAX app that has used the F12 key for a function for years (it's actually a hold over from the original DOS app). Customers have used this key for the sam function for nearly 15 years and we'd really like to avoid having to move that function. Cheers

  Read the article

• What software analogies have helped you?

  - by Galwegian

  I have often enjoyed the use of analogies in understanding a software scenario or problem. For example, to understand the concept of public key encryption, the 'locked mailbox' analogy or similar is often used as an aid: An analogy for public-key encryption is that of a locked mailbox with a mail slot. The mail slot is exposed and accessible to the public; its location (the street address) is in essence the public key. Anyone knowing the street address can go to the door and drop a written message through the slot; however, only the person who possesses the key can open the mailbox and read the message. My question is: What analogies have you used or heard of in your career that have given you that "Eureka" moment with a complex concept? EDIT: If you have a good one, don't just state the name, please share with the group!

  Read the article

• jquery atrr("href") is not consistent ..in sharepoint

  - by alienavatar

  Hi all I have a jquery function(This is not written by me anyway still I am learning). In that we are replacing urls using f.attr("href") in several places. I am not understanding that from where this href value will be binded. And why the value(f.attr("href")) is changing place to place. I mean to say it is having some value @ one location and if I give the same it is giving me different value at other location. I read in article that The .attr() method gets the attribute value for only the first element in the matched set..What is the matched set means

  Read the article

• dropdowllist selected item from javascript to servlet

  - by kawtousse

  Hi, I am writing to ask if anybody knows, is it possible to get the value from a JavaScript variable and use this value in a Java Servlet? I have read up on this but all i have found is getting the JavaScript value through a form submit. What I need is: I have a html select combo box. I need to extract the selected value from this and use this value to query a database. Is this possible. Thanks in advance.

  Read the article

< Previous Page | 414 415 416 417 418 419 420 421 422 423 424 425  | Next Page >