Search Results

Search found 11529 results on 462 pages for 'rvalue reference'.

Page 424/462 | < Previous Page | 420 421 422 423 424 425 426 427 428 429 430 431  | Next Page >

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

  • manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • Pass param to a silverlight application

    - by Lucas_Santos
    In my javascript I create my <OBJECT> tag var htmlEmbedSilverlight = "<div id='silverlightControlHost'> " + "<object data='data:application/x-silverlight-2,' type='application/x-silverlight-2' width='550px' height='250px'> " + "<param name='source' value='../../ClientBin/FotoEmprestimoChave.xap'/> " + "<param name='onError' value='onSilverlightError' /> " + "<param name='background' value='white' /> " + "<param name='minRuntimeVersion' value='4.0.60310.0' /> " + "<param name='autoUpgrade' value='true' /> " + "<param name='initparams' values='chave_id=" + data + "' /> " + "<a href='http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0' style='text-decoration:none'> " + "<img src='http://go.microsoft.com/fwlink/?LinkId=161376' alt='Get Microsoft Silverlight' style='border-style:none'/> " + "</a> " + "</object><iframe id='_sl_historyFrame' style='visibility:hidden;height:0px;width:0px;border:0px'></iframe></div>"; $("#tiraFotoSilverlight").html(htmlEmbedSilverlight); This is a reference to my Silverlight application where I call in my Web Application. The problem is my <param name='initparams' values='chave_id=" + data + "' /> " because in my App.xaml in Silverlight, I have the code below private void Application_Startup(object sender, StartupEventArgs e) { if (e.InitParams != null) { foreach (var item in e.InitParams) { this.Resources.Add(item.Key, item.Value); } } this.RootVisual = new MainPage(); } Where InitParams always has Count = 0 and I don't know why. Can someone help me ? I'm just trying to pass a value to my Silverlight application, without a PostBack. Rendered <object width="550px" height="250px" type="application/x-silverlight-2" data="data:application/x-silverlight-2,"> <param value="../../ClientBin/FotoEmprestimoChave.xap" name="source"> <param value="onSilverlightError" name="onError"> <param value="white" name="background"> <param value="4.0.60310.0" name="minRuntimeVersion"> <param value="true" name="autoUpgrade"> <param values="chave_id=1" name="initparams"> <a style="text-decoration:none" href="http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0"> </object>

    Read the article

  • Inserting a string array as a row into an Excel document using the Open XML SDK 2.0

    - by Sam
    The code runs, but corrupts my excel document. Any help would be mucho appreciated! I used this as a reference. public void AddRow(string fileName, string[] values) { using (SpreadsheetDocument doc = SpreadsheetDocument.Open(fileName, true)) { SharedStringTablePart sharedStringPart = GetSharedStringPart(doc); WorksheetPart worksheetPart = doc.WorkbookPart.WorksheetParts.First(); uint rowIdx = AppendRow(worksheetPart); for (int i = 0; i < values.Length; ++i) { int stringIdx = InsertSharedString(values[i], sharedStringPart); Cell cell = InsertCell(i, rowIdx, worksheetPart); cell.CellValue = new CellValue(stringIdx.ToString()); cell.DataType = new EnumValue<CellValues>( CellValues.SharedString); worksheetPart.Worksheet.Save(); } } } private SharedStringTablePart GetSharedStringPart( SpreadsheetDocument doc) { if (doc.WorkbookPart. GetPartsCountOfType<SharedStringTablePart>() > 0) return doc.WorkbookPart. GetPartsOfType<SharedStringTablePart>().First(); else return doc.WorkbookPart. AddNewPart<SharedStringTablePart>(); } private uint AppendRow(WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); uint rowIndex = (uint)sheetData.Elements<Row>().Count(); Row row = new Row() { RowIndex = rowIndex }; sheetData.Append(row); return rowIndex; } private int InsertSharedString(string s, SharedStringTablePart sharedStringPart) { if (sharedStringPart.SharedStringTable == null) sharedStringPart.SharedStringTable = new SharedStringTable(); int i = 0; foreach (SharedStringItem item in sharedStringPart.SharedStringTable. Elements<SharedStringItem>()) { if (item.InnerText == s) return i; ++i; } sharedStringPart.SharedStringTable.AppendChild( new Text(s)); sharedStringPart.SharedStringTable.Save(); return i; } private Cell InsertCell(int i, uint rowIdx, WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); string cellReference = AlphabetMap.Instance[i] + rowIdx; Cell cell = new Cell() { CellReference = cellReference }; Row row = sheetData.Elements<Row>().ElementAt((int)rowIdx); row.InsertAt(cell, i); worksheetPart.Worksheet.Save(); return cell; }

    Read the article

  • One Controller is Sometimes Bound Twice with Ninject

    - by Dusda
    I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

    Read the article

  • What is the best practice to segment c#.net projects based on a single base project

    - by Anthony
    Honestly, I can't word my question any better without describing it. I have a base project (with all its glory, dlls, resources etc) which is a CMS. I need to use this project as a base for othe custom bake projects. This base project is to be maintained and updated among all custom bake projects. I use subversion (Collabnet and Tortise SVN) I have two questions: 1 - Can I use subversion to share the base project among other projects What I mean here is can I "Checkout" the base project into another "Checked Out" project and have both update and commit seperatley. So, to paint a picture, let's say I am working on a custom project and I modify the core/base prject in some way (which I know will suit the others) can I then commit those changes and upon doing so when I update the base project in the other "Checked out" resources will it pull the changes? In short, I would like not to have to manually deploy updated core files whenever I make changes into each seperate project. 2 - If I create a custom file (let's say an webcontrol or aspx page etc) can I have it compile seperatley from the base project Another tricky one to explain. When I publish my web application it creates DLLs based on the namespaces of projects attached to it. So I may have a number of DLLs including the "Website's" namespace DLL, which could simply be website. I want to be able to make a seperate, custom, control which does not compile into those DLLs as the custom files should not rely on those DLLS to run. Is it as simple to set a seperate namespace for those files like CustomFiles.ProjectName for example? Think of the whole idea as adding modules to the .NET project, I don't want the module's code in any of the core DLLs but I do need for module to be able to access the core dlls. (There is no need for the core project to access the module code as it should be one way only in theory, though I reckon it woould not be possible anyway without using JSON/SOAP or something like that, maybe I am wrong.) I want to create a pluggable environment much like that of Joomla/Wordpress as since PHP generally doesn't have to be compiled first I see this is the reason why all this is possible/easy. The idea is to allow pluggable themes, modules etc etc. (I haven't tried simply adding .NET themes after compile/publish but I am assuming this is possible anyway? OR does the compiler need to reference items in the files?)

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

  • Need Google Map InfoWindow Hyperlink to Open Content in Overlay (Fusion Table Usage)

    - by McKev
    I have the following code established to render the map in my site. When the map is clicked, the info window pops up with a bunch of content including a hyperlink to open up a website with a form in it. I would like to utilize a function like fancybox to open up this link "form" in an overlay. I have read that fancybox doesn't support calling the function from within an iframe, and was wondering if there was a way to pass the link data to the DOM and trigger the fancybox (or another overlay option) in another way? Maybe a callback trick - any tips would be much appreciated! <style> #map-canvas { width:850px; height:600px; } </style> <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=true"></script> <script src="http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/src/fusiontips.js" type="text/javascript"></script> <script type="text/javascript"> var map; var tableid = "1nDFsxuYxr54viD_fuH7fGm1QRZRdcxFKbSwwRjk"; var layer; var initialLocation; var browserSupportFlag = new Boolean(); var uscenter = new google.maps.LatLng(37.6970, -91.8096); function initialize() { map = new google.maps.Map(document.getElementById('map-canvas'), { zoom: 4, mapTypeId: google.maps.MapTypeId.ROADMAP }); layer = new google.maps.FusionTablesLayer({ query: { select: "'Geometry'", from: tableid }, map: map }); //http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/docs/reference.html layer.enableMapTips({ select: "'Contact Name','Contact Title','Contact Location','Contact Phone'", from: tableid, geometryColumn: 'Geometry', suppressMapTips: false, delay: 500, tolerance: 8 }); ; // Try W3C Geolocation (Preferred) if(navigator.geolocation) { browserSupportFlag = true; navigator.geolocation.getCurrentPosition(function(position) { initialLocation = new google.maps.LatLng(position.coords.latitude,position.coords.longitude); map.setCenter(initialLocation); //Custom Marker var pinColor = "A83C0A"; var pinImage = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_letter&chld=%E2%80%A2|" + pinColor, new google.maps.Size(21, 34), new google.maps.Point(0,0), new google.maps.Point(10, 34)); var pinShadow = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_shadow", new google.maps.Size(40, 37), new google.maps.Point(0, 0), new google.maps.Point(12, 35)); new google.maps.Marker({ position: initialLocation, map: map, icon: pinImage, shadow: pinShadow }); }, function() { handleNoGeolocation(browserSupportFlag); }); } // Browser doesn't support Geolocation else { browserSupportFlag = false; handleNoGeolocation(browserSupportFlag); } function handleNoGeolocation(errorFlag) { if (errorFlag == true) { //Geolocation service failed initialLocation = uscenter; } else { //Browser doesn't support geolocation initialLocation = uscenter; } map.setCenter(initialLocation); } } google.maps.event.addDomListener(window, 'load', initialize); </script>

    Read the article

  • What is GC holes?

    - by tianyi
    I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

    Read the article

  • Saving JQuery Draggable Sitemap Values Correctly

    - by mdolon
    I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

    Read the article

  • NHibernate and objects with value-semantics

    - by Groo
    Problem: If I pass a class with value semantics (Equals method overridden) to NHibernate, NHibernate tries to save it to db even though it just saved an entity equal by value (but not by reference) to the database. What am I doing wrong? Here is a simplified example model for my problem: Let's say I have a Person entity and a City entity. One thread (producer) is creating new Person objects which belong to a specific existing City, and another thread (consumer) is saving them to a repository (using NHibernate as DAL). Since there is lot of objects being flushed at a time, I am using Guid.Comb id's to ensure that each insert is made using a single SQL command. City is an object with value-type semantics (equal by name only -- for this example purposes only): public class City : IEquatable<City> { public virtual Guid Id { get; private set; } public virtual string Name { get; set; } public virtual bool Equals(City other) { if (other == null) return false; return this.Name == other.Name; } public override bool Equals(object obj) { return Equals(obj as City); } public override int GetHashCode() { return this.Name.GetHashCode(); } } Fluent NH mapping is something like: public class PersonMap : ClassMap<Person> { public PersonMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); References(x => x.City) .Cascade.SaveUpdate(); } } public class CityMap : ClassMap<City> { public CityMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); Map(x => x.Name); } } Right now (with my current NHibernate mapping config), my consumer thread maintains a dictionary of cities and replaces their references in incoming person objects (otherwise NHibernate will see a new, non-cached City object and try to save it as well), and I need to do it for every produced Person object. Since I have implemented City class to behave like a value type, I hoped that NHibernate would compare Cities by value and not try to save them each time -- i.e. I would only need to do a lookup once per session and not care about them anymore. Is this possible, and if yes, what am I doing wrong here?

    Read the article

  • How do you programmatically set a Style on a View?

    - by Greg
    I would like to do something like this: <Button android:id="@+id/button" android:layout_width="wrap_content" android:layout_height="wrap_cotent" style="@style/SubmitButtonType" /> But in code The xml approach works fine provided that SubmitButtonType is defined. Now what I assume happens is that the appt parser runs through this xml, generates an AttributeSet. That AttributeSet when passed to context/theme#obtainStyledAttributes() will have the style ref mask anything that is not written inline in this tag. Great that's fine! Now how do we do this programmatically. Button, as well as other View types, has a constructor that has the form: <Widget>(Context context, AttributeSet set, int defStyle). So I thought this would work. Button button = new Button(context, null, R.style.SubmitButtonType); However, I am finding that defStyle is badly documented as it really should be written to be a resourceId to an attribute (from R.attrs) that will be passed to obtainStyledAttributes() as the attribute resource, and not the style resource. After looking at the code, all the view implementations seem to pass 0 as the styleRef. I don't see the harm in having it passed as both the attr and the style resource (more flexible and negligible overhead) However I might be approaching this all wrong. How do you do this in code then other than by setting each individual element of the style to the specific widget you want to style (only possible by looking a the code to see what param maps to which method or set of methods). The only way I have found to do this is: <declare-styleable> <attr name="totallyAdhoc_attribute_just_for_this_case" format="reference"> </declare-styleable> <style name="MyAlreadyExistantTheme" > ... ... <item name="totallyAdhoc_attribute_just_for_this_case">@style/SubmitButtonType</item> </style> And instead of passing R.style.SubmitButtonType as defStyle, I pass the new R.attr.totallyAdhoc_attribute_just_for_this_case. Button button = new Button(context, null, R.attr.totallyAdhoc_attribute_just_for_this_case); This works but sounds way too complicated.

    Read the article

  • cellForRowAtIndexPath called too late

    - by Mihai Fonoage
    Hi, I am trying to re-load a table every time some data I get from the web is available. This is what I have: SearchDataViewController: - (void)parseDatatXML { parsingDelegate = [[XMLParsingDelegate alloc] init]; parsingDelegate.searchDataController = self; // CONTAINS THE TABLE THAT NEEDS RE-LOADING; ImplementedSearchViewController *searchController = [[ImplementedSearchViewController alloc] initWithNibName:@"ImplementedSearchView" bundle:nil]; ProjectAppDelegate *delegate = [[UIApplication sharedApplication] delegate]; UINavigationController *nav = (UINavigationController *)[delegate.splitViewController.viewControllers objectAtIndex: 0]; NSArray *viewControllers = [[NSArray alloc] initWithObjects:nav, searchController, nil]; self.splitViewController.viewControllers = viewControllers; [viewControllers release]; // PASS A REFERENCE TO THE PARSING DELEGATE SO THAT IT CAN CALL reloadData on the table parsingDelegate.searchViewController = searchController; [searchController release]; // Build the url request used to fetch data ... NSURLRequest *dataURLRequest = [NSURLRequest requestWithURL:[NSURL URLWithString:dataURL]]; parsingDelegate.feedConnection = [[[NSURLConnection alloc] initWithRequest:dataURLRequest delegate:parsingDelegate] autorelease]; } ImplementedSearchViewController: - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { NSLog(@"count = %d", [keys count]); // keys IS A NSMutableArray return [self.keys count]; } - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { ... cell.textLabel.text = [keys objectAtIndex:row]; ... } XMLParsingDelgate: -(void) updateSearchTable:(NSArray *)array { ... [self.currentParseBatch addObject:(NSString *)[array objectAtIndex:1]]; // RELOAD TABLE [self.searchViewController.table reloadData]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qualifiedName attributes:(NSDictionary *)attributeDict { if ([elementName isEqualToString:@"..."]) { self.currentParseBatch = [NSMutableArray array]; searchViewController.keys = self.currentParseBatch; ... } ... } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName { if ([elementName isEqualToString:@"..."]) { ... [self performSelectorOnMainThread:@selector(updateSearchTable:) withObject:array waitUntilDone:NO]; } ... } My problem is that when I debug, the calls go between reloadData and numberOfRowsInSection until the keys array is filled with the last data, time at which the cellForRowAtIndexPath gets called. I wanted the table to be updated for each element I send, one by one, instead of just in the end. Any ideas why this behavior? Thank you!

    Read the article

  • ASP.Net / MySQL : Translating content into several languages

    - by philwilks
    I have an ASP.Net website which uses a MySQL database for the back end. The website is an English e-commerce system, and we are looking at the possibility of translating it into about five other languages (French, Spanish etc). We will be getting human translators to perform the translation - we've looked at automated services but these aren't good enough. The static text on the site (e.g. headings, buttons etc) can easily be served up in multiple languages via .Net's built in localization features (resx files etc). The thing that I'm not so sure about it how best to store and retrieve the multi-language content in the database. For example, there is a products table that includes these fields... productId (int) categoryId (int) title (varchar) summary (varchar) description (text) features (text) The title, summary, description and features text would need to be available in all the different languages. Here are the two options that I've come up with... Create additional field for each language For example we could have titleEn, titleFr, titleEs etc for all the languages, and repeat this for all text columns. We would then adapt our code to use the appropriate field depending on the language selected. This feels a bit hacky, and also would lead to some very large tables. Also, if we wanted to add additional languages in the future it would be time consuming to add even more columns. Use a lookup table We could create a new table with the following format... textId | languageId | content ------------------------------- 10 | EN | Car 10 | FR | Voiture 10 | ES | Coche 11 | EN | Bike 11 | FR | Vélo We'd then adapt our products table to reference the appropriate textId for the title, summary, description and features instead of having the text stored in the product table. This seems much more elegant, but I can't think of a simple way of getting this data out of the database and onto the page without using complex SQL statements. Of course adding new languages in the future would be very simple compared to the previous option. I'd be very grateful for any suggestions about the best way to achieve this! Is there any "best practice" guidance out there? Has anyone done this before?

    Read the article

  • Select latest group by in nhibernate

    - by Kendrick
    I have Canine and CanineHandler objects in my application. The CanineHandler object has a PersonID (which references a completely different database), an EffectiveDate (which specifies when a handler started with the canine), and a FK reference to the Canine (CanineID). Given a specific PersonID, I want to find all canines they're currently responsible for. The (simplified) query I'd use in SQL would be: Select Canine.* from Canine inner join CanineHandler on(CanineHandler.CanineID=Canine.CanineID) inner join (select CanineID,Max(EffectiveDate) MaxEffectiveDate from caninehandler group by CanineID) as CurrentHandler on(CurrentHandler.CanineID=CanineHandler.CanineID and CurrentHandler.MaxEffectiveDate=CanineHandler.EffectiveDate) where CanineHandler.HandlerPersonID=@PersonID Edit: Added mapping files below: <class name="CanineHandler" table="CanineHandler" schema="dbo"> <id name="CanineHandlerID" type="Int32"> <generator class="identity" /> </id> <property name="EffectiveDate" type="DateTime" precision="16" not-null="true" /> <property name="HandlerPersonID" type="Int64" precision="19" not-null="true" /> <many-to-one name="Canine" class="Canine" column="CanineID" not-null="true" access="field.camelcase-underscore" /> </class> <class name="Canine" table="Canine"> <id name="CanineID" type="Int32"> <generator class="identity" /> </id> <property name="Name" type="String" length="64" not-null="true" /> ... <set name="CanineHandlers" table="CanineHandler" inverse="true" order-by="EffectiveDate desc" cascade="save-update" access="field.camelcase-underscore"> <key column="CanineID" /> <one-to-many class="CanineHandler" /> </set> <property name="IsDeleted" type="Boolean" not-null="true" /> </class> I haven't tried yet, but I'm guessing I could do this in HQL. I haven't had to write anything in HQL yet, so I'll have to tackle that eventually anyway, but my question is whether/how I can do this sub-query with the criterion/subqueries objects. I got as far as creating the following detached criteria: DetachedCriteria effectiveHandlers = DetachedCriteria.For<Canine>() .SetProjection(Projections.ProjectionList() .Add(Projections.Max("EffectiveDate"),"MaxEffectiveDate") .Add(Projections.GroupProperty("CanineID"),"handledCanineID") ); but I can't figure out how to do the inner join. If I do this: Session.CreateCriteria<Canine>() .CreateCriteria("CanineHandler", "handler", NHibernate.SqlCommand.JoinType.InnerJoin) .List<Canine>(); I get an error "could not resolve property: CanineHandler of: OPS.CanineApp.Model.Canine". Obviously I'm missing something(s) but from the documentation I got the impression that should return a list of Canines that have handlers (possibly with duplicates). Until I can make this work, adding the subquery isn't going to work... I've found similar questions, such as http://stackoverflow.com/questions/747382/only-get-latest-results-using-nhibernate but none of the answers really seem to apply with the kind of direct result I'm looking for. Any help or suggestion is greatly appreciated.

    Read the article

  • NSNotifications vs delegate for multiple instances of same protocol

    - by Brent Traut
    I could use some architectural advice. I've run into the following problem a few times now and I've never found a truly elegant way to solve it. The issue, described at the highest level possible:I have a parent class that would like to act as the delegate for multiple children (all using the same protocol), but when the children call methods on the parent, the parent no longer knows which child is making the call. I would like to use loose coupling (delegates/protocols or notifications) rather than direct calls. I don't need multiple handlers, so notifications seem like they might be overkill. To illustrate the problem, let me try a super-simplified example: I start with a parent view controller (and corresponding view). I create three child views and insert each of them into the parent view. I would like the parent view controller to be notified whenever the user touches one of the children. There are a few options to notify the parent: Define a protocol. The parent implements the protocol and sets itself as the delegate to each of the children. When the user touches a child view, its view controller calls its delegate (the parent). In this case, the parent is notified that a view is touched, but it doesn't know which one. Not good enough. Same as #1, but define the methods in the protocol to also pass some sort of identifier. When the child tells its delegate that it was touched, it also passes a pointer to itself. This way, the parent know exactly which view was touched. It just seems really strange for an object to pass a reference to itself. Use NSNotifications. The parent defines a separate method for each of the three children and then subscribes to the "viewWasTouched" notification for each of the three children as the notification sender. The children don't need to attach themselves to the user dictionary, but they do need to send the notification with a pointer to themselves as the scope. Same as #4, but rather than using separate methods, the parent could just use one with a switch case or other branching along with the notification's sender to determine which path to take. Create multiple man-in-the-middle classes that act as the delegates to the child views and then call methods on the parent either with a pointer to the child or with some other differentiating factor. This approach doesn't seem scalable. Are any of these approaches considered best practice? I can't say for sure, but it feels like I'm missing something more obvious/elegant.

    Read the article

  • Setting background-image with javascript

    - by Mattoe3k
    In chrome, safari, and opera setting the background image to an absolute reference such as: "/images/image.png" changes it to "http://sitepath/images/image.png". It does not do this in firefox. Is there any way to avoid this behavior, or is it written into the browser's javascript engine? Using jquery to set the background-image also does this problem. The problem is that I am posting the HTML to a php script that needs the urls in this specific format. I know that setting the image path relative fixes this, but I can't do that. The only other alternative would be to use a regexp. to convert the urls. Thanks. Test this in firefox, and chrome / webkit browser: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Untitled Document</title> </head> <body> <div style="height:400px;width:400px;background-image:url(/images/images/logo.gif);"> </div> <br /> <br /> <div id="test" style="height:400px;width:400px;"> </div> <script type="text/javascript" src="/javascripts/jquery.js"></script> <script type="text/javascript"> $(document).ready(function(){ $("#test").css('background-image',"url(/images/images/logo.gif)"); alert(document.getElementById('test').style.backgroundImage); }); </script> </body> </html>

    Read the article

  • DLL configuration file in asp.net site

    - by Tominator
    Hi, I've made a .net 2.0 librabry project, that results in a dll. I've made an app.config file in my project, with settings used in the dll, with the intention that they can be changed later. I'm attempting to use the dll in an asp.net web application now, so I made the reference to my other project's output, and I see that the dll is copied over to the site's bin folder, and everything works. However, the configuration file is not copied. When I manually copy the app.config and rename it to myDll.config, it has no influence. The contents of the config file is approximately this: <?xml version="1.0" encoding="utf-8" ?> <configuration> <configSections> <sectionGroup name="applicationSettings" type="System.Configuration.ApplicationSettingsGroup, System, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" > <section name="myDLL.My.MySettings" type="System.Configuration.ClientSettingsSection, System, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" requirePermission="false" /> </sectionGroup> </configSections> <applicationSettings> <myDLL.My.MySettings> <setting name="myDLL_webservice_Service" serializeAs="String"> <value>https://myhost/Service.asmx</value> </setting> <setting name="ID" serializeAs="String"> <value>6</value> </setting> </myDLL.My.MySettings> </applicationSettings> </configuration> And I use its settings in the dll with this (vb.net code): Private _id As Long = My.Settings.ID How can I put my config information somewhere so it can be used? In the web.config of the site application? That has only the appSettings section, and it uses the syntax. It doesn't appear to work though. In a custom file format that I create and use? Not that pretty..

    Read the article

  • jQuery - Sorting an array?

    - by Probocop
    Hi, I'm using Ajax to get some XML, and then filling in some fields on a form with the results. There is a numerical field on the form and I would like to sort the results by this number (highest first). How would I go about doing this in jQuery? My js function code is currently: function linkCounts() { ws_url = "http://archreport.epiphanydev2.co.uk/worker.php?query=linkcounts&domain="+$('#hidden_the_domain').val(); $.ajax({ type: "GET", url: ws_url, dataType: "xml", success: function(xmlIn){ results = xmlIn.getElementsByTagName("URL"); for ( var i = 0; i < results.length; i++ ) { $("#tb_domain_linkcount_url_"+(i+1)).val($(results[i].getElementsByTagName("Page")).text()); $("#tb_domain_linkcount_num_"+(i+1)).val($(results[i].getElementsByTagName("Links")).text()); } $('#img_linkcount_worked').attr("src","/images/worked.jpg"); }, error: function(){$('#img_linkcount_worked').attr("src","/images/failed.jpg");} }); } The Links tag is the one I'm wanting to sort it on. Thanks For reference the XML that's getting returned is like the following: <?xml version="1.0" encoding="utf-8" standalone="yes"?> <Response> <ResponseCode>1</ResponseCode> <ResponseStatus>OK</ResponseStatus> <ReportId>2</ReportId> <UrlChecked /> <MaxLinks>75</MaxLinks> <PagesFound>121</PagesFound> <URLs> <URL> <Page>http://www.epiphanysolutions.co.uk/blog</Page> <Links>78</Links> </URL> <URL> <Page>http://www.epiphanysolutions.co.uk/blog/</Page> <Links>78</Links> </URL> <URL> <Page>http://www.epiphanysolutions.co.uk/blog/author/daniel-peden/</Page> <Links>78</Links> </URL> <URL> <Page>http://www.epiphanysolutions.co.uk/blog/author/daniel-peden/page/2/</Page> <Links>78</Links> </URL> </URLS> </Response>

    Read the article

  • [C++] Multiple inheritance from template class

    - by Tom P.
    Hello, I'm having issues with multiple inheritance from different instantiations of the same template class. Specifically, I'm trying to do this: template <class T> class Base { public: Base() : obj(NULL) { } virtual ~Base() { if( obj != NULL ) delete obj; } template <class T> T* createBase() { obj = new T(); return obj; } protected: T* obj; }; class Something { // ... }; class SomethingElse { // ... }; class Derived : public Base<Something>, public Base<SomethingElse> { }; int main() { Derived* d = new Derived(); Something* smth1 = d->createBase<Something>(); SomethingElse* smth2 = d->createBase<SomethingElse>(); delete d; return 0; } When I try to compile the above code, I get the following errors: 1>[...](41) : error C2440: '=' : cannot convert from 'SomethingElse *' to 'Something *' 1> Types pointed to are unrelated; conversion requires reinterpret_cast, C-style cast or function-style cast 1> [...](71) : see reference to function template instantiation 'T *Base<Something>::createBase<SomethingElse>(void)' being compiled 1> with 1> [ 1> T=SomethingElse 1> ] 1>[...](43) : error C2440: 'return' : cannot convert from 'Something *' to 'SomethingElse *' 1> Types pointed to are unrelated; conversion requires reinterpret_cast, C-style cast or function-style cast The issue seems to be ambiguity due to member obj being inherited from both Base< Something and Base< SomethingElse , and I can work around it by disambiguating my calls to createBase: Something* smth1 = d->Base<Something>::createBase<Something>(); SomethingElse* smth2 = d->Base<SomethingElse>::createBase<SomethingElse>(); However, this solution is dreadfully impractical, syntactically speaking, and I'd prefer something more elegant. Moreover, I'm puzzled by the first error message. It seems to imply that there is an instantiation createBase< SomethingElse in Base< Something , but how is that even possible? Any information or advice regarding this issue would be much appreciated.

    Read the article

  • Robust way to save/load objects with dependencies?

    - by mrteacup
    I'm writing an Android game in Java and I need a robust way to save and load application state quickly. The question seems to apply to most OO languages. To understand what I need to save: I'm using a Strategy pattern to control my game entities. The idea is I have a very general Entity class which e.g. stores the location of a bullet/player/enemy and I then attach a Behaviour class that tells the entity how to act: class Entiy { float x; float y; Behavior b; } abstract class Behavior { void update(Entity e); {} // Move about at a constant speed class MoveBehavior extends Behavior { float speed; void update ... } // Chase after another entity class ChaseBehavior extends Behavior { Entity target; void update ... } // Perform two behaviours in sequence class CombineBehavior extends Behavior { Behaviour a, b; void update ... } Essentially, Entity objects are easy to save but Behaviour objects can have a semi-complex graph of dependencies between other Entity objects and other Behaviour objects. I also have cases where a Behaviour object is shared between entities. I'm willing to change my design to make saving/loading state easier, but the above design works really well for structuring the game. Anyway, the options I've considered are: Use Java serialization. This is meant to be really slow in Android (I'll profile it sometime). I'm worried about robustness when changes are made between versions however. Use something like JSON or XML. I'm not sure how I would cope with storing the dependencies between objects however. Would I have to give each object a unique ID and then use these IDs on loading to link the right objects together? I thought I could e.g. change the ChaseBehaviour to store a ID to an entity, instead of a reference, that would be used to look up the Entity before performing the behaviour. I'd rather avoid having to write lots of loading/saving code myself as I find it really easy to make mistakes (e.g. forgetting to save something, reading things out in the wrong order). Can anyone give me any tips on good formats to save to or class designs that make saving state easier?

    Read the article

  • Are there any platforms where using structure copy on an fd_set (for select() or pselect()) causes p

    - by Jonathan Leffler
    The select() and pselect() system calls modify their arguments (the 'struct fd_set *' arguments), so the input value tells the system which file descriptors to check and the return values tell the programmer which file descriptors are currently usable. If you are going to call them repeatedly for the same set of file descriptors, you need to ensure that you have a fresh copy of the descriptors for each call. The obvious way to do that is to use a structure copy: struct fd_set ref_set_rd; struct fd_set ref_set_wr; struct fd_set ref_set_er; ... ...code to set the reference fd_set_xx values... ... while (!done) { struct fd_set act_set_rd = ref_set_rd; struct fd_set act_set_wr = ref_set_wr; struct fd_set act_set_er = ref_set_er; int bits_set = select(max_fd, &act_set_rd, &act_set_wr, &act_set_er, &timeout); if (bits_set > 0) { ...process the output values of act_set_xx... } } My question: Are there any platforms where it is not safe to do a structure copy of the struct fd_set values as shown? I'm concerned lest there be hidden memory allocation or anything unexpected like that. (There are macros/functions FD_SET(), FD_CLR(), FD_ZERO() and FD_ISSET() to mask the internals from the application.) I can see that MacOS X (Darwin) is safe; other BSD-based systems are likely to be safe, therefore. You can help by documenting other systems that you know are safe in your answers. (I do have minor concerns about how well the struct fd_set would work with more than 8192 open file descriptors - the default maximum number of open files is only 256, but the maximum number is 'unlimited'. Also, since the structures are 1 KB, the copying code is not dreadfully efficient, but then running through a list of file descriptors to recreate the input mask on each cycle is not necessarily efficient either. Maybe you can't do select() when you have that many file descriptors open, though that is when you are most likely to need the functionality.) There's a related SO question - asking about 'poll() vs select()' which addresses a different set of issues from this question.

    Read the article

  • help with generating models from database for many to many in doctrine

    - by ajsie
    im using doctrine and i have set up some test tables to be generated into models: I want a many-to-many relationship models (3 tables converted into 3 models) (things are simplified to make the point clear) mysql tables: user: id INT // primary key name VARCHAR group: id INT // primary key name VARCHAR user_group: user_id INT // primary and foreign key to user.id group_id INT // primary and foreign key to group.id i thought that it would generate these models (from the documentation): // User.php class User extends Doctrine_Record { public function setTableDefinition() { $this->hasColumn('id'); $this->hasColumn('name); } public function setUp() { $this->hasMany('Group as Groups', array( 'refClass' => 'UserGroup', 'local' => 'user_id', 'foreign' => 'group_id' ) ); } } // Group.php class Group extends Doctrine_Record { public function setTableDefinition() { $this->hasColumn('id'); $this->hasColumn('name); } public function setUp() { $this->hasMany('User as Users', array( 'refClass' => 'UserGroup', 'local' => 'group_id', 'foreign' => 'user_id' ) ); } } // UserGroup.php class UserGroup extends Doctrine_Record { public function setTableDefinition() { $this->hasColumn('user_id') ); $this->hasColumn('group_id') ); } } but it generated this: // User.php abstract class BaseUser extends Doctrine_Record { public function setTableDefinition() { $this->hasColumn('id'); $this->hasColumn('name'); } public function setUp() { $this->hasMany('UserGroup', array( 'local' => 'id', 'foreign' => 'user_id')); } } // Group.php abstract class BaseGroup extends Doctrine_Record { public function setTableDefinition() { $this->hasColumn('id'); $this->hasColumn('name'); } public function setUp() { $this->hasMany('UserGroup', array( 'local' => 'id', 'foreign' => 'group_id')); } } // UserGroup.php abstract class BaseUserGroup extends Doctrine_Record { public function setTableDefinition() { $this->hasColumn('user_id'); $this->hasColumn('group_id'); } public function setUp() { $this->hasOne('User', array( 'local' => 'user_id', 'foreign' => 'id')); $this->hasOne('Group', array( 'local' => 'group_id', 'foreign' => 'id')); } } as you can see, there is no 'refClass' in the 'User' and 'Group' models pointing to the 'UserGroup'. the 'UserGroup' table in this case is just another table from Doctrine's perspective not a reference table. I've checked my table definitions in mysql. They are correct. user_group has 2 columns (primary keys and foreign keys), each one pointing to the primary key in either User or Group. But i want the standard many-to-many relationship models in Doctrine models. I'd appreciate some help. I have struggled to figure it out for a half day now. What is wrong? Thanks!

    Read the article

< Previous Page | 420 421 422 423 424 425 426 427 428 429 430 431  | Next Page >