Search Results

Search found 23474 results on 939 pages for 'xml import'.

Page 422/939 | < Previous Page | 418 419 420 421 422 423 424 425 426 427 428 429  | Next Page >

  • Why is django giving me an attribute error when I call _set.all() for its children models?

    - by user1876508
    I have two models defined from django.db import models class Blog(models.Model): title = models.CharField(max_length=144) @property def posts(self): self.Post_set.all() class Post(models.Model): title = models.CharField(max_length=144) text = models.TextField() blog = models.ForeignKey('Blog') but the problem is, when I run shell, and enter >>> blog = Blog(title="My blog") >>> post = Post(title="My first post", text="Here is the main text for my blog post", blog=blog) >>> blog.posts I get the error Traceback (most recent call last): File "<console>", line 1, in <module> File "/home/lucas/Programming/Python/Django/djangorestfun/blog/models.py", line 9, in posts self.Post_set.all() AttributeError: 'Blog' object has no attribute 'Post_set' >>> Now I am having the following problem >>> from blog.models import * >>> blog = Blog(title="gewrhter") >>> blog.save() >>> blog.__dict__ {'_state': <django.db.models.base.ModelState object at 0x259be10>, 'id': 1, 'title': 'gewrhter'} >>> blog._state.__dict__ {'adding': False, 'db': 'default'} >>> post = Post(title="sdhxcvb", text="hdbfdgb", blog=blog) >>> post.save() >>> post.__dict__ {'blog_id': 1, 'title': 'sdhxcvb', 'text': 'hdbfdgb', '_blog_cache': <Blog: Blog object>, '_state': <django.db.models.base.ModelState object at 0x259bed0>, 'id': 1} >>> blog.posts >>> print blog.posts None Second update So I followed your guide, but I am still getting nothing. In addition, blog.posts gives me an error. >>> from blog.models import * >>> blog = Blog(title="asdf") >>> blog.save() >>> post = Post(title="asdf", text="sdxcvb", blog=blog) >>> post.save() >>> blog.posts Traceback (most recent call last): File "<console>", line 1, in <module> AttributeError: 'Blog' object has no attribute 'posts' >>> print blog.all_posts None

    Read the article

  • jqgrid not updating data on reload

    - by meepmeep
    I have a jqgrid with data loading from an xml stream (handled by django 1.1.1): jQuery(document).ready(function(){ jQuery("#list").jqGrid({ url:'/downtime/list_xml/', datatype: 'xml', mtype: 'GET', postData:{site:1,date_start:document.getElementById('datepicker_start').value,date_end:document.getElementById('datepicker_end').value}, colNames:[...], colModel :[...], pager: '#pager', rowNum: 25, rowList:[10,25,50], viewrecords: true, height: 500, caption: 'Click on column headers to reorder' }); $("#grid_reload").click(function(){ $("#list").trigger("reloadGrid"); }); $("#tabs").tabs(); $("#datepicker_start").datepicker({dateFormat: 'yy-mm-dd'}); $("#datepicker_end").datepicker({dateFormat: 'yy-mm-dd'}); ... And the html elements: <th>Start Date:</th> <td><input id="datepicker_start" type="text" value="2009-12-01"></input></td> <th>End Date:</th> <td><input id="datepicker_end" type="text" value="2009-12-03"></input></td> <td><input id="grid_reload" type="submit" value="load" /></td> When I click the grid_reload button, the grid reloads, but when it has done so it shows exactly the same data as before, even though the xml is tested to return different data for different timestamps. I have checked using alert(document.getElementById('datepicker_start').value) that the values in the date inputs are passed correctly when the reload event is triggered. Any ideas why the data doesn't update? A caching or browser issue perhaps?

    Read the article

  • Java: exception-throwing class?

    - by HH
    I have classes DirReader and Search. The search uses DirReader. I want the search to know when DirReader throws exception. So how can I have class throwing exception? Currently, I use initCorrect -dummy var. Exception-style method may be more appropriate. Simplified Example Error $ javac ExceptionStatic.java ExceptionStatic.java:4: '{' expected public class ExceptionStatic throws Exception{ ^ 1 error Code import java.util.*; import java.io.*; // THIS PART NEEDS TO BE FIXED: public class ExceptionStatic throws Exception{ private static boolean initCorrect = false; public static String hello; static{ try{ hello = "hallo"; //some other conditionals in real code if( true) throw new Exception(); initCorrect=true; }catch(Exception e){ e.printStackTrace(); } } public static void main(String[] args){ if(initCorrect) System.out.println(hello); } }

    Read the article

  • ASP.Net menu databinding encoding problem

    - by WtFudgE
    Hi, I have a menu where I bind data through: XmlDataSource xmlData = new XmlDataSource(); xmlData.DataFile = String.Format(@"{0}{1}\Navigation.xml", getXmlPath(), getLanguage()); xmlData.XPath = @"/Items/Item"; TopNavigation.DataSource = xmlData; TopNavigation.DataBind(); The problem is when my xml has special characters, since I use a lot of french words. As an alternative I tried using a stream instead and using encoding to get the special characters, with the following code: StreamReader strm = new StreamReader(String.Format(@"{0}{1}\Navigation.xml", getXmlPath(), getLanguage()), Encoding.GetEncoding(1254)); XmlDocument xDoc = new XmlDocument(); xDoc.Load(strm); XmlDataSource xmlData = new XmlDataSource(); xmlData.ID = "TopNav"; xmlData.Data = xDoc.InnerXml; xmlData.XPath = @"/Items/Item"; TopNavigation.Items.Clear(); TopNavigation.DataSource = xmlData; TopNavigation.DataBind(); The problem I'm having now is that my data doesn't refresh when I change the path where the stream gets read. When I skip through the code it does, but not on my page. So the thing is either, how do I get the data te be refreshed? Or (which is actually preferred) how do I get the encoding right in the first piece of code? Help is highly apreciated!

    Read the article

  • Python class design - Splitting up big classes into multiple ones to group functionality

    - by Ivo Wetzel
    OK I've got 2 really big classes 1k lines each that I currently have split up into multiple ones. They then get recombined using multiple inheritance. Now I'm wondering, if there is any cleaner/better more pythonic way of doing this. Completely factoring them out would result in endless amounts of self.otherself.do_something calls, which I don't think is the way it should be done. To make things clear here's what it currently looks like: from gui_events import GUIEvents # event handlers from gui_helpers import GUIHelpers # helper methods that don't directly modify the GUI # GUI.py class GUI(gtk.Window, GUIEvents, GUIHelpers): # general stuff here stuff here One problem that is result of this is Pylint complaining giving me trillions of "init not called" / "undefined attribute" / "attribute accessed before definition" warnings.

    Read the article

  • The nexus of MSDeploy, MSBuild and Hudson

    - by roufamatic
    Hey, I have experience with MSBuild and Hudson, but am new to MSDeploy. I currently have a simple solution with one web application project. I set up a build configuration and am using the "Publish" command (Visual Studio 2010) to simply copy files to a local folder and do config file replacement. What I would like to do is automate this using Hudson. So I figure I'll create an MSBuild script that will Perform the build (by calling out to the project file with my desired build configuration) Call MSDeploy to do all the same things that the "Publish" command is doing, except copy the files to a different folder. Configure Hudson to poll subversion and perform steps 1 & 2 when changes are detected Step 2 is where I'm getting lost. I assumed that the project.xml file that was created by VS2010 corresponded to -verb:sync -source:manifest=project.xml options, but msdeploy is choking on that xml file so clearly that's not what it's intended for. What command is Visual Studio executing under the covers to perform the config file replacement and the file copy? How do I automate the Publish command?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • OpenEjb DeploymentLoader.getWebDescriptors NullPointerException

    - by jwmajors81
    I am currently getting the following error when I try to startup an EAR that includes OpenEJB. The error is: java.lang.NullPointerException at org.apache.openejb.config.DeploymentLoader.getWebDescriptors(DeploymentLoader.java:1057) at org.apache.openejb.config.DeploymentLoader.discoverModuleType(DeploymentLoader.java:1162) at org.apache.openejb.config.DeploymentsResolver.processUrls(DeploymentsResolver.java:294) at org.apache.openejb.config.DeploymentsResolver.loadFromClasspath(DeploymentsResolver.java:248) at org.apache.openejb.spring.ClassPathApplication.loadApplications(ClassPathApplication.java:56) at org.apache.openejb.spring.AbstractApplication.deployApplication(AbstractApplication.java:106) at org.apache.openejb.spring.OpenEJB.deployApplication(OpenEJB.java:342) at org.apache.openejb.spring.AbstractApplication.start(AbstractApplication.java:94) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:79) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at java.lang.reflect.Method.invoke(Method.java:618) at org.springframework.beans.factory.annotation.InitDestroyAnnotationBeanPostProcessor$LifecycleElement.invoke(InitDestroyAnnotationBeanPostProcessor.java:340) The environment consists of: - Spring 3.0 - OpenEJB 3.1 - WebSphere 6.1 (Without EJB/Web Service feature packs) - OpenEJB-Spring jar The app-config.xml that configures Spring and OpenEJB looks like: <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:context="http://www.springframework.org/schema/context" xmlns:p="http://www.springframework.org/schema/p" xsi:schemaLocation=" http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-3.0.xsd http://www.springframework.org/schema/context http://www.springframework.org/schema/context/spring-context-3.0.xsd" Also please note that I do have a JUnit test that runs against the app-config.xml specified above that can successfully load the application context file. It is just when I deploy it to WebSphere I encounter the error provided at the beginning of this message. Any assistance would be greatly appreciated. Thanks, Jeremy

    Read the article

  • Is this a good way to do a game loop for an iPhone game?

    - by Danny Tuppeny
    Hi all, I'm new to iPhone dev, but trying to build a 2D game. I was following a book, but the game loop it created basically said: function gameLoop update() render() sleep(1/30th second) gameLoop The reasoning was that this would run at 30fps. However, this seemed a little mental, because if my frame took 1/30th second, then it would run at 15fps (since it'll spend as much time sleeping as updating). So, I did some digging and found the CADisplayLink class which would sync calls to my gameLoop function to the refresh rate (or a fraction of it). I can't find many samples of it, so I'm posting here for a code review :-) It seems to work as expected, and it includes passing the elapsed (frame) time into the Update method so my logic can be framerate-independant (however I can't actually find in the docs what CADisplayLink would do if my frame took more than its allowed time to run - I'm hoping it just does its best to catch up, and doesn't crash!). // // GameAppDelegate.m // // Created by Danny Tuppeny on 10/03/2010. // Copyright Danny Tuppeny 2010. All rights reserved. // #import "GameAppDelegate.h" #import "GameViewController.h" #import "GameStates/gsSplash.h" @implementation GameAppDelegate @synthesize window; @synthesize viewController; - (void) applicationDidFinishLaunching:(UIApplication *)application { // Create an instance of the first GameState (Splash Screen) [self doStateChange:[gsSplash class]]; // Set up the game loop displayLink = [CADisplayLink displayLinkWithTarget:self selector:@selector(gameLoop)]; [displayLink setFrameInterval:2]; [displayLink addToRunLoop:[NSRunLoop currentRunLoop] forMode:NSDefaultRunLoopMode]; } - (void) gameLoop { // Calculate how long has passed since the previous frame CFTimeInterval currentFrameTime = [displayLink timestamp]; CFTimeInterval elapsed = 0; // For the first frame, we want to pass 0 (since we haven't elapsed any time), so only // calculate this in the case where we're not the first frame if (lastFrameTime != 0) { elapsed = currentFrameTime - lastFrameTime; } // Keep track of this frames time (so we can calculate this next time) lastFrameTime = currentFrameTime; NSLog([NSString stringWithFormat:@"%f", elapsed]); // Call update, passing the elapsed time in [((GameState*)viewController.view) Update:elapsed]; } - (void) doStateChange:(Class)state { // Remove the previous GameState if (viewController.view != nil) { [viewController.view removeFromSuperview]; [viewController.view release]; } // Create the new GameState viewController.view = [[state alloc] initWithFrame:CGRectMake(0, 0, IPHONE_WIDTH, IPHONE_HEIGHT) andManager:self]; // Now set as visible [window addSubview:viewController.view]; [window makeKeyAndVisible]; } - (void) dealloc { [viewController release]; [window release]; [super dealloc]; } @end Any feedback would be appreciated :-) PS. Bonus points if you can tell me why all the books use "viewController.view" but for everything else seem to use "[object name]" format. Why not [viewController view]?

    Read the article

  • Django Managers

    - by owca
    I have the following models code : from django.db import models from categories.models import Category class MusicManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Music') def count_music(self): return self.all().count() class SportManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Sport') class Event(models.Model): title = models.CharField(max_length=120) category = models.ForeignKey(Category) objects = models.Manager() music = MusicManager() sport = SportManager() Now by registering MusicManager() and SportManager() I am able to call Event.music.all() and Event.sport.all() queries. But how can I create Event.music.count() ? Should I call self.all() in count_music() function of MusicManager to query only on elements with 'Music' category or do I still need to filter through them in search for category first ?

    Read the article

  • Parsing Json Feeds with google Gson

    - by mnml
    I would like to know how to parse a json feed by items, eg. url / title / description for each item. I have had a look to the doc / api but, it didn't help me. This is what I got so far import com.google.gson.Gson; import com.google.gson.JsonObject; public class ImportSources extends Job { public void doJob() throws IOException { String json = stringOfUrl("http://feed.test/all.json"); JsonObject jobj = new Gson().fromJson(json, JsonObject.class); Logger.info(jobj.get("responseData").toString()); } public static String stringOfUrl(String addr) throws IOException { ByteArrayOutputStream output = new ByteArrayOutputStream(); URL url = new URL(addr); IOUtils.copy(url.openStream(), output); return output.toString(); } }

    Read the article

  • Conversion failed when converting datetime from character string. Linq To SQL & OpenXML

    - by chobo2
    Hi I been following this tutorial on how to do a linq to sql batch insert. http://www.codeproject.com/KB/linq/BulkOperations_LinqToSQL.aspx However I have a datetime field in my database and I keep getting this error. System.Data.SqlClient.SqlException was unhandled Message="Conversion failed when converting datetime from character string." Source=".Net SqlClient Data Provider" ErrorCode=-2146232060 Class=16 LineNumber=7 Number=241 Procedure="spTEST_InsertXMLTEST_TEST" Server="" State=1 StackTrace: at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection) at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj) at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj) I am not sure why when I just take the datetime in the generated xml file and manually copy it into sql server 2005 it has no problem with it and converts it just fine. This is my SP CREATE PROCEDURE [dbo].[spTEST_InsertXMLTEST_TEST](@UpdatedProdData nText) AS DECLARE @hDoc int exec sp_xml_preparedocument @hDoc OUTPUT,@UpdatedProdData INSERT INTO UserTable(CreateDate) SELECT XMLProdTable.CreateDate FROM OPENXML(@hDoc, 'ArrayOfUserTable/UserTable', 2) WITH ( CreateDate datetime ) XMLProdTable EXEC sp_xml_removedocument @hDoc C# code using (TestDataContext db = new TestDataContext()) { UserTable[] testRecords = new UserTable[1]; for (int count = 0; count < 1; count++) { UserTable testRecord = new UserTable() { CreateDate = DateTime.Now }; testRecords[count] = testRecord; } StringBuilder sBuilder = new StringBuilder(); System.IO.StringWriter sWriter = new System.IO.StringWriter(sBuilder); XmlSerializer serializer = new XmlSerializer(typeof(UserTable[])); serializer.Serialize(sWriter, testRecords); db.spTEST_InsertXMLTEST_TEST(sBuilder.ToString()); } Rendered XML Doc <?xml version="1.0" encoding="utf-16"?> <ArrayOfUserTable xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <UserTable> <CreateDate>2010-05-19T19:35:54.9339251-07:00</CreateDate> </UserTable> </ArrayOfUserTable>

    Read the article

  • android app working on simulator but not on phone

    - by raqz
    i have this app that i developed and it works great on the simulator with no errors what so ever. but the moment i try to run the same on the phone for testing, the app crashes stating filenotfoundexception. it says the file /res/drawable/divider_horizontal.9.png is missing. but actually speaking, i have never referenced that file through my code. i believe its a system/os file that is unavailable. i have a custom list view, i guess its the divider there... could somebody please suggest what is wrong here. i believe this is a similar issue discussed here..but i am unable to make any sense out of it http://code.google.com/p/transdroid/issues/detail?id=14 the listview.xml layout file <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_height="wrap_content" android:gravity="left|center" android:layout_width="wrap_content" android:paddingBottom="5px" android:paddingTop="5px" android:paddingLeft="5px" > <ImageView android:id="@+id/linkImage" android:layout_width="wrap_content" android:layout_height="fill_parent" android:layout_marginRight="6dip" android:src="@drawable/icon" /> <LinearLayout android:orientation="vertical" android:layout_width="0dip" android:layout_weight="1" android:layout_height="fill_parent"> <TextView android:id="@+id/firstLineView" android:layout_width="wrap_content" android:layout_height="wrap_content" android:gravity="center" android:textColor="#FFFF00" android:text="first line title"></TextView> <TextView android:id="@+id/secondLineView" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="second line title" android:layout_marginLeft="10px" android:gravity="center" android:textColor="#0099CC"></TextView> </LinearLayout> </LinearLayout> the main xml file that calls the listview.xml <?xml version="1.0" encoding="UTF-8"?> <FrameLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:orientation="horizontal" android:layout_width="fill_parent" android:layout_height="40px"> <Button android:id="@+id/todayButton" android:layout_width="fill_parent" android:layout_height="fill_parent" android:text="Today" android:textSize="12sp" android:gravity="center" android:layout_weight="1" /> <Button android:id="@+id/tomorrowButton" android:layout_width="fill_parent" android:layout_height="fill_parent" android:text="Tomorrow" android:textSize="12sp" android:layout_weight="1" /> <Button android:id="@+id/WeekButton" android:layout_width="fill_parent" android:layout_height="fill_parent" android:text="Future" android:textSize="12sp" android:layout_weight="1" /> </LinearLayout> <LinearLayout android:id="@+id/listLayout" android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent"> <ListView android:id="@+id/ListView01" android:layout_width="fill_parent" android:layout_height="fill_parent" /> <TextView android:id="@id/android:empty" android:layout_width="fill_parent" android:layout_height="fill_parent" android:text="No Results" /> </LinearLayout> </LinearLayout> </FrameLayout> and the code for the same is private class EfficientAdapter extends BaseAdapter{ private LayoutInflater mInflater; private String eventTitleArray[]; private String eventDateArray[]; private String eventImageLinkArray[]; public EfficientAdapter(Context context,String[] eventTitleArray,String[] eventDateArray, String[] eventImageLinkArray){ mInflater = LayoutInflater.from(context); this.eventDateArray=eventDateArray; this.eventTitleArray=eventTitleArray; this.eventImageLinkArray =eventImageLinkArray; } public int getCount(){ //return XmlParser.todayEvents.size()-1; return this.eventDateArray.length; } public Object getItem(int position){ return position; } public long getItemId(int position){ return position; } public View getView(int position, View convertView, ViewGroup parent){ ViewHolder holder; if(convertView == null){ convertView = mInflater.inflate(R.layout.listview,null); holder = new ViewHolder(); holder.firstLine = (TextView) convertView.findViewById(R.id.firstLineView); holder.secondLine = (TextView) convertView.findViewById(R.id.secondLineView); holder.imageView = (ImageView) convertView.findViewById(R.id.linkImage); //holder.checkbox = (CheckBox) convertView.findViewById(R.id.star); holder.firstLine.setFocusable(false); holder.secondLine.setFocusable(false); holder.imageView.setFocusable(false); //holder.checkbox.setFocusable(false); convertView.setTag(holder); }else{ holder = (ViewHolder) convertView.getTag(); } Log.i(tag, "Creating the list"); holder.firstLine.setText(this.eventTitleArray[position]); holder.secondLine.setText(this.eventDateArray[position]); Bitmap bitmap; try { bitmap = BitmapFactory.decodeStream((InputStream)new URL("http://eventur.sis.pitt.edu/images/heinz7.jpg").getContent()); } catch (MalformedURLException e1) { // TODO Auto-generated catch block e1.printStackTrace(); } catch (Exception e1) { // TODO Auto-generated catch block bitmap = BitmapFactory.decodeFile("assets/heinz7.jpg");//decodeFile(getResources().getAssets().open("icon.png")); e1.printStackTrace(); } try { try{ bitmap = BitmapFactory.decodeStream((InputStream)new URL(this.eventImageLinkArray[position]).getContent());} catch(Exception e){ bitmap = BitmapFactory.decodeStream((InputStream)new URL("http://eventur.sis.pitt.edu/images/heinz7.jpg").getContent()); } int width = 0; int height =0; int newWidth = 50; int newHeight = 40; try{ width = bitmap.getWidth(); height = bitmap.getHeight(); } catch(Exception e){ width = 50; height = 40; } float scaleWidth = ((float)newWidth)/width; float scaleHeight = ((float)newHeight)/height; Matrix mat = new Matrix(); mat.postScale(scaleWidth, scaleHeight); try{ Bitmap newBitmap = Bitmap.createBitmap(bitmap,0,0,width,height,mat,true); BitmapDrawable bmd = new BitmapDrawable(newBitmap); holder.imageView.setImageDrawable(bmd); holder.imageView.setScaleType(ScaleType.CENTER); } catch(Exception e){ } } catch (MalformedURLException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } return convertView; } class ViewHolder{ TextView firstLine; TextView secondLine; ImageView imageView; //CheckBox checkbox; } The stack trace 12-12 22:55:25.022: ERROR/AndroidRuntime(11069): Uncaught handler: thread main exiting due to uncaught exception 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): android.view.InflateException: Binary XML file line #6: Error inflating class java.lang.reflect.Constructor 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.LayoutInflater.createView(LayoutInflater.java:512) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at com.android.internal.policy.impl.PhoneLayoutInflater.onCreateView(PhoneLayoutInflater.java:56) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.LayoutInflater.createViewFromTag(LayoutInflater.java:562) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.LayoutInflater.rInflate(LayoutInflater.java:617) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.LayoutInflater.inflate(LayoutInflater.java:407) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.LayoutInflater.inflate(LayoutInflater.java:320) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.LayoutInflater.inflate(LayoutInflater.java:276) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at com.eventur.MainActivity$EfficientAdapter.getView(MainActivity.java:566) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.AbsListView.obtainView(AbsListView.java:1274) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.ListView.makeAndAddView(ListView.java:1661) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.ListView.fillDown(ListView.java:610) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.ListView.fillFromTop(ListView.java:673) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.ListView.layoutChildren(ListView.java:1519) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.AbsListView.onLayout(AbsListView.java:1113) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.View.layout(View.java:6156) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.LinearLayout.setChildFrame(LinearLayout.java:1119) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.LinearLayout.layoutVertical(LinearLayout.java:998) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.LinearLayout.onLayout(LinearLayout.java:918) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.View.layout(View.java:6156) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.LinearLayout.setChildFrame(LinearLayout.java:1119) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.LinearLayout.layoutVertical(LinearLayout.java:998) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.LinearLayout.onLayout(LinearLayout.java:918) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.View.layout(View.java:6156) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.FrameLayout.onLayout(FrameLayout.java:333) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.View.layout(View.java:6156) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.FrameLayout.onLayout(FrameLayout.java:333) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.View.layout(View.java:6156) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.LinearLayout.setChildFrame(LinearLayout.java:1119) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.LinearLayout.layoutVertical(LinearLayout.java:998) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.LinearLayout.onLayout(LinearLayout.java:918) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.View.layout(View.java:6156) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.FrameLayout.onLayout(FrameLayout.java:333) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.View.layout(View.java:6156) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.ViewRoot.performTraversals(ViewRoot.java:950) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.ViewRoot.handleMessage(ViewRoot.java:1529) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.os.Handler.dispatchMessage(Handler.java:99) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.os.Looper.loop(Looper.java:123) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.app.ActivityThread.main(ActivityThread.java:3977) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at java.lang.reflect.Method.invokeNative(Native Method) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at java.lang.reflect.Method.invoke(Method.java:521) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:782) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:540) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at dalvik.system.NativeStart.main(Native Method) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): Caused by: java.lang.reflect.InvocationTargetException 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.ImageView.<init>(ImageView.java:128) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at java.lang.reflect.Constructor.constructNative(Native Method) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at java.lang.reflect.Constructor.newInstance(Constructor.java:446) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.view.LayoutInflater.createView(LayoutInflater.java:499) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): ... 42 more 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): Caused by: android.content.res.Resources$NotFoundException: File res/drawable/divider_horizontal_dark.9.png from drawable resource ID #0x7f020001 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.content.res.Resources.loadDrawable(Resources.java:1643) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.content.res.TypedArray.getDrawable(TypedArray.java:548) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.widget.ImageView.<init>(ImageView.java:138) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): ... 46 more 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): Caused by: java.io.FileNotFoundException: res/drawable/divider_horizontal_dark.9.png 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.content.res.AssetManager.openNonAssetNative(Native Method) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.content.res.AssetManager.openNonAsset(AssetManager.java:417) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): at android.content.res.Resources.loadDrawable(Resources.java:1636) 12-12 22:55:25.212: ERROR/AndroidRuntime(11069): ... 48 more

    Read the article

  • JavaScript/Dojo Module Pattern - how to debug?

    - by djna
    I'm working with Dojo and using the "Module Pattern" as described in Mastering Dojo. So far as I can see this pattern is a general, and widely used, JavaScript pattern. My question is: How do we debug our modules? So far I've not been able to persuade Firebug to show me the source of my module. Firebug seems to show only the dojo eval statement used to execute the factory method. Hence I'm not able to step through my module source. I've tried putting "debugger" statements in my module code, and Firebug seems to halt correctly, but does not show the source. Contrived example code below. This is just an example of sufficient complexity to make the need for debugging plausible, it's not intended to be useful code. The page <!-- Experiments with Debugging --> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <title>console me</title> <style type="text/css"> @import "../dojoroot/dojo/resources/dojo.css"; @import "../dojoroot/dijit/themes/tundra/tundra.css"; @import "edf.css"; </style> <script type="text/javascript" src="../dojoroot/dojo/dojo.js"> </script> <script type="text/javascript" > dojo.registerModulePath("mytest", "../../mytest"); dojo.require("mytest.example"); dojo.addOnLoad(function(){ mytest.example.greet(); }); </script> </head> <body class="tundra"> <div id="bulletin"> <p>Just Testing</p> </div> </body> </html> <!-- END: snip1 --> The java script I'd like to debug dojo.provide("mytest.example"); dojo.require("dijit.layout.ContentPane"); /** * define module */ (function(){ //define the main program functions... var example= mytest.example; example.greet= function(args) { var bulletin = dojo.byId("bulletin"); console.log("bulletin:" + bulletin); if ( bulletin) { var content = new dijit.layout.ContentPane({ id: "dummy", region: "center" }); content.setContent('Greetings!'); dojo._destroyElement(bulletin); dojo.place(content.domNode, dojo.body(), "first"); console.log("greeting done"); } else { console.error("no bulletin board"); } } })();

    Read the article

  • How to stop a QDialog from executing while still in the __init__ statement(or immediatly after)?

    - by Jonathan
    I am wondering how I can go about stopping a dialog from opening if certain conditions are met in its __init__ statement. The following code tries to call the 'self.close()' function and it does, but (I'm assuming) since the dialog has not yet started its event loop, that it doesn't trigger the close event? So is there another way to close and/or stop the dialog from opening without triggering an event? Example code: from PyQt4 import QtCore, QtGui class dlg_closeInit(QtGui.QDialog): ''' Close the dialog if a certain condition is met in the __init__ statement ''' def __init__(self): QtGui.QDialog.__init__(self) self.txt_mytext = QtGui.QLineEdit('some text') self.btn_accept = QtGui.QPushButton('Accept') self.myLayout = QtGui.QVBoxLayout(self) self.myLayout.addWidget(self.txt_mytext) self.myLayout.addWidget(self.btn_accept) self.setLayout(self.myLayout) # Connect the button self.connect(self.btn_accept,QtCore.SIGNAL('clicked()'), self.on_accept) self.close() def on_accept(self): # Get the data... self.mydata = self.txt_mytext.text() self.accept() def get_data(self): return self.mydata def closeEvent(self, event): print 'Closing...' if __name__ == '__main__': import sys app = QtGui.QApplication(sys.argv) dialog = dlg_closeInit() if dialog.exec_(): print dialog.get_data() else: print "Failed"

    Read the article

  • Oracle XMLDB's XMLCAST and XMLQUERY incompatible with iBatis?

    - by tthong
    I've been trying to select a list of values from XMLs stored in an XMLType column but I keep getting the errors which are listed at the tail end of this post. The select id is getXMLFragment , and the relevant subset of the sqlmap.xml is as follows: <select id="getXMLFragment" resultClass="list"> SELECT XMLCAST(XMLQUERY('$CUSTOMER/CUSTOMER/DETAILS/ CUST_NAME/text()' PASSING CUSTOMER AS "CUSTOMER" RETURNING CONTENT) AS VARCHAR2(20)) AS customers FROM SHOP.CLIENT_INFO </select> (CUSTOMER is an XMLType column in CLIENT_INFO) and I call the statement using List<String> custNames= (List<String>) sqlMap.queryForList("getXMLFragment"); I am using ibatis-2.3.4.726.jar. Is it because iBatis does not recognise XMLDB queries and hence, tokenizes the string wrongly? On a sidenote, I have implemented XMLTypeCallback.java to handle XMLType insertions successfully, and I think it will work should I wish to retrieve the entire XML. However, in this case, I need to extract only individual values due to requirements. A workaround would be greatly appreciated. Thanks in advance. The exceptions generated are listed below: --- The error occurred in sqlMap.xml. --- The error occurred while preparing the mapped statement for execution. --- Check the getXMLFragment. --- Check the SQL statement. --- Cause: java.util.NoSuchElementException at com.ibatis.sqlmap.engine.mapping.statement.MappedStatement.executeQueryWithCallback(MappedStatement.java: 204) at com.ibatis.sqlmap.engine.mapping.statement.MappedStatement.executeQueryForList(MappedStatement.java: 139) at com.ibatis.sqlmap.engine.impl.SqlMapExecutorDelegate.queryForList(SqlMapExecutorDelegate.java: 567) at com.ibatis.sqlmap.engine.impl.SqlMapExecutorDelegate.queryForList(SqlMapExecutorDelegate.java: 541) at com.ibatis.sqlmap.engine.impl.SqlMapSessionImpl.queryForList(SqlMapSessionImpl.java: 118) at com.ibatis.sqlmap.engine.impl.SqlMapSessionImpl.queryForList(SqlMapSessionImpl.java: 122) at com.ibatis.sqlmap.engine.impl.SqlMapClientImpl.queryForList(SqlMapClientImpl.java: 98) at Main.main(Main.java:60) Caused by: java.util.NoSuchElementException at java.util.StringTokenizer.nextToken(StringTokenizer.java:332) at com.ibatis.sqlmap.engine.mapping.sql.simple.SimpleDynamicSql.processDynamicElements(SimpleDynamicSql.java: 90) at com.ibatis.sqlmap.engine.mapping.sql.simple.SimpleDynamicSql.getSql(SimpleDynamicSql.java: 45) at com.ibatis.sqlmap.engine.mapping.statement.MappedStatement.executeQueryWithCallback(MappedStatement.java: 184) ... 7 more

    Read the article

  • Convert Wordpress.com Hosted Blog to BlogEngine.NET

    - by Chris Marisic
    I'm looking at what is needed to move from wordpress.com to a BlogEngine.NET or similar blog. I've seen a tool for replacing export.php so that it will export your wordpress site in BlogML format so it can easily be imported into BlogEngine.NET, however I'd really not want to have to setup php/wordpress just so I can import a back up from wordpress.com and then use the export from my local wordpress to have a BlogML file. Are there any tools that will convert the wordpress file? Is there a different blog that will natively import the wordpress file? Edit: For the question about other blog providers, I am open to them as long as they are .NET based, preferably C#.

    Read the article

  • Python Ephem calculation

    - by dassouki
    the output should process the first date as "day" and second as "night". I've been playing with this for a few hours now and can't figure out what I'm doing wrong. Any ideas? Output: $ python time_of_day.py * should be day: event date: 2010/4/6 16:00:59 prev rising: 2010/4/6 09:24:24 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/7 09:22:27 next set: 2010/4/6 23:34:27 day * should be night: event date: 2010/4/6 00:01:00 prev rising: 2010/4/5 09:26:22 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/6 09:24:24 next set: 2010/4/6 23:34:27 day time_of_day.py import datetime import ephem # install from http://pypi.python.org/pypi/pyephem/ #event_time is just a date time corresponding to an sql timestamp def type_of_light(latitude, longitude, event_time, utc_time, horizon): o = ephem.Observer() o.lat, o.long, o.date, o.horizon = latitude, longitude, event_time, horizon print "event date ", o.date print "prev rising: ", o.previous_rising(ephem.Sun()) print "prev setting: ", o.previous_setting(ephem.Sun()) print "next rise: ", o.next_rising(ephem.Sun()) print "next set: ", o.next_setting(ephem.Sun()) if o.previous_rising(ephem.Sun()) <= o.date <= o.next_setting(ephem.Sun()): return "day" elif o.previous_setting(ephem.Sun()) <= o.date <= o.next_rising(ephem.Sun()): return "night" else: return "error" print "should be day: ", type_of_light('45.959','-66.6405','2010/4/6 16:01','-4', '-6') print "should be night: ", type_of_light('45.959','-66.6405','2010/4/6 00:01','-4', '-6')

    Read the article

  • AutoCompleteTextView displays 'android.database.sqlite.SQLiteCursor@'... after making selection

    - by user244190
    I am using the following code to set the adapter (SimpleCursorAdapter) for an AutoCompleteTextView mComment = (AutoCompleteTextView) findViewById(R.id.comment); Cursor cComments = myAdapter.getDistinctComments(); scaComments = new SimpleCursorAdapter(this,R.layout.auto_complete_item,cComments,new String[] {DBAdapter.KEY_LOG_COMMENT},new int[]{R.id.text1}); mComment.setAdapter(scaComments); auto_complete_item.xml <?xml version="1.0" encoding="utf-8"?> <TextView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/text1" android:layout_width="wrap_content" android:layout_height="wrap_content"/> and thi is the xml for the actual control <AutoCompleteTextView android:id="@+id/comment" android:hint="@string/COMMENT" android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="18dp"/> The dropdown appears to work correctly, and shows a list of items. When I make a selection from the list I get a sqlite object ('android.database.sqlite.SQLiteCursor@'... ) in the textview. Anyone know what would cause this, or how to resolve this? thanks Ok I am able to hook into the OnItemClick event, but the TextView.setText() portion of the AutoCompleteTextView widget is updated after this point. The OnItemSelected() event never gets fired, and the onNothingSelected() event gets fired when the dropdown items are first displayed. mComment.setOnItemClickListener( new OnItemClickListener() { @Override public void onItemClick(AdapterView<?> arg0, View arg1, int arg2, long arg3) { // TODO Auto-generated method stub SimpleCursorAdapter sca = (SimpleCursorAdapter) arg0.getAdapter(); String str = getSpinnerSelectedValue(sca,arg2,"comment"); TextView txt = (TextView) arg1; txt.setText(str); Toast.makeText(ctx, "onItemClick", Toast.LENGTH_SHORT).show(); } }); mComment.setOnItemSelectedListener(new OnItemSelectedListener() { @Override public void onItemSelected(AdapterView<?> arg0, View arg1, int arg2, long arg3) { Toast.makeText(ctx, "onItemSelected", Toast.LENGTH_SHORT).show(); } @Override public void onNothingSelected(AdapterView<?> arg0) { // TODO Auto-generated method stub Toast.makeText(ctx, "onNothingSelected", Toast.LENGTH_SHORT).show(); } }); Anyone alse have any ideas on how to override the updating of the TextView? thanks patrick

    Read the article

  • IronPython and Nodebox in C#

    - by proxylittle
    My plan: I'm trying to setup my C# project to communicate with Nodebox to call a certain function which populates a graph and draws it in a new window. Current situation: [fixed... see Update2] I have already included all python-modules needed, but im still getting a Library 'GL' not found it seems that the pyglet module needs a reference to GL/gl.h, but can't find it due to IronPython behaviour. Requirement: The project needs to stay as small as possible without installing new packages. Thats why i have copied all my modules into the project-folder and would like to keep it that or a similar way. My question: Is there a certain workaround for my problem or a fix for the library-folder missmatch. Have read some articles about Tao-Opengl and OpenTK but can't find a good solution. Update1: Updated my sourcecode with a small pyglet window-rendering example. Problem is in pyglet and referenced c-Objects. How do i include them in my c# project to be called? No idea so far... experimenting alittle now. Keeping you updated. SampleCode C#: ScriptRuntimeSetup setup = Python.CreateRuntimeSetup(null); ScriptRuntime runtime = new ScriptRuntime(setup); ScriptEngine engine = Python.GetEngine(runtime); ScriptSource source = engine.CreateScriptSourceFromFile("test.py"); ScriptScope scope = engine.CreateScope(); source.Execute(scope); SampleCode Python (test.py): from nodebox.graphics import * from nodebox.graphics.physics import Vector, Boid, Flock, Obstacle flock = Flock(50, x=-50, y=-50, width=700, height=400) flock.sight(80) def draw(canvas): canvas.clear() flock.update(separation=0.4, cohesion=0.6, alignment=0.1, teleport=True) for boid in flock: push() translate(boid.x, boid.y) scale(0.5 + boid.depth) rotate(boid.heading) arrow(0, 0, 15) pop() canvas.size = 600, 300 def main(canvas): canvas.run(draw) Update2: Line 139 [pyglet/lib.py] sys.platform is not win32... there was the error. Fixed it by just using the line: from pyglet.gl.lib_wgl import link_GL, link_GLU, link_WGL Now the following Error: 'module' object has no attribute '_getframe' Kind of a pain to fix it. Updating with results... Update3: Fixed by adding following line right after first line in C#-Code: setup.Options["Frames"] = true; Current Problem: No module named unicodedata, but in Python26/DLLs is only a *.pyd file`. So.. how do i implement it now?!

    Read the article

  • undefined symbol: PyUnicodeUCS2_Decode whilst trying to install psycopg2

    - by Marco Fucci
    I'm getting an error whilst trying to install psycopg2 on ubuntu 9.10 64 bit. The error is: >>> import psycopg2 Traceback (most recent call last): File "<stdin>", line 1, in <module> File "psycopg2/__init__.py", line 69, in <module> from _psycopg import BINARY, NUMBER, STRING, DATETIME, ROWID ImportError: psycopg2/_psycopg.so: undefined symbol: PyUnicodeUCS2_Decode I've tried downloading the package from http://initd.org/pub/software/psycopg/ and installing it. I've tried by using easy_install too. No error during the installation. It's quite weird as my python (2.6.2) has been compiled with UCS4 and so the installation should just work without problems. Any help would be appreciated. Cheers

    Read the article

  • TabHost NullPointerException in layout

    - by Chubbs
    I been following the Tab example provided by Google. I am trying to use the XML layout provided to setup a tab layout. I use this XML layout @ http://developer.android.com/guide/tutorials/views/hello-tabwidget.html <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content" /> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent"> <TextView android:id="@+id/textview1" android:layout_width="fill_parent" android:layout_height="fill_parent" android:text="this is a tab" /> <TextView android:id="@+id/textview2" android:layout_width="fill_parent" android:layout_height="fill_parent" android:text="this is another tab" /> <TextView android:id="@+id/textview3" android:layout_width="fill_parent" android:layout_height="fill_parent" android:text="this is a third tab" /> </FrameLayout> </LinearLayout> </TabHost> When ever I switch the Layout tab in the Eclipse layout designer I get a NullPointerException: null error inside my Eclipse. This happens also when I try to drag and drop a TabHost, and then a TabWidget into an empty layout file. What am I doing wrong ? this seems pretty simple.

    Read the article

  • python urllib post question

    - by paul
    hello ALL im making some simple python post script but it not working well. there is 2 part to have to login. first login is using 'http://mybuddy.buddybuddy.co.kr/userinfo/UserInfo.asp' this one. and second login is using 'http://user.buddybuddy.co.kr/usercheck/UserCheckPWExec.asp' i can login first login page, but i couldn't login second page website. and return some error 'illegal access' such like . i heard this is related with some cooke but i don't know how to implement to resolve this problem. if anyone can help me much appreciated!! Thanks! import re,sys,os,mechanize,urllib,time import datetime,socket params = urllib.urlencode({'ID':'ph896011', 'PWD':'pk1089' }) rq = mechanize.Request("http://mybuddy.buddybuddy.co.kr/userinfo/UserInfo.asp", params) rs = mechanize.urlopen(rq) data = rs.read() logged_fail = r';history.back();</script>' in data if not logged_fail: print 'login success' try: params = urllib.urlencode({'PASSWORD':'pk1089'}) rq = mechanize.Request("http://user.buddybuddy.co.kr/usercheck/UserCheckPWExec.asp", params ) rs = mechanize.urlopen(rq) data = rs.read() print data except: print 'error'

    Read the article

  • Run bat file in Java and wait 2

    - by Savvas Dalkitsis
    This is a followup question to my other question : http://stackoverflow.com/questions/2434125/run-bat-file-in-java-and-wait The reason i am posting this as a separate question is that the one i already asked was answered correctly. From some research i did my problem is unique to my case so i decided to create a new question. Please go read that question before continuing with this one as they are closely related. Running the proposed code blocks the program at the waitFor invocation. After some research i found that the waitFor method blocks if your process has output that needs to be proccessed so you should first empty the output stream and the error stream. I did those things but my method still blocks. I then found a suggestion to simply loop while waiting the exitValue method to return the exit value of the process and handle the exception thrown if it is not, pausing for a brief moment as well so as not to consume all the CPU. I did this: import java.io.BufferedReader; import java.io.IOException; import java.io.InputStreamReader; public class Test { public static void main(String[] args) { try { Process p = Runtime.getRuntime().exec( "cmd /k start SQLScriptsToRun.bat" + " -UuserName -Ppassword" + " projectName"); final BufferedReader input = new BufferedReader(new InputStreamReader(p.getInputStream())); final BufferedReader error = new BufferedReader(new InputStreamReader(p.getErrorStream())); new Thread(new Runnable() { @Override public void run() { try { while (input.readLine()!=null) {} } catch (IOException e) { e.printStackTrace(); } } }).start(); new Thread(new Runnable() { @Override public void run() { try { while (error.readLine()!=null) {} } catch (IOException e) { e.printStackTrace(); } } }).start(); int i = 0; boolean finished = false; while (!finished) { try { i = p.exitValue(); finished = true; } catch (IllegalThreadStateException e) { e.printStackTrace(); try { Thread.sleep(500); } catch (InterruptedException e1) { e1.printStackTrace(); } } } System.out.println(i); } catch (IOException e) { e.printStackTrace(); } } } but my process will not end! I keep getting this error: java.lang.IllegalThreadStateException: process has not exited Any ideas as to why my process will not exit? Or do you have any libraries to suggest that handle executing batch files properly and wait until the execution is finished?

    Read the article

  • Python 3: unpack inner lists in list comprehension

    - by Beau Martínez
    I'm running the following code on a list of strings to return a list of its words: words = [re.split('\\s+', line) for line in lines] However, I end up getting something like: [['import', 're', ''], ['', ''], ['def', 'word_count(filename):', ''], ...] As opposed to the desired: ['import', 're', '', '', '', 'def', 'word_count(filename):', '', ...] How can I unpack the lists re.split('\\s+', line) produces in the above list comprehension? Naïvely, I tried using * but that doesn't work. (I'm looking for a simple and Pythonic way of doing; I was tempted to write a function but I'm sure the language accommodates for this issue.)

    Read the article

< Previous Page | 418 419 420 421 422 423 424 425 426 427 428 429  | Next Page >