Search Results

Search found 2776 results on 112 pages for 'overlapping matches'.

Page 42/112 | < Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >

  • java filenames filter pattern

    - by Sergey
    Hello, I need to implement File[] files = getFiles( String folderName, String ptrn ); Where ptrn is a command prompt style pattern like "*2010*.txt" I'm familar with FilenameFilter class, but can't implement public boolean accept(File dir, String filename) because String.matches() doesn't accept such patterns. Thanks!

    Read the article

  • Custom dynamic error pages in Ruby on Rails not working

    - by PlanetMaster
    Hi, I'm trying to implement custom dynamic error pages following this post: http://www.perfectline.co.uk/blog/custom-dynamic-error-pages-in-ruby-on-rails I did exactly what the blog post says. I included config.action_controller.consider_all_requests_local = false in my environment.rb. But is not working. My browser shows: Routing Error No route matches "/555" with {:method=>:get} So, it looks like the rescues are not fired. I get the following in my log file: ActionController::RoutingError (No route matches "/555" with {:method=>:get}): Rendering rescues/layout (not_found) Is there some routing interfering with the code? I'm not sure what to look for. I'm running rails 2.3.5. Here is the routes.rb file: ActionController::Routing::Routes.draw do |map| # routing van property-url map.connect 'buy/:property_type_plural/:province/:city/:address/:house_number', :controller => 'properties' , :action => 'show', :id => 'whatever' map.myimmonatie 'myimmonatie' , :controller => 'myimmonatie/properties', :action => 'index' map.login "login", :controller => "user_sessions", :action => "create", :conditions => {:method => :post} map.login "login", :controller => "user_sessions", :action => "new" map.logout "logout", :controller => "user_sessions", :action => "destroy" map.buy "buy", :controller => 'buy' map.sell "sell", :controller => 'sell' map.home "home", :controller => 'home' map.disclaimer "disclaimer", :controller => 'disclaimer' map.sign_up "sign_up", :controller => 'users', :action => :new map.contact "contact", :controller => 'contact' map.resources :user_sessions map.resources :contact map.resources :password_resets map.resources :messages map.resources :users, :only => [:index,:new,:create,:activate,:edit,:profile,:password] map.resources :images map.resources :activation , :only => [:new,:resend] map.resources :email map.resources :properties, :except => [:index,:destroy] map.namespace :admin do |admin| admin.resources :users admin.resources :properties admin.resources :order_items, :as => :orders admin.resources :blog_posts, :as => :blog end map.connect 'myimmonatie/:action' , :controller => 'users', :id => 'current', :requirements => {:action => /(profile)|(password)|(email)/} map.namespace :myimmonatie do |myimmonatie| myimmonatie.resources :messages, :controller => 'messages' myimmonatie.resources :password, :as => "password", :controller => 'users', :action => 'password' myimmonatie.resources :properties , :controller => 'properties' myimmonatie.resources :orders , :only => [:index,:show,:create,:new] end map.root :controller => "home" map.connect ':controller/:action' map.connect ':controller/:action/:id' map.connect ':controller/:action/:id.:format' end ActionController::Routing::Translator.translate_from_file('config','i18n-routes.yml')

    Read the article

  • use split() for splitting a string

    - by Hamed
    Hi again... Guys I'd asked 2 questions before and I'd said that I want to split a string like below: Input string: a=aa|b=b||b|c=cc and the output: a=aa b=b||b c=cc some guys answer my question but they use .Match(): var matches = "a=aa|b=b||b|c=cc".match(/(?:[^|]|\|\|)+/g) but I need to use the .split() method and store the outputs in an array. please help me guys... It's so critical... Thanks...

    Read the article

  • Regular Expression for CSV with numbers

    - by Bernie Perez
    I'm looking for some regular expression to help parse my CSV file. The file has lines of number,number number,number Comment I want to skip number,number number,number Ex: 319,5446 564425,87 Text to skip 27,765564 I read each line into a string and I wanted to use some regular express to make sure the line matches the pattern of (number,number). If not then don't use the line.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to compare arrays in Perl?

    - by devtech
    I have two arrays A & B. I want to do a compare among the elements of the two arrays. my @a = qw"abc def efg ghy klm ghn"; my @b = qw"def ghy jgk lom com klm"; If any element matches then set a flag. Is there any simple way to do this? Please advise.

    Read the article

  • Chrome extension Page Action JS

    - by Radek Šimko
    I'm trying to create an extension using this docs: http://code.google.com/chrome/extensions/content_scripts.html I want a part of JS code to run when document is ready (loaded). This is my manifest.json: { "name": "OwnExtension", "version": "0.1", "content_scripts": [ { "matches": ["https://my.site.eu/*"], "css": ["styles.css"], "js": ["main.js"] } ] } This is my main.js: alert(10); Am I doing sth wrong, that nothing happend when page https://my.site.eu/ loaded in browser?

    Read the article

  • Using a regex to match IP addresses in Python

    - by MHibbin
    I'm trying to make a test for checking whether a sys.argv input matches the regex for an IP address... As a simple test, I have the following... import re pat = re.compile("\d{1,3}.\d{1,3}.\d{1,3}.\d{1,3}") test = pat.match(hostIP) if test: print "Acceptable ip address" else: print "Unacceptable ip address" However when I pass random values into it, it returns "Acceptable ip address" in most cases, except when I have an "address" that is basically equivalent to \d+ Any thoughts welcome. Cheers Matt

    Read the article

  • Issue with my regular expression?

    - by Rubans
    I'm trying to locate the number matches in a relative path for directory up references("..\"). So I have the following pattern : "(..\)" which works as expected for the path "....\a\b" where it will give me 2 successfull groups ("..\") but when I try the path "..\a\b" it will also return 2 when it should be 1. I tried this in a reg ex tool such Expresso and it seems to work as expected in there but not in in .net, any ideas?

    Read the article

  • Disadvantage of unlifted type products?

    - by peaker
    In Haskell, lifted type products mean that there's a semantic difference between (a,b,c) and (a, (b, c)). If all pattern matches of all products was always irrefutable, then there would be no difference, and (a, b, c) could be syntactic sugar for (a, (b, c)). Why did Haskell choose to lift type products?

    Read the article

  • [bash] Escape a string for sed search pattern

    - by Alexander Gladysh
    In my bash script I have an external (received from user) string, which I should use in sed pattern. REPLACE="<funny characters here>" sed "s/KEYWORD/$REPLACE/g" How can I escape the $REPLACE string so it would be safely accepted by sed as a literal replacement? NOTE: The KEYWORD is a dumb substring with no matches etc. It is not supplied by user.

    Read the article

  • Using \b in C# regular expressions doesn't work?

    - by Nikhil
    I am wondering why the following regex does not match. string query = "\"1 2\" 3"; string pattern = string.Format(@"\b{0}\b", Regex.Escape("\"1 2\"")); string repl = Regex.Replace(query, pattern, "", RegexOptions.CultureInvariant); Note that if I remove the word boundary characters (\b) from pattern, it matches fine. Is there something about '\b' that might be tripping this up?

    Read the article

  • How to display specific data from a file

    - by user1067332
    My program is supposed to ask the user for firstname, lastname, and phone number till the users stops. Then when to display it asks for the first name and does a search in the text file to find all info with the same first name and display lastname and phones of the matches. import java.util.*; import java.io.*; import java.util.Scanner; public class WritePhoneList { public static void main(String[] args)throws IOException { BufferedWriter output = new BufferedWriter(new FileWriter(new File( "PhoneFile.txt"), true)); String name, lname, age; int pos,choice; try { do { Scanner input = new Scanner(System.in); System.out.print("Enter First name, last name, and phone number "); name = input.nextLine(); output.write(name); output.newLine(); System.out.print("Would you like to add another? yes(1)/no(2)"); choice = input.nextInt(); }while(choice == 1); output.close(); } catch(Exception e) { System.out.println("Message: " + e); } } } Here is the display code, when i search for a name, it finds a match but displays the last name and phone number of the same name 3 times, I want it to display all of the possible matches with the first name. import java.util.*; import java.io.*; import java.util.Scanner; public class DisplaySelectedNumbers { public static void main(String[] args)throws IOException { String name; String strLine; try { FileInputStream fstream = new FileInputStream("PhoneFile.txt"); // Get the object of DataInputStream DataInputStream in = new DataInputStream(fstream); BufferedReader br = new BufferedReader(new InputStreamReader(in)); Scanner input = new Scanner(System.in); System.out.print("Enter a first name"); name = input.nextLine(); strLine= br.readLine(); String[] line = strLine.split(" "); String part1 = line[0]; String part2 = line[1]; String part3 = line[2]; //Read File Line By Line while ((strLine= br.readLine()) != null) { if(name.equals(part1)) { // Print the content on the console System.out.print("\n" + part2 + " " + part3); } } }catch (Exception e) {//Catch exception if any System.out.println("Error: " + e.getMessage()); } } }

    Read the article

  • rails solr search limit total search results / get fixed number of results

    - by kLeos
    I'm trying to perform a search, order the results randomly, and only return a number of results, not all matches. Something like limit(2) I've tried using the Solr param 'rows' but that doesn't seem to do anything: @featured_articles = Article.search do with(:is_featured, true) order_by :random adjust_solr_params do |params| params[:rows] = 2 end end @featured_articles.total should be 2, but it returns more than 2 How can I get a randomized fixed number of results?

    Read the article

  • XY-Scatter Chart In SSRS Won't Display Points

    - by Dalin Seivewright
    I'm a bit confused with this one. I have a Dataset with a BackupDate and a BackupTime as well as a BackupType. The BackupDate is comprised of 12 characters from the left of a datetime string within a table. The BackupTime is comprised of 8 characters from the right of that same datetime string. So for example: BackupDate would be 'December 12 2008' and the BackupTime would be '12:53PM.' I have added an XY-scatter chart to the report. I've added a 'series' value for the BackupType (so one can distinguish between a Full/Incr/Log backup). I've added a category value of BackupDate and set the Scale for the X-axis from the Min of BackupDate to the Max of BackupDate. I've then added an item to the Values with the Y variable set to BackupTime and the X variable set to BackupDate. The interval for the Y-axis is 12:00AM to 11:59PM and the formatting for the labels is 'hh:mmtt'. The BackupTime matches the format of the Y-axis. The BackupDate matches the format of the X-axis. 10 entries are retrieved by my Dataset and the Legend is properly populated by the BackupType field. No points are being plotted on the graph and no markers/pointers are shown if they are enabled. There should be a point on the graph for every point in time of each day there is a backup of a specific type. Am I missing something? Does anyone know of a good tutorial dealing specifically with XY-scatter graphs and using them in a way I intend? I am using the 2005 version of SSRS rather than the 2008 version. Screenshot of what my chart currently looks like: In case it could be dataset related: SELECT TOP (10) backup_type, LTRIM(RTRIM(LEFT(backup_finish_date, 12))) AS BackupDate, LTRIM(RTRIM(RIGHT(backup_finish_date, 8))) AS BackupTime FROM DBARepository.Backup_History As requested, here are the results of this query. There is a Where clause to constrain the results to a specific database of a specific server that was not included in the above SQL Query. Log Dec 26 2008 12:00PM Log Dec 27 2008 4:00AM Log Dec 27 2008 8:00AM Log Dec 27 2008 12:00PM Log Dec 27 2008 4:00PM Log Dec 27 2008 8:00PM Database Dec 27 2008 10:01PM Log Dec 28 2008 12:00AM Log Dec 28 2008 4:00AM Log Dec 28 2008 8:00AM

    Read the article

  • Erlang: Find intersections in a ets table

    - by Yadira Suazo
    I have an ets with the next items: [at, {other_place}, me], [other_place, {place}, {other_place}]], [at, {place}, me], [on, {surface}, {object}], [small, {object}] And I have the list [[at, door, me],[on, floor, chair],[small, bannanas]] I need to compare every item in the ets table to an item in the list and if the first one is the same atom, replace the items in round brackets. So if I have [at, door, me], it matches with [at, {other_place}, me], I have to change {other_place} for the atom door in all the ets table.

    Read the article

  • Double request from mod-rewrite

    - by Dave
    I've written a module that sets Apache environment variables to be used by mod-rewrite. It hooks into ap_hook_post_read_request() and that works fine, but if mod-rewrite matches a RewriteRule then it makes a second call to my request handler with the rewritten URL. This looks like a new request to me in that the environment variables are no longer set and therefore I have to execute my (expensive) code twice for each hit. What am I doing wrong, or is there a work around for this? Thanks

    Read the article

  • awk - Remove line if field is duplicate

    - by Kyle
    Looking for an awk (or sed) one-liner to remove lines from the output if the first field matches. An example for removing duplicate lines I've seen is: awk 'a !~ $0; {a=$0}' Tried using it for a basis with no luck (I thought changing the $0's to $1's would do the trick, but didn't seem to work).

    Read the article

  • using regular expression in Java

    - by Mrityunjay
    Hi, i need to check a string that should contain only ABCDEFG characters, in any sequence and with only 7 characters. Please let me know the correct way of using regular expression. as corrently i am using String abs = "ABPID"; if(!Pattern.matches("[[ABCDEFG]", abs)) System.out.println("Error"); i am using the following code which works when i use the String abcdefg but for other cases it fails. please help me out.

    Read the article

  • Find last match with python regular expression

    - by SDD
    I wanto to match the last occurence of a simple pattern in a string, e.g. list = re.findall(r"\w+ AAAA \w+", "foo bar AAAA foo2 AAAA bar2) print "last match: ", list[len(list)-1] however, if the string is very long, a huge list of matches is generated. Is there a more direct way to match the second occurence of "AAAA" or should I use this workaround?

    Read the article

  • Does anyone have experience simultaneously running a Drupal and Wordpress site and redirecting some

    - by DKinzer
    This is a really weird question and I apologize: I've been asked if it's possible not to import our blog from Wordpress to Drupal but just keep it in Wordpress as an archive and re-direct our users say from hostname/blog/... to hostname/wordpress/... when a URL matches the Wordpress URL pattern. I've never heard of anyone trying this and I'm wondering about pitfalls and whether or not it's even possible. Thanks! D

    Read the article

< Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >