Search Results

Search found 81445 results on 3258 pages for 'file command'.

Page 423/3258 | < Previous Page | 419 420 421 422 423 424 425 426 427 428 429 430  | Next Page >

  • SQL ADO.NET shortcut extensions (old school!)

    - by Jeff
    As much as I love me some ORM's (I've used LINQ to SQL quite a bit, and for the MSDN/TechNet Profile and Forums we're using NHibernate more and more), there are times when it's appropriate, and in some ways more simple, to just throw up so old school ADO.NET connections, commands, readers and such. It still feels like a pain though to new up all the stuff, make sure it's closed, blah blah blah. It's pretty much the least favorite task of writing data access code. To minimize the pain, I have a set of extension methods that I like to use that drastically reduce the code you have to write. Here they are... public static void Using(this SqlConnection connection, Action<SqlConnection> action) {     connection.Open();     action(connection);     connection.Close(); } public static SqlCommand Command(this SqlConnection connection, string sql){    var command = new SqlCommand(sql, connection);    return command;}public static SqlCommand AddParameter(this SqlCommand command, string parameterName, object value){    command.Parameters.AddWithValue(parameterName, value);    return command;}public static object ExecuteAndReturnIdentity(this SqlCommand command){    if (command.Connection == null)        throw new Exception("SqlCommand has no connection.");    command.ExecuteNonQuery();    command.Parameters.Clear();    command.CommandText = "SELECT @@IDENTITY";    var result = command.ExecuteScalar();    return result;}public static SqlDataReader ReadOne(this SqlDataReader reader, Action<SqlDataReader> action){    if (reader.Read())        action(reader);    reader.Close();    return reader;}public static SqlDataReader ReadAll(this SqlDataReader reader, Action<SqlDataReader> action){    while (reader.Read())        action(reader);    reader.Close();    return reader;} It has been awhile since I've really revisited these, so you will likely find opportunity for further optimization. The bottom line here is that you can chain together a bunch of these methods to make a much more concise database call, in terms of the code on your screen, anyway. Here are some examples: public Dictionary<string, string> Get(){    var dictionary = new Dictionary<string, string>();    _sqlHelper.GetConnection().Using(connection =>        connection.Command("SELECT Setting, [Value] FROM Settings")            .ExecuteReader()            .ReadAll(r => dictionary.Add(r.GetString(0), r.GetString(1))));    return dictionary;} or... public void ChangeName(User user, string newName){    _sqlHelper.GetConnection().Using(connection =>         connection.Command("UPDATE Users SET Name = @Name WHERE UserID = @UserID")            .AddParameter("@Name", newName)            .AddParameter("@UserID", user.UserID)            .ExecuteNonQuery());} The _sqlHelper.GetConnection() is just some other code that gets a connection object for you. You might have an even cleaner way to take that step out entirely. This looks more fluent, and the real magic sauce for me is the reader bits where you can put any kind of arbitrary method in there to iterate over the results.

    Read the article

  • PHP uploads file - enctype="multipart/form-data" issue

    - by user147685
    Hi all, I have this upload code. there are no problem running it individually, but when i try to add into my other codes, it did not get the $_files parameter. Im guessing it was becoz of enctype="multipart/form-data" in the form tag, based on this post: http://stackoverflow.com/questions/1695246/why-file-upload-didnt-work-without-enctype the enctype is needed. SO my problem is, how can i do upload files without concern to this? can we juz change the code structure so that it will be compatible with other codes? if($_POST['check']){ $faillampiran=$_POST['faillampiran']; $file=$_FILES['faillampiran']["name"]; $fileSize = $_FILES['faillampiran']['size']; $fileType = $_FILES['faillampiran']['type']; if ($_FILES["faillampiran"]["error"] > 0 ) { echo "Return Code: " . $_FILES["faillampiran"]["error"] . "<br />"; } else { move_uploaded_file($_FILES["faillampiran"]["tmp_name"],"upload/" . $_FILES["faillampiran"]["name"]); echo '<table align = "center">'; echo "<tr><td>"; echo "Your file has been successfully stored."; echo "</td></tr>"; echo '</table>'; } } ?> <form method="post" name="form1" id="form1" enctype="multipart/form-data"> <tr><td></td><td><input type="hidden" name="MAX_FILE_SIZE" value=""> </td> </tr> <tr><td> Please choose a file</td><td>:</td></tr> <tr> <input type="file" size="50" name="faillampiran" alt="faillampiran" id="faillampiran" 1value= "<?=$faillampiran;?>" /> <tr align = "center"><td colspan = "3"><input type="submit" value="Hantar" name="check"/></td></tr> </tr></form> thank you.

    Read the article

  • Questions about linux root file system.

    - by smwikipedia
    I read the manual page of the "mount" command, at it reads as below: All files accessible in a Unix system are arranged in one big tree, the file hierarchy, rooted at /. These files can be spread out over several devices. The mount command serves to attach the file system found on some device to the big file tree. My questions are: Where is this "big tree" located? Suppose I have 2 disks, if I mount them onto some point in the "big tree", does linux place some "special marks" in the mount point to indicate that these 2 "mount directories" are indeed seperate disks?

    Read the article

  • Understanding the Unix file system and ruby installs without Sudo

    - by JZ
    I'm trying to comprehend the Unix file system on my OSX. I'm following wikipedia Filesystem Hierarchy Standard. I understand when I install ruby gems I must use the command sudo gem install but if I omit sudo, problems may occur. Where are gems installed within the file system when I omit sudo? How can I delete these gems? A Fun side question: When I enter cd ~/.gem my terminal is directed to .gem user$, When I enter cd ~/ and list folders using the ls command I can't find a .gem folder. Where is the .gem folder? How does this fit into the Filesystem?

    Read the article

  • The ctags command doesn't recurse saying "it is not a regular file".

    - by indiv
    When I run ctags -R *, I get errors saying that all directories are not regular files and it skips them instead of recursively generating tags for them. ctags: skipping arpa: it is not a regular file. ctags: skipping asm: it is not a regular file. ctags: skipping asm-generic: it is not a regular file. ctags: skipping bits: it is not a regular file. ctags: skipping blkid: it is not a regular file. ctags: skipping boost: it is not a regular file. What is the problem?

    Read the article

  • How to import a macro file (previously exported as .bas file) to Microsoft Word using command line?

    - by Nam Gi VU
    I'm writing a command-line program that has a step in which I need to replace text in a Word file. The replacing task is accomplished using Word macro. What I need to do now is to call this macro from command-line. At the moment we can do this by using the -mMacroName parameter of 'winword.exe', i.e. \winword.exe -mMacroName. But this need the macro to be already available as a global macro. Since I need to run the program on another computer, I need to import the above replacing macro programatically... and I don't know how to do this. Please help.

    Read the article

  • How to log messages to a log file in a specific path from a bash script

    - by Erik
    How do you log messages to a log file in a specific path from a bash script? A naive implementation would be commands like: echo My message >>/my/custom/path/to/my_script.log But this probably has many disadvantages (no log rotation for example). I could use the 'logger' command, but it does not support logs in custom paths as far as I know and is not easy to configure if you have lots of bash scripts that could use a custom log file. In a scripting language like Ruby all this is quite easy: https://github.com/rudionrails/yell/wiki/101-the-datefile-adapter I could also make my own logger command based on this ruby library and call it from my bash scripts, but I guess there is already a well known solution that provides similar behavior for shell scripts?

    Read the article

  • How do I reset my display settings from the command line?

    - by Trevor
    I'm running 12.10 on a dell e5400 laptop and I used xrandr to get the dual monitors working that I connect through a laptop dock. I used xrandr again to switch back to the laptop display when I undocked. The problem is, after a restart, the laptop seems to want to come back up with the dual monitor configuration and the laptop screen stays blank. I can boot into single user mode but I'm not sure what to do from there to get the display settings reset. Any ideas? There's no xorg.conf file so I'm not sure where the settings are stored anymore. Thanks.

    Read the article

  • Will the app file be sync from dmgr side after we remove it from installedApps path in Websphere?

    - by wing2ofsky
    do you know whether the app file will be sync from dmgr side and regenerated after we remove it from installedApps path? i've got one issue recently from customer. That is, they uploaded one image file into WASNode installedApps app path manually. Afterwards, they removed that file manually again from installedApps app path. But after restarting the Application server process, that file has been regenerated under same installedApps path. So i suspect that file maybe has been resync from dmgr node, like app file under applications folder. However, first of all, i don't see that image file within application ear file from DMGR applications folder. Moreover, i made a test myself, if i deleted file from installedApps app path, that file never be regenerated any more even though the node sync completed. So does anybody know why? Thanks in advance

    Read the article

  • How to play small sound file continuously in Silverlight?

    - by ash
    Hello, I have two questions regarding Silverlight's SoundPlay action and properties. My scenario is like: I have two story board: The first story board has an image and a sound file; when the silverlight application gets loaded, the sound starts to play automatically, but if someone clicks the image, the sound file will stop and the second storyboard will start with a new sound file. 1) My first question is how to stop the first sound file of first story board when the second story board starts with the second sound file. 2) My second question is how to play a sound file continuously; for example, in Silverlight we can play a story board continuously with RepeatBehavior="Forever"; but I cannot find a way to play my 10 second sound file forever or continuously. Note: I have attached a small XAML file to show what I am talking about; I am also stating that if instead of an image file, if there were a button, then I can stop the first music file after I click the button and start my second story board with a new sound file, but I would like to use image file instead of a button. Is it possible? If it is, how to do it? Therefore, please answer my following two questions or give big hint or website tutorial links on 1) How to stop the first sound file of first story board when the second story board starts with the second sound file ( When the clickable element is an image instead of a button) 2) How to play a 10 second sound file continuously? ............Code Snippet...................... XAML ............ <Grid x:Name="LayoutRoot" Background="Red"> <Button HorizontalAlignment="Left" Margin="212,0,0,111" VerticalAlignment="Bottom" Width="75" Content="Button" Click="onClick"/> <MediaElement x:Name="sound2_mp3" Height="0" HorizontalAlignment="Left" Margin="105,230,0,0" VerticalAlignment="Top" Width="0" Source="/sound2.mp3" Stretch="Fill"/> <MediaElement x:Name="sound1_mp1" Height="0" HorizontalAlignment="Left" Margin="190,164,0,0" VerticalAlignment="Top" Width="0" Source="/sound1.mp3" Stretch="Fill" AutoPlay="False"/> </Grid> ..................................................................................................................................................................................................................... using System; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Ink; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Animation; using System.Windows.Shapes; namespace testPrj { public partial class MainPage : UserControl { public MainPage() { // Required to initialize variables InitializeComponent(); } private void onClick(object sender, System.Windows.RoutedEventArgs e) { Storyboard1.Stop(); sound2_mp3.Stop(); sound1_mp1.Play(); } } } ...................................................................................................

    Read the article

  • DOS batch script to list folders that have a specific file in them

    - by Lee
    I'm trying to create a file that has a list of directories that have a specific file name in them. Let's say I'm trying to find directories that have a file named *.joe in them. I initially tried just a simple dir /ad *.joe dir_list.txt , but it searches the directory names for *.joe, so no go. Then I concluded that a for loop was probably my best bet. I started with for /d /r %a in ('dir *.joe /b') do @echo %a dir_list.txt and it looked like it wasn't executing the dir command. I added the "usebackq", but that seems to only work for the /F command extension. Ideas?

    Read the article

  • Rails 3: How do I call a javascript function from a js.erb file

    - by user321775
    Now that I've upgraded to Rails 3, I'm trying to figure out the proper way to separate and reuse pieces of javascript. Here's the scenario I'm dealing with: I have a page with two areas: one with elements that should be draggable, the other with droppables. When the page loads I use jQuery to setup the draggables and droppables. Currently I have the script in the head portion of application.html.erb, which I'm sure is not the right solution but at least works. When I press a button on the page, an ajax call is made to my controller that replaces the draggables with a new set of elements that should also be draggable. I have a js.erb file that renders a partial in the correct location. After rendering I need to make the new elements draggable, so I'd like to reuse the code that currently lives in application.html.erb, but I haven't found the right way to do it. I can only make the new elements draggable by pasting the code directly into my js.erb file (yuck). What I'd like to have: - a javascript file that contains the functions prepdraggables() and prepdroppables() - a way to call either function from application.html.erb or from a js.erb file I've tried using :content_for to store and reuse the code, but can't seem to get it working correctly. What I currently have in the head section of application.html.erb <% content_for :drag_drop_prep do %> <script type="text/javascript" charset="utf-8"> $(document).ready(function () { // declare all DOM elements with class draggable to be draggable $( ".draggable" ).draggable( { revert : 'invalid' }); // declare all DOM elements with class legal to be droppable $(".legal").droppable({ hoverClass : 'legal_hover', drop : function(event, ui) { var c = new Object(); c['die'] = ui.draggable.attr("id"); c['cell'] = $(this).attr("id"); c['authenticity_token'] = encodeURIComponent(window._token); $.ajax({ type: "POST", url: "/placeDie", data: c, timeout: 5000 }); }}); }); </script> <% end %> undo.js.erb $("#board").html("<%= escape_javascript(render :partial => 'shared/board', :locals => { :playable => true, :restartable => !session[:challenge]}) %>") // This is where I want to prepare draggables. <%= javascript_include_tag "customdragdrop.js" %> // assuming this file had the draggables code from above in a prepdraggables() function prepdraggables();

    Read the article

  • Binary file reading problem

    - by ScReYm0
    Ok i have problem with my code for reading binary file... First i will show you my writing code: void book_saving(char *file_name, struct BOOK *current) { FILE *out; BOOK buf; out = fopen(file_name, "wb"); if(out != NULL) { printf_s("Writting to file..."); do { if(current != NULL) { strcpy(buf.catalog_number, current->catalog_number); strcpy(buf.author, current->author); buf.price = current->price; strcpy(buf.publisher, current->publisher); strcpy(buf.title, current->title); buf.price = current->year_published; fwrite(&buf, sizeof(BOOK), 1, out); } current = current->next; }while(current != NULL); printf_s("Done!\n"); fclose(out); } } and here is my "version" for reading it back: int book_open(struct BOOK *current, char *file_name) { FILE *in; BOOK buf; BOOK *vnext; int count; int i; in = fopen("west", "rb"); printf_s("Reading database from %s...", file_name); if(!in) { printf_s("\nERROR!"); return 1; } i = fread(&buf,sizeof(BOOK), 1, in); while(!feof(in)) { if(current != NULL) { current = malloc(sizeof(BOOK)); current->next = NULL; } strcpy(current->catalog_number, buf.catalog_number); strcpy(current->title, buf.title); strcpy(current->publisher, buf.publisher); current->price = buf.price; current->year_published = buf.year_published; fread(&buf, 1, sizeof(BOOK), in); while(current->next != NULL) current = current->next; fclose(in); } printf_s("Done!"); return 0; } I just need to save my linked list in binary file and to be able to read it back ... please help me. The program just don't read it or its crash every time different situation ...

    Read the article

  • How to change icons of specific file types on Ubuntu 11.10?

    - by Curious Apprentice
    I want to change file icons of some specific file types like- .html, .css etc. I have tried using "File Type Editor (assogiate)" which is not working. I have also tried using "Gnome Tweak Tool" using icon themes. But that also does not worked properly (Though I can change folder icons , dash menu icons but not file icons). Please suggest me a way so that I can change file icons properly. I have read some of the articles saying about some mime type changes. I could not get proper guide from any of those articles. If there is such a way then please write in detail. Many Many Thanks in Advance :)

    Read the article

  • php download file slows

    - by hobbywebsite
    OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

    Read the article

  • Is it possible to mod_rewrite BASED on the existence of a file/directory and uniqueID?

    - by JM4
    My site currently forces all non www. pages to use www. Ultimately, I am able to handle all unique subdomains and parse correctly but I am trying to achieve the following: (ideally with mod_rewrite): when a consumer visits www.site.com/john4, the server processes that request as: www.site.com?Agent=john4 Our requirements are: The URL should continue to show www.site.com/john4 even though it was redirected to www.site.com?index.php?Agent=john4 If a file (of any extension OR a directory) exists with the name, the entire process stops an it tries to pull that file instead: for example: www.site.com/file would pull up (www.site.com/file.php if file.php existed on the server. www.site.com/pages would go to www.site.com/pages/index.php if the pages directory exists). Thank you ahead of time. I am completely at a crapshot right now.

    Read the article

  • Why dd is not a reliable command to write bootable .iso files to USB thumb drive?

    - by Samik
    As the answers here indicate Ubuntu .iso s are not expected to boot if copied with dd to a USB thumb drive. Now my question is why is so that some Linux distributions have the option to directly write their bootable .iso file to a thumb drive with dd but some (read Ubuntu) have not(for Ubuntu I think it has to be converted to .img first). Is it for some architectural difference in .isos? Or is it due to any limitation of dd itself?I don't know if it is off-topic here. I can move it to a more proper place if the community thinks so or suggests one. Some explanation would be appreciable.

    Read the article

  • Is there a way to recover a file that I have deleted but is still open somewhere?

    - by George Edison
    This question is related to How to recover deleted files? but it is slightly different in nature. Suppose I have a file named ~/something open in a text editor. Further suppose that I open a terminal and run the following command while the file is still open in the text editor: rm ~/something This will delete the file. Now suppose that I changed my mind and wanted to get the file back. The file is still open in the text editor, so it hasn't been removed from the disk or filesystem yet. Is there any way to recover it?

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • nicely display file rename history in git log

    - by Jian
    The git command git log --format='%H' --follow -- foo.txt will give you the series of commits that touch foo.txt, following it across renames. I'm wondering if there's a git log command that will also print the corresponding historical file name beside each commit. It would be something like this, where we can interpret '%F' to be the (actually non-existent) placeholder for filename. git log --format='%H %F' --follow -- foo.txt I know this could be accomplished with git log --format='%H' --follow --numstat -- foo.txt but the output is not ideal since it requires some non-trivial parsing; each commit is strewn across multiple lines, and you'll still need to parse the file rename syntax ("bar.txt => foo.txt") to find what you're looking for.

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • Can I copy large files faster without using the file cache?

    - by Veazer
    After adding the preload package, my applications seem to speed up but if I copy a large file, the file cache grows by more than double the size of the file. By transferring a single 3-4 GB virtualbox image or video file to an external drive, this huge cache seems to remove all the preloaded applications from memory, leading to increased load times and general performance drops. Is there a way to copy large, multi-gigabyte files without caching them (i.e. bypassing the file cache)? Or a way to whitelist or blacklist specific folders from being cached?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • A question about making a C# class persistent during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

< Previous Page | 419 420 421 422 423 424 425 426 427 428 429 430  | Next Page >