Search Results

Search found 15210 results on 609 pages for 'technical writing'.

Page 423/609 | < Previous Page | 419 420 421 422 423 424 425 426 427 428 429 430  | Next Page >

• Running commands though PHP/Perl scripts as a priviledged user on Linux.

  - by jtd

  Background: I am writing a script for a company that will allow users to create FTP accounts through a web interface. In the background, the script must run a bunch of commands: Add the user to the system (useradd) Open and edit various files mail the user via sendmail and a few other things... I'm basically looking for the most secure way of doing this. I've heard of the setuid method, the sudo method, and of course, running httpd as a priviledged user. There will be sanity checks on the data entered of course before any commands are executed (ie. only alphanumeric characters in usernames) What is the method used by the popular scripts out there (webmin for example), as it must be fairly secure?

  Read the article

• C++ IDE for OSX

  - by gprime

  When i was at university i wrote a lot of C++. I primarily used either Visual Studio (at the time it was version 6) or VIM (if i was on linux) as an editor to write my code. Since i have graduate and have been working primarily in web programming i have stopped writing C++. Since i graduated i have also bought myself and started using my Mac exclusively. I am now starting to get back to my C++ coding (just for fun) and would like an opinion on good IDE's for Mac. I am currently using xCode which seems kinda cool because it has everything built into it. Do any of you have any other IDE's that you would suggest that i give a shot or should i just stick to xCode?

  Read the article

• How to trigger Mouse-Over on iPhone?

  - by Andrew

  This might seem like a really dumb question, but I am writing an application and I have come across where my mouse-over, mouse-click and mouse-hover need different events bound to them. Now on Internet Explorer, Firefox, and Safari. It all works as expected. However, on my iPhone the actions will not trigger. Now my question is are their any specific ways I can have the Mouse-Over essentially be fired when I hold my finger down and trigger an event? An example where this doesn't work is right on this website when you hover over a comment it is supposed to display the +1 or flag icon. I am using jquery.

  Read the article

• How to read, edit and write xls files, and then export to SQL Server

  - by tuanvt

  I have an excel file that have the list of contacts( about 10 k of them) that I need to push into my SQL Server database. So, I am writing an .net windows program using visual studio 2008 to read the files, generate random password for each contact, and then push these information in to my SQL Server database. It was easy to handle excel file in 2003 but now my computer have office 2007 in it and things seem to changed. I am digging on Microsoft.Office.Interop.Excel but it is seem to be a lot more complicated than before.

  Read the article

• In web project can we write core services layer without knowledge of UI ?

  - by Silent Warrior

  I am working on web project. We are using flex as UI layer. My question is often we are writing core service layer separately from web/UI layer so we can reuse same services for different UI layer/technology. So practically is it possible to reuse same core layer services without any changes/addition in API with different kind of UI technologies/layers. For e.g. same core service layer with UI technology which supports synchronized request response (e.g. jsp etc.) and non synchronize or event driven UI technology (e.g Ajax, Flex, GWT etc.) or with multiple devices like (computers, mobiles, pdas etc.). Personally I feel its very tough to write core service layer without any knowledge of UI. Looking for thoughts from other people.

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• How do I compare vectors in C++?

  - by Sam Phelps

  I am trying to compare two vector objects, and return a single vector containing all the chars which appear in both vectors. How would I go about this without writing some horribly complex manual method which compares every char in the first vector to every char in the second vector and using an if to add it to a third vector (which would be returned) if they match. Maybe my lack of real experience with vectors is making me imagine this will be harder than it really is, but I suspect there is some simplier way which I have been unable to find through searching.

  Read the article

• JQuery: After adding some AJAX, some of the jquery code no longer works

  - by fwaokda

  Here's a pastebin link to my entire jQuery code. [ http://pastebin.com/w57ma5Gx ] The "Thumbnails" section was working fine before I added the ajax sections. Anyone can help me with why it quit working? And if I need to I can post another question but figured I'd try it here first. Whats a better way of writing the ajax code where it executes once upon loading the page and then every time I click the $("a#next") link afterwards? Right now I just repasted the code outside of the next link and that works, but seems silly to have the same code in two different places like that. Thanks!

  Read the article

• .NET Regular Expressions - Shorter match

  - by Xavier

  Hi Guys, I have a question regarding .NET regular expressions and how it defines matches. I am writing: var regex = new Regex("<tr><td>1</td><td>(.+)</td><td>(.+)</td>"); if (regex.IsMatch(str)) { var groups = regex.Match(str).Groups; var matches = new List<string>(); for (int i = 1; i < groups.Count; i++) matches.Add(groups[i].Value); return matches; } What I want is get the content of the two following tags. Instead it returns: [0]: Cell 1</td><td>Cell 2</td>... [1]: Last row of the table Why is the first match taking </td> and the rest of the string instead of stopping at </td>?

  Read the article

• create logging so that the messages will be displayed on screen and logged to a file

  - by robUK

  Hello, gcc 4.4.4 c89 I am writing a client/server application. I have finished and now I want to implement some logging feature that will display log messages on the screen as well as log to a file. However, I don't want to display all log messages (warning, error, critical, unrecoverable, debug, etc). Maybe I can set so that it will display, just errors and debug messages and nothing else. For example, the user might not be interested in the debug messages. Is there any design-pattern that I can follow? What do you normally for for logging? Any tutorials out there that address logging? many thanks for any suggestions,

  Read the article

• networkstream always empty!

  - by ALEX

  hey I'm writing on an Server-Client program but when my client sends something, it never reaches my server! I'm sending like this: public void Send(string s) { char[] chars = s.ToCharArray(); byte[] bytes = chars.CharToByte(); nstream.Write(bytes, 0, bytes.Length); nstream.Flush(); } and Receiving in a background thread like this void CheckIncoming(object dd) { RecievedDelegate d = (RecievedDelegate)dd; try { while (true) { List<byte> bytelist = new List<byte>(); System.Threading.Thread.Sleep(1000); int ssss; ssss = nstream.ReadByte(); if (ssss > 1) { System.Diagnostics.Debugger.Break(); } if (bytelist.Count != 0) { d.Invoke(bytelist.ToArray()); } } } catch (Exception exp) { MSGBOX("ERROR:\n" + exp.Message); } } the ssss int is never 1 whats happening here???

  Read the article

• Selenium testing with checksums (md5)

  - by Peter

  I am new at selenium testing and am writing a bunch of tests for a webpage that relies heavily on javascript user interaction. At first I wrote a lot of assertions of the style If I press button A" then assert number of visible rows = x, assert checkboxes checked are such assert title = bar .... [20 more] and so on. Then I switched to checksumming the HTML using MD5: If I press button A" then assert md5(html) = 8548bccac94e35d9836f1fec0da8115c. And it made my life a whole lot easier... But is this a bad practice in any way?

  Read the article

• Are breakpoints introduce delay?

  - by kamilo

  How is that setting a breakpoint in my code allows the following code to complete which would fail otherwise. Here is the problem. I'm writing an add-on for SAP B1 and encountered following problem. When I load a form I would like to enter some values into the form' matrix. But without a breakpoint (set on a method in which loading a form takes place) the part of code that is executed afterwards will fail. That part of code is referencing a matrix that is not yet displayed which results in an exception. This is all clear. But why setting a breakpoint "solves" the problem. What is going on? I suspect that my breakpoint introduces some delay between loading and displaying my form and part of code that references element of that form but I could be wrong. Thanks in advance

  Read the article

• Language restrictions on iPhone lifted?

  - by John Smith

  Apparently Apple has changed some term in the agreement again. From http://www.appleoutsider.com/2010/06/10/hello-lua/ section 3.3.2 is now Unless otherwise approved by Apple in writing, no interpreted code may be downloaded or used in an Application except for code that is interpreted and run by Apple’s Documented APIs and built-in interpreter(s). Notwithstanding the foregoing, with Apple’s prior written consent, an Application may use embedded interpreted code in a limited way if such use is solely for providing minor features or functionality that are consistent with the intended and advertised purpose of the Application. instead of the original No interpreted code may be downloaded or used in an Application except for code that is interpreted and run by Apple’s Documented APIs and built-in interpreter(s). I am more interested in embedding Lua, but other people have other embeddings they want to make. I am wondering how you ask for permission, and what they mean by the terms "minor features" and "consistent" and how will Apple interpret this section? It seems to have enough loopholes to drive a real firetruck through.

  Read the article

• Facebook action and object submission

  - by tijanja

  Am new to Facebook sdk and i want to use it in my project (blackberry app) has the developer i tried writing to my timeline with the code blow through a web service and i was able to write to my timeline, my question is this must i create an action and object that must be submitted for approval before other users can use my app to write to their timeline? because permission are not granted when users try to write to their timeline. $ret_obj = $facebook->api('/me/feed', 'POST',array('link' => 'www.****.com','message' => $user_profile["name"].' just downloaded W1')); echo '<pre>Post ID: ' . $ret_obj['id'] . '</pre>';

  Read the article

• PHP preg_match Math Function

  - by Matt

  I'm writing a script that will allow a user to input a string that is a math statement, to then be evaluated. I however have hit a roadblock. I cannot figure out how, using preg_match, to dissallow statements that have variables in them. Using this, $calc = create_function("", "return (" . $string . ");" ); $calc();, allows users to input a string that will be evaluated, but it crashes whenever something like echo 'foo'; is put in place of the variable $string.

  Read the article

• Ruby Hash.merge with specified keys only

  - by ba

  I'm pretty sure I saw on a Rails related site something along the lines of: def my_function(*opts) opts.require_keys(:first, :second, :third) end And if one of the keys in require_keys weren't specified, or if there were keys that weren't specified, an exception was raised. I've been looking through ActiveSupport and I guess I might be looking for something like the inverse of except. I like to try and use as much of the framework as possible compared to writing my own code, that's the reason I'm asking when I know how to make the same functionality on my own. :) At the moment I'm doing it through the normal merge routine and making sure that I have what I need with some IFs.

  Read the article

• Is there a way in C# 4.0 to have a method take a delegate with the parameters baked in?

  - by Rob Packwood

  I have this code for reporting on a simple demo app I am writing: private static void ReportOnTimedProcess(Action process) { var stopwatch = new Stopwatch(); stopwatch.Start(); process(); stopwatch.Stop(); Console.WriteLine("Process took {0} seconds", stopwatch.ElapsedMilliseconds*1000); } I basically want to track the time of any process. I am trying to have this method take a delegate as a parameter that can have any number of varying parameters. Is there some way an Expression can do this?

  Read the article

• How to properly design a simple favorites and blocked table?

  - by Nils Riedemann

  Hey, i am currently writing a webapp in rails where users can mark items as favorites and also block them. I came up two ways and wondered which one is more common/better way. 1. Separate join tables Would it be wise to have 2 tables for this? Like: users_favorites - user_id - item_id users_blocked - user_id - item_id 2. single table users_marks (or so) - users_id - item_id - type (["fav", "blk"]) Both ways seem to have advantages. Which one would you use and why?

  Read the article

• Speed of interpolation algorithms, C# and C++ working together.

  - by Kaminari

  Hello. I need fast implementation of popular interpolation algorithms. I figured it out that C# in such simple algorithms will be much slower than C++ so i think of writing some native code and using it in my C# GUI. First of all i run some tests and few operations on 1024x1024x3 matrix took 32ms in C# and 4ms in C++ and that's what i basicly need. Interpolation however is not a good word because i need them only for downscaling. But the question is: Will it be faster than C# methods in Drawing2D Image outputImage = new Bitmap(destWidth, destHeight, PixelFormat.Format24bppRgb); Graphics grPhoto = Graphics.FromImage(outputImage); grPhoto.InterpolationMode = InterpolationMode.*; //all of them grPhoto.DrawImage(bmp, new Rectangle(0, 0, destWidth, destHeight), Rectangle(0, 0, sourceWidth, sourceHeight), GraphicsUnit.Pixel); grPhoto.Dispose(); Some of these method run in 20ms and some in 80. Is there a way to do it faster?

  Read the article

• Performance when accessing class members

  - by Dr. Acula

  I'm writing something performance-critical and wanted to know if it could make a difference if I use: int test( int a, int b, int c ) { // Do millions of calculations with a, b, c } or class myStorage { public: int a, b, c; }; int test( myStorage values ) { // Do millions of calculations with values.a, values.b, values.c } Does this basically result in similar code? Is there an extra overhead of accessing the class members? I'm sure that this is clear to an expert in C++ so I won't try and write an unrealistic benchmark for it right now

  Read the article

• SWIG interface file questions

  - by morpheous

  I am writing a C/C++ extension module for other languages and I am using SWIG to generate the bindings. I have two questions Can I include more than 1 header file in the declaration part of the interface file e.g.: /* Declarations exposed to wrapper: */ > %{ > #define SWIG_FILE_WITH_INIT > #include "a.h" > #include "b.h" > #include "c.h" %} In all of the examples I have seen so far, after the header include declaration (as shown above), the functions declared in the header are then declared again in the interface file. Is this really necessary, as it means there are two copies of the function declarations that need to be maintained. Note: I can appreciate that some functions/methods declaration may need to be 'decorated' with the 'newobject' declaration so these obviously need to be in the interface file, to avoid memory leaks - however, I would have though that it would be sufficient to include the headers and then ONLY the declarations of the functions/methods that need to be declared with 'newobject' - is this recommended way of doing things?

  Read the article

• How to track conversion rate (clicks to sales) from an internal advertising system?

  - by Ed Woodcock

  I am currently writing an interal advertising system for a company client's website, where the adverts will only be seen by internal users, and all transactions take place internally to the site (i.e. the adverts are for member-only content available on the site). Does anyone have any recommendations as to the best way to track the conversion rate of these adverts (i.e. views:clicks:sales)? EDIT I'm not looking for a 'Why don't you use google analystics'-type answer, I'm looking into possible architecture outlines, i.e. a 'why don't use store a guid in a cache temporarily and see if it ties to the advert' kind of answer. /EDIT In a previous job I did something based on an internal cache, which simply did view:click tracking, however the addition of the sales rate makes this task more complex, especially if we take into account the idea that someone may click through to an advert and not purchase immediately. Cheers, Ed (N.B. I'm leaving this purposely vague in order to (hopefully) get some answers that provide ideas I've yet to have thought of by coming at the problem from a different angle)

  Read the article

• how to remove error text from the email format checker code?

  - by rdesai

  I have been writing a code for validating forms using javascript/jquery. Following is a code snippet for checking email format. The problem is when I enter invalid email, it recognizes it, but when I go back to this field and enter correct email, the error text still stays even though I have used the 'else' part. How do I remove the error text in this case? if(e1.value!=''){ var emailRegEx = /^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i; if (document.signupForm.email1.value.search(emailRegEx) == -1) { $("#err_email1").html("Please enter valid email address."); } status=0; } else{ $("#err_email1").html(""); status=1; }

  Read the article

• Strings - Filling In Leading Zeros Wtih A Zero

  - by headscratch

  I'm reading an array of hard-coded strings of numeric characters - all positions are filled with a character, even for the leading zeros. Thus, can confidently parse it using substring(start, end) to convert to numeric. Example: "0123 0456 0789" However, a string coming from a database does not fill in the leading zero with a 'zero character', it simply fetches the '123 456 789', which is correct for an arithmetic number but not for my needs and makes for parsing trouble. Before writing conditionals to check for leading zeros and adding them to the string if needed, is there a simple way of specifying they be filled with a character ? I'm not finding this in my Java book... I could have done the three conditionals in the time it took to post this but, this is more about 'education'... Thanks

  Read the article

< Previous Page | 419 420 421 422 423 424 425 426 427 428 429 430  | Next Page >