Search Results

Search found 15629 results on 626 pages for 'mod python'.

Page 423/626 | < Previous Page | 419 420 421 422 423 424 425 426 427 428 429 430  | Next Page >

  • Is there a way to control how pytest-xdist runs tests in parallel?

    - by superselector
    I have the following directory layout: runner.py lib/ tests/ testsuite1/ testsuite1.py testsuite2/ testsuite2.py testsuite3/ testsuite3.py testsuite4/ testsuite4.py The format of testsuite*.py modules is as follows: import pytest class testsomething: def setup_class(self): ''' do some setup ''' # Do some setup stuff here def teardown_class(self): '''' do some teardown''' # Do some teardown stuff here def test1(self): # Do some test1 related stuff def test2(self): # Do some test2 related stuff .... .... .... def test40(self): # Do some test40 related stuff if __name__=='__main()__' pytest.main(args=[os.path.abspath(__file__)]) The problem I have is that I would like to execute the 'testsuites' in parallel i.e. I want testsuite1, testsuite2, testsuite3 and testsuite4 to start execution in parallel but individual tests within the testsuites need to be executed serially. When I use the 'xdist' plugin from py.test and kick off the tests using 'py.test -n 4', py.test is gathering all the tests and randomly load balancing the tests among 4 workers. This leads to the 'setup_class' method to be executed every time of each test within a 'testsuitex.py' module (which defeats my purpose. I want setup_class to be executed only once per class and tests executed serially there after). Essentially what I want the execution to look like is: worker1: executes all tests in testsuite1.py serially worker2: executes all tests in testsuite2.py serially worker3: executes all tests in testsuite3.py serially worker4: executes all tests in testsuite4.py serially while worker1, worker2, worker3 and worker4 are all executed in parallel. Is there a way to achieve this in 'pytest-xidst' framework? The only option that I can think of is to kick off different processes to execute each test suite individually within runner.py: def test_execute_func(testsuite_path): subprocess.process('py.test %s' % testsuite_path) if __name__=='__main__': #Gather all the testsuite names for each testsuite: multiprocessing.Process(test_execute_func,(testsuite_path,))

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • What is the Simplest Possible Payment Gateway to Implement? (using Django)

    - by b14ck
    I'm developing a web application that will require users to either make one time deposits of money into their account, or allow users to sign up for recurring billing each month for a certain amount of money. I've been looking at various payment gateways, but most (if not all) of them seem complex and difficult to get working. I also see no real active Django projects which offer simple views for making payments. Ideally, I'd like to use something like Amazon FPS, so that I can see online transaction logs, refund money, etc., but I'm open to other things. I just want the EASIEST possible payment gateway to integrate with my site. I'm not looking for anything fancy, whatever does the job, and requires < 10 hours to get working from start to finish would be perfect. I'll give answer points to whoever can point out a good one. Thanks!

    Read the article

  • Include ":" character in parameter using Apache's mod_rewrite

    - by travis
    I use something like that to pass to the parameter 'text' what follows after the domain RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule ^(.*)$ index.php?text=$1 [L,QSA] So if I have www.example.com/tralala I get $text='tralala' But I want it to be possible to have in the parameter the character ":" multiple times: www.example.com/me:you:him Can you give me a hand? If I test www.example.com/me:you:him I get the error: Forbidden You don't have permission to access /you:me:him on this server.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • django test client trouble

    - by Anton Koval'
    I've got a problem... we're writing project using django, and i'm trying to use django.test.client with nose test-framework for tests. Our code is like this: from simplejson import loads from urlparse import urljoin from django.test.client import Client TEST_URL = "http://smakly.localhost:9090/" def test_register(): cln = Client() ref_data = {"email": "[email protected]", "name": "???????", "website": "http://hot.bear.com", "xhr": "true"} print urljoin(TEST_URL, "/accounts/register/") response = loads(cln.post(urljoin(TEST_URL, "/accounts/register/"), ref_data)) print response["message"] and in nose output I catch: Traceback (most recent call last): File "/home/psih/work/svn/smakly/eggs/nose-0.11.1-py2.6.egg/nose/case.py", line 183, in runTest self.test(*self.arg) File "/home/psih/work/svn/smakly/src/smakly.tests/smakly/tests/frontend/test_profile.py", line 25, in test_register response = loads(cln.post(urljoin(TEST_URL, "/accounts/register/"), ref_data)) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 313, in post response = self.request(**r) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 225, in request response = self.handler(environ) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 69, in __call__ response = self.get_response(request) File "/home/psih/work/svn/smakly/parts/django/django/core/handlers/base.py", line 78, in get_response urlconf = getattr(request, "urlconf", settings.ROOT_URLCONF) File "/home/psih/work/svn/smakly/parts/django/django/utils/functional.py", line 273, in __getattr__ return getattr(self._wrapped, name) AttributeError: 'Settings' object has no attribute 'ROOT_URLCONF' My settings.py file does have this attribute. If I get the data from the server with standard urllib2.urllopen().read() it works in the proper way. Any ideas how I can solve this case?

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • More HtAccess Rewrite Rules

    - by pws5068
    Greetings all, I need help combining some htaccess rewrites, these crazy regular expressions screw with my head. So I have a folder structure something like this: /www/mysite.com/page/member/friends.php /www/mysite.com/page/video/videos.php /www/mysite.com/page/messages/inbox.php The URLs get rewritten to this: mysite.com/member/friends.php mysite.com/video/videos.php mysite.com/messages/inbox.php (Notice the /page/ folder is hidden in the url, but I keep it on the server for better file organization) The rewrite rules look something like this: (I'm new so correct me if they are flawed) RewriteRule ^video/(.*)$ /page/video/$1 [NC] RewriteRule ^member/(.*)$ /page/member/$1 [NC] RewriteRule ^messages/(.*)$ /page/messages/$1 [NC] Now, I also need to do a completely different rewrite to a file called lobby.php inside of the member folder: After the original rewrites, a sample url looks like: mysite.com/member/lobby.php?member=pws5068 I need a new rewrite to make it look like this: mysite.com/pws5068 Thank you for bearing with my super-long question here. How can I make this happen?

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • Getting unpredictable data into a tabular format

    - by Acorn
    The situation: Each page I scrape has <input> elements with a title= and a value= I don't know what is going to be on the page. I want to have all my collected data in a single table at the end, with a column for each title. So basically, I need each row of data to line up with all the others, and if a row doesn't have a certain element, then it should be blank (but there must be something there to keep the alignment). eg. First page has: {animal: cat, colour: blue, fruit: lemon, day: monday} Second page has: {animal: fish, colour: green, day: saturday} Third page has: {animal: dog, number: 10, colour: yellow, fruit: mango, day: tuesday} Then my resulting table should be: animal | number | colour | fruit | day cat | none | blue | lemon | monday fish | none | green | none | saturday dog | 10 | yellow | mango | tuesday Although it would be good to keep the order of the title value pairs, which I know dictionaries wont do. So basically, I need to generate columns from all the titles (kept in order but somehow merged together) What would be the best way of going about this without knowing all the possible titles and explicitly specifying an order for the values to be put in?

    Read the article

  • How to generate lots of redundant ajax elements like checkboxes and pulldowns in Django?

    - by iJames
    Hello folks. I've been getting lots of answers from stackoverflow now that I'm in Django just be searching. Now I hope my question will also create some value for everybody. In choosing Django, I was hoping there was some similar mechanism to the way you can do partials in ROR. This was going to help me in two ways. One was in generating repeating indexed forms or form elements, and also in rendering only a piece of the page on the round trip. I've done a little bit of that by using taconite with a simple URL click but now I'm trying to get more advanced. This will focus on the form issue which boils down to how to iterate over a secondary object. If I have a list of photo instances, each of which has a couple of parameters, let's say a size and a quantity. I want to generate form elements for each photo instance separately. But then I have two lists I want to iterate on at the same time. Context: photos : Photo.objects.all() and forms = {} for photo in photos: forms[photo.id] = PhotoForm() In other words we've got a list of photo objects and a dict of forms based on the photo.id. Here's an abstraction of the template: {% for photo in photos %} {% include "photoview.html" %} {% comment %} So here I want to use the photo.id as an index to get the correct form. So that each photo has its own form. I would want to have a different action and each form field would be unique. Is that possible? How can I iterate on that? Thanks! {% endcomment %} Quantity: {{ oi.quantity }} {{ form.quantity }} Dimensions: {{ oi.size }} {{ form.size }} {% endfor %} What can I do about this simple case. And how can I make it where every control is automatically updating the server instead of using a form at all? Thanks! James

    Read the article

  • Encoding with url and api

    - by user2950824
    So I have this web app set up and running and it works fine for any username that you request, but when i try http://mrcastelo.pythonanywhere.com/lol/euw/Nazaré, it simply doesnt work - the error that I get on the server is the following: iddata= getJSON(urllolbase+region+urlid+username) #SummonerID UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 5: ordinal not in range(128) It is annoying me greatly, I've tried some other threads but none of them came to a fix. The api that I am using (www.legendaryapi.com) does accept this because this works. Any idea on how to fix this?

    Read the article

  • Trying to output a list using class

    - by captain morgan
    Am trying to get the moving average of a price..but i keep getting an attribute error in my Moving_Average class. ('Moving_Average' object has no attribute 'days'). Here is what I have: class Moving_Average: def calculation(self, alist:list,days:int): m = self.days prices = alist[1::2] average = [0]* len(prices) signal = ['']* len(prices) for m in range(0,len(prices)-days+1): average[m+2] = sum(prices[m:m+days])/days if prices[m+2] < average[m+2]: signal[m+2]='SELL' elif prices[m+2] > average[m+2] and prices[m+1] < average[m+1]: signal[m+2]='BUY' else: signal[m+2] ='' return average,signal def print_report(symbol:str,strategy:str): print('SYMBOL: ', symbol) print('STRATEGY: ', strategy) print('Date Closing Strategy Signal') def user(): strategy = ''' Which of the following strategy would you like to use? * Simple Moving Average [S] * Directional Indicator[D] Please enter your choice: ''' if signal_strategy in 'Ss': days = input('Please enter the number of days for the average') days = int(days) strategy = 'Simple Moving Average {}-days'.format(str(days)) m = Moving_Average() ma = m.calculation(gg, days) print(ma) gg is an list that contains date and prices. [2013-10-01,60,2013-10-02,60] The output is supposed to look like: Date Price Average Signal 2013-10-01 60.0 2013-10-02 60.0 60.00 BUY

    Read the article

  • How to emulate mod_rewrite in PHP

    - by Tyler Crompton
    I have a few URLs that I want to map to certain files via PHP. Currently, I am just using mod_rewrite in Apache. However, my application is getting too large for the rewriting to be done with regular expressions. So I created a file router.php that does the rewriting. I understand to do a redirect I could just send the Location: header. However, I don't always want to do a redirect. For example, I may want /api/item/ to map to the file /herp/derp.php relative to the document root. I need to preserve the HTTP method as well. "No problem," I thought. I made my .htaccess have the following snippet. RewriteEngine On RewriteRule ^api/item/$ /cgi-bin/router.php [L] And my router.php file looks as follows: <?php $uri = parse_url($_SERVER['REQUEST_URI']); $query = isset($uri['query']) ? $uri['query'] ? array(); // some code that modifies the query require_once "{$_SERVER['DOCUMENT_ROOT']}/herp/derp.php?" . http_build_query($query); ?> However, this doesn't work, because the OS is looking for a file named derp.php?some=query. How can I simulate a rewrite rule such as RewriteRule ^api/item/$ /herp/derp/ [L] in PHP. In other words, how do I tell the server to process a different URL than requested and preserve the query and HTTP method without causing a redirect? Note: Using variables set in router.php is less than desirable and is bad structure since it's only supposed to be responsible for handling URLs. I am open to using a light-weight third party solution.

    Read the article

  • How to inject a key string to andoid device through ADB?

    - by Nandi
    Hi, Can somebody help me for the following. I want to select a perticular string in the list displayed in android phone. If i take example of phone book. i want to pass a person name to the device using adb interface and that name should get highlighted in the list. I tried all adb commands for this but could pass string and key events to the screen but not able to select the respective string. please help. Thanks in advance.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Django website on Apache with wsgi failing

    - by notagain
    I have a website I've built in django that I'm trying to get working on our corporate Apache server (on debian) for our intranet at my workplace. Unfortunately, Apache keeps returning server errors whenever I try to navigate to my site. Although I can navigate to the statics folder. My Apache config and wsgi script look like the following... lbirdf.wsgi import os import sys sys.path.append('/home/lbi/rdfweb/web') sys.path.append('/home/lbi/rdfweb/lbirdf') os.environ['DJANGO_SETTINGS_MODULE'] = 'lbirdf.settings_production' import django.core.handlers.wsgi application = django.core.handlers.wsgi.WSGIHandler() Apache config Listen 8080 <VirtualHost *:8080> ServerName server1 WSGIScriptAlias /rdfweb /home/lbi/rdfweb/web/lbirdf/apache/lbirdf.wsgi Alias /statics /home/lbi/rdfweb/web/lbirdf/statics Alias /admin_media /home/lbi/rdfweb/web/lbirdf/admin_media <Directory /home/lbi/rdfweb/web/lbirdf/apache> Order allow,deny Allow from all </Directory> <Directory /home/lbi/rdfweb/web/lbirdf/admin_media> Order allow,deny Allow from all </Directory> </VirtualHost> Any ideas on where I might be going wrong?

    Read the article

  • .htaccess Redirect Loop, adding multiple .php extensions

    - by Ryan Smith
    I have sort of a small parent/teacher social network set up for my school. I use my .htaccess file to make the links to teacher profiles cleaner and to add a trailing slash to all urls. I get this problem when going to /teachers/teacher-name/ the link (sometimes) redirects to /teachers/teacher-name.php.php.php.php.php.php.php.php... Below is my .htaccess file. Sometimes if I clear my browser cache in Chrome it temporarily fixes it. I can't exactly wright .htaccess syntax, but I'm pretty familiar with it. Any suggestions are appreciated! RewriteEngine on RewriteBase / #remove php ext RewriteEngine on RewriteCond %{REQUEST_FILENAME} !-d RewriteCond %{REQUEST_FILENAME}\.php -f RewriteRule ^([^/]+)/$ $1.php RewriteRule ^([^/]+)/([^/]+)/$ $1/$2.php #force trailing slash/ RewriteCond %{REQUEST_FILENAME} !-f RewriteRule ^(.*)([^/])$ /$1$2/ [L,R=301] #other rewrites RewriteRule ^teachers/([^/\.]+)/$ /teachers/profile.php?u=$1 RewriteRule ^teachers/([^/\.]+)/posts/$ /teachers/posts.php?u=$1 RewriteRule ^teachers/([^/\.]+)/posts/([^/\.]+)/$ /teachers/post.php?u=$1&p=$2 RewriteRule ^gallery/([^/\.]+)/$ /gallery/album.php?n=$1 RewriteRule ^gallery/([^/\.]+)/slideshow/$ /gallery/slideshow.php?n=$1 RewriteRule ^gallery/([^/\.]+)/([^/\.]+)/([^/\.]+)/$ /gallery/photo.php?a=$1&p=$2&e=$3 EDIT:I have attached a screenshot of exactly what I'm talking about.

    Read the article

  • Search for a String and replace it with a variable

    - by chrissygormley
    Hello, I am trying to use regular expression to search a document fo a UUID number and replace the end of it with a new number. The code I have so far is: read_file = open('test.txt', 'r+') write_file = open('test.txt', 'w') r = re.compile(r'(self.uid\s*=\s*5EFF837F-EFC2-4c32-A3D4\s*)(\S+)') for l in read_file: m1 = r.match(l) if m1: new=(str,m1.group(2)) new?????? This where I get stuck. The file test.txt has the below UUID stored in it: self.uid = '5EFF837F-EFC2-4c32-A3D4-D15C7F9E1F22' I want to replace the part D15C7F9E1F22. I have also tried this: r = re.compile(r'(self.uid\s*=\s*)(\S+)') for l in fp: m1 = r.match(l) new=map(int,m1.group(2).split("-") new[4]='RHUI5345JO' But I cannot seem to match the string. Thanks in advance for any help.

    Read the article

  • How to make Universal Feed Parser only parse feeds?

    - by piquadrat
    I'm trying to get content from external feeds on my Django web site with Universal Feed Parser. I want to have some user error handling, e.g. if the user supplies a URL that is not a feed. When I tried how feedparser responds to faulty input, I was surprised to see that feedparser does not throw any Exceptions at all. E.g. on HTML content, it tries to parse some information from the HTML code, and on non-existing domains, it returns a mostly empty dictionary: {'bozo': 1, 'bozo_exception': URLError(gaierror(-2, 'Name or service not known'),), 'encoding': 'utf-8', 'entries': [], 'feed': {}, 'version': None} Other faulty input manifest themselves in the status_code or the namespaces values in the returned dictionary. So, what's the best approach to have sane error checking without resorting to an endless cascade of if .. elif .. elif ...?

    Read the article

  • Problem with anchor tags in Django after using lighttpd + fastcgi

    - by Drew A
    I just started using lighttpd and fastcgi for my django site, but I've noticed my anchor links are no longer working. I used the anchor links for sorting links on the page, for example I use an anchor to sort links by the number of points (or votes) they have received. For example: the code in the html template: ... {% load sorting_tags %} ... {% ifequal sort_order "points" %} {% trans "total points" %} {% trans "or" %} {% anchor "date" "date posted" %} {% order_by_votes links request.direction %} {% else %} {% anchor "points" "total points" %} {% trans "or" %} {% trans "date posted" %} ... The anchor link on "www.mysite.com/my_app/" for total points will be directed to "my_app/?sort=points" But the correct URL should be "www.mysite.com/my_app/?sort=points" All my other links work, the problem is specific to anchor links. The {% anchor %} tag is taken from django-sorting, the code can be found at http://github.com/directeur/django-sorting Specifically in django-sorting/templatetags/sorting_tags.py Thanks in advance.

    Read the article

  • Matplotlib autodatelocator custom date formatting?

    - by jawonlee
    I'm using Matplotlib to dynamically generate .png charts from a database. The user may set as the x-axis any given range of datetimes, and I need to account for all of it. While Matplotlib has the dates.AutoDateLocator(), I want the datetime format printed on the chart to be context-specific - e.g. if the user is charting from 3 p.m. to 5 p.m., the year/month/day information doesn't need to be displayed. Right now, I'm manually creating Locator and Formatter objects thusly: def get_ticks(start, end): from datetime import timedelta as td delta = end - start if delta <= td(minutes=10): loc = mdates.MinuteLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(minutes=30): loc = mdates.MinuteLocator(byminute=range(0,60,5)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=1): loc = mdates.MinuteLocator(byminute=range(0,60,15)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=6): loc = mdates.HourLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=1): loc = mdates.HourLocator(byhour=range(0,24,3)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=3): loc = mdates.HourLocator(byhour=range(0,24,6)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(weeks=2): loc = mdates.DayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=12): loc = mdates.WeekdayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=52): loc = mdates.MonthLocator() fmt = mdates.DateFormatter('%b') else: loc = mdates.MonthLocator(interval=3) fmt = mdates.DateFormatter('%b %Y') return loc,fmt Is there a better way of doing this?

    Read the article

< Previous Page | 419 420 421 422 423 424 425 426 427 428 429 430  | Next Page >