Search Results

Search found 48020 results on 1921 pages for 'void return'.

Page 436/1921 | < Previous Page | 432 433 434 435 436 437 438 439 440 441 442 443  | Next Page >

  • How to properly downcast in C# with a SWIG generated interface?

    - by JG
    I've got a very large and mature C++ code base that I'm trying to use SWIG on to generate a C# interface for. I cannot change the actual C++ code itself but we can use whatever SWIG offers in the way of extending/updating it. I'm facing an issue where a function C++ is written as such: A* SomeClass::next(A*) The caller might do something like: A* acurr = 0; while( (acurr = sc->next(acurr)) != 0 ){ if( acurr isoftype B ){ B* b = (B*)a; ...do some stuff with b.. } elseif( acurr isoftype C ) ... } Essentially, iterating through a container elements that depending on their true type, do something different. The SWIG generated C# layer for the "next" function unfortunately does the following: return new A(); So the calling code in C# land cannot determine if the returned object is actually a derived class or not, it actually appears to always be the base class (which does make sense). I've come across several solutions: Use the %extend SWIG keyword to add a method on an object and ultimately call dynamic_cast. The downside to this approach, as I see it, is that this requires you to know the inheritance hierarchy. In my case it is rather huge and I see this is as a maintenance issue. Use the %factory keyword to supply the method and the derived types and have SWIG automatically generate the dynamic_cast code. This appears to be a better solution that the first, however upon a deeper look it still requires you to hunt down all the methods and all the possible derived types it could return. Again, a huge maintenance issue. I wish I had a doc link for this but I can't find one. I found out about this functionality by looking through the example code that comes with SWIG. Create a C# method to create an instance of the derived object and transfer the cPtr to the new instance. While I consider this clumsy, it does work. See an example below. public static object castTo(object fromObj, Type toType) { object retval = null; BaseClass fromObj2 = fromObj as BaseClass; HandleRef hr = BaseClass.getCPtr(fromObj2); IntPtr cPtr = hr.Handle; object toObj = Activator.CreateInstance(toType, cPtr, false); // make sure it actually is what we think it is if (fromObj.GetType().IsInstanceOfType(toObj)) { return toObj; } return retval; } Are these really the options? And if I'm not willing to dig through all the existing functions and class derivations, then I'm left with #3? Any help would be appreciated.

    Read the article

  • Javascript AJAX function returns undefined instead of true / false

    - by Josh K
    I have a function that issues an AJAX call (via jQuery). In the complete section I have a function that says: complete: function(XMLHttpRequest, textStatus) { if(textStatus == "success") { return(true); } else { return(false); } } However, if I call this like so: if(callajax()) { // Do something } else { // Something else } The first is never called. If I put an alert(textStatus) in the complete function I get true, but not before that function returns undefined.

    Read the article

  • javascript add prototype method to all functions?

    - by salmane
    Is there a way to add a method to all javascript functions without using the prototype library? something along the lines of : Function.prototype.methodName = function(){ return dowhateverto(this) }; this is what i tried so far but it didnt work. Perhaps it is a bad idea also if so could you please tell me why? if so can I add it to a set of functions i choose something like : MyFunctions.prototype.methodName = function(){ return dowhateverto(this) }; where MyFunctions is an array of function names thank you

    Read the article

  • ui.datepicker.js form validation (solved)

    - by lena
    Hi, I'm using ui.datepicker.js and I want to validate the date field to make sure the user select a date. I have tried function allow_submit() { var f = document.all.frm; if (f.date.value == "") { jAlert("Please select a date"); return false; } //if return true; } and also have try if (f.date.value == "0000-00-00") { without succes Any clue?

    Read the article

  • Using MembershipCreateStatus in MVC

    - by Jemes
    How can I use the MembershipCreateStatus in my controller below to identify errors? My controller below creates a new user but I would like to catch any errors from CreateStatus and add the error to my modelstate. [HttpPost] public ActionResult CreateUser(user UserToCreate) { if (ModelState.IsValid) { // TODO: If the UserToCreate object is Valid we'll //Eventually want to save it in a database Membership.CreateUser(UserToCreate.Username, UserToCreate.Password, UserToCreate.Email); return Redirect("/"); } //Invalid - redisplay form with errors return View(UserToCreate); }

    Read the article

  • javascript function is not getting called onclick of hx:commant button

    - by Sunny Mate
    hi i have method called test() when iu click on the commandButton the method should get called but the method is not getting called my code is as follows method **function test() { alert('ss'); return "true"; }** and method calling is <hx:commandExButton type="submit" value="Search" styleClass="action2" id="searchButton" **onclick="return test();"** action="#{pc_WorkInProgressUserGrid.doSearchButtonAction}" immediate="true </hx:commandExButton> any suggestion would be helpful

    Read the article

  • A* algorithm works OK, but not perfectly. What's wrong?

    - by Bart van Heukelom
    This is my grid of nodes: I'm moving an object around on it using the A* pathfinding algorithm. It generally works OK, but it sometimes acts wrongly: When moving from 3 to 1, it correctly goes via 2. When going from 1 to 3 however, it goes via 4. When moving between 3 and 5, it goes via 4 in either direction instead of the shorter way via 6 What can be wrong? Here's my code (AS3): public static function getPath(from:Point, to:Point, grid:NodeGrid):PointLine { // get target node var target:NodeGridNode = grid.getClosestNodeObj(to.x, to.y); var backtrace:Map = new Map(); var openList:LinkedSet = new LinkedSet(); var closedList:LinkedSet = new LinkedSet(); // begin with first node openList.add(grid.getClosestNodeObj(from.x, from.y)); // start A* var curNode:NodeGridNode; while (openList.size != 0) { // pick a new current node if (openList.size == 1) { curNode = NodeGridNode(openList.first); } else { // find cheapest node in open list var minScore:Number = Number.MAX_VALUE; var minNext:NodeGridNode; openList.iterate(function(next:NodeGridNode, i:int):int { var score:Number = curNode.distanceTo(next) + next.distanceTo(target); if (score < minScore) { minScore = score; minNext = next; return LinkedSet.BREAK; } return 0; }); curNode = minNext; } // have not reached if (curNode == target) break; else { // move to closed openList.remove(curNode); closedList.add(curNode); // put connected nodes on open list for each (var adjNode:NodeGridNode in curNode.connects) { if (!openList.contains(adjNode) && !closedList.contains(adjNode)) { openList.add(adjNode); backtrace.put(adjNode, curNode); } } } } // make path var pathPoints:Vector.<Point> = new Vector.<Point>(); pathPoints.push(to); while(curNode != null) { pathPoints.unshift(curNode.location); curNode = backtrace.read(curNode); } pathPoints.unshift(from); return new PointLine(pathPoints); } NodeGridNode::distanceTo() public function distanceTo(o:NodeGridNode):Number { var dx:Number = location.x - o.location.x; var dy:Number = location.y - o.location.y; return Math.sqrt(dx*dx + dy*dy); }

    Read the article

  • Error in Print Function in Bubble Sort MIPS?

    - by m00nbeam360
    Sorry that this is such a long block of code, but do you see any obvious syntax errors in this? I feel like the problem is that the code isn't printing correctly since the sort and swap methods were from my textbook. Please help if you can! .data save: .word 1,2,4,2,5,6 size: .word 6 .text swap: sll $t1, $a1, 2 #shift bits by 2 add $t1, $a1, $t1 #set $t1 address to v[k] lw $t0, 0($t1) #load v[k] into t1 lw $t2, 4($t1) #load v[k+1] into t1 sw $t2, 0($t1) #swap addresses sw $t0, 4($t1) #swap addresses jr $ra #return sort: addi $sp, $sp, -20 #make enough room on the stack for five registers sw $ra, 16($sp) #save the return address on the stack sw $s3, 12($sp) #save $s3 on the stack sw $s2, 8($sp) #save Ss2 on the stack sw $s1, 4($sp) #save $s1 on the stack sw $s0, 0($sp) #save $s0 on the stack move $s2, $a0 #copy the parameter $a0 into $s2 (save $a0) move $s3, $a1 #copy the parameter $a1 into $s3 (save $a1) move $s0, $zero #start of for loop, i = 0 for1tst: slt $t0, $s0, $s3 #$t0 = 0 if $s0 S $s3 (i S n) beq $t0, $zero, exit1 #go to exit1 if $s0 S $s3 (i S n) addi $s1, $s0, -1 #j - i - 1 for2tst: slti $t0, $s1, 0 #$t0 = 1 if $s1 < 0 (j < 0) bne $t0, $zero, exit2 #$t0 = 1 if $s1 < 0 (j < 0) sll $t1, $s1, 2 #$t1 = j * 4 (shift by 2 bits) add $t2, $s2, $t1 #$t2 = v + (j*4) lw $t3, 0($t2) #$t3 = v[j] lw $t4, 4($t2) #$t4 = v[j+1] slt $t0, $t4, $t3 #$t0 = 0 if $t4 S $t3 beq $t0, $zero, exit2 #go to exit2 if $t4 S $t3 move $a0, $s2 #1st parameter of swap is v(old $a0) move $a1, $s1 #2nd parameter of swap is j jal swap #swap addi $s1, $s1, -1 j for2tst #jump to test of inner loop j print exit2: addi $s0, $s0, 1 #i = i + 1 j for1tst #jump to test of outer loop exit1: lw $s0, 0($sp) #restore $s0 from stack lw $s1, 4($sp) #resture $s1 from stack lw $s2, 8($sp) #restore $s2 from stack lw $s3, 12($sp) #restore $s3 from stack lw $ra, 16($sp) #restore $ra from stack addi $sp, $sp, 20 #restore stack pointer jr $ra #return to calling routine .data space:.asciiz " " # space to insert between numbers head: .asciiz "The sorted numbers are:\n" .text print:add $t0, $zero, $a0 # starting address of array add $t1, $zero, $a1 # initialize loop counter to array size la $a0, head # load address of print heading li $v0, 4 # specify Print String service syscall # print heading out: lw $a0, 0($t0) # load fibonacci number for syscall li $v0, 1 # specify Print Integer service syscall # print fibonacci number la $a0, space # load address of spacer for syscall li $v0, 4 # specify Print String service syscall # output string addi $t0, $t0, 4 # increment address addi $t1, $t1, -1 # decrement loop counter bgtz $t1, out # repeat if not finished jr $ra # return

    Read the article

  • asp.net mvc How to test controllers correctly

    - by Simon G
    Hi, I'm having difficulty testing controllers. Original my controller for testing looked something like this: SomethingController CreateSomethingController() { var somethingData = FakeSomethingData.CreateFakeData(); var fakeRepository = FakeRepository.Create(); var controller = new SomethingController(fakeRepository); return controller; } This works fine for the majority of testing until I got the Request.IsAjaxRequest() part of code. So then I had to mock up the HttpContext and HttpRequestBase. So my code then changed to look like: public class FakeHttpContext : HttpContextBase { bool _isAjaxRequest; public FakeHttpContext( bool isAjaxRequest = false ) { _isAjaxRequest = isAjaxRequest; } public override HttpRequestBase Request { get { string ajaxRequestHeader = ""; if ( _isAjaxRequest ) ajaxRequestHeader = "XMLHttpRequest"; var request = new Mock<HttpRequestBase>(); request.SetupGet( x => x.Headers ).Returns( new WebHeaderCollection { {"X-Requested-With", ajaxRequestHeader} } ); request.SetupGet( x => x["X-Requested-With"] ).Returns( ajaxRequestHeader ); return request.Object; } } private IPrincipal _user; public override IPrincipal User { get { if ( _user == null ) { _user = new FakePrincipal(); } return _user; } set { _user = value; } } } SomethingController CreateSomethingController() { var somethingData = FakeSomethingData.CreateFakeData(); var fakeRepository = FakeRepository.Create(); var controller = new SomethingController(fakeRepository); ControllerContext controllerContext = new ControllerContext( new FakeHttpContext( isAjaxRequest ), new RouteData(), controller ); controller.ControllerContext = controllerContext; return controller; } Now its got to that stage in my controller where I call Url.Route and Url is null. So it looks like I need to start mocking up routes for my controller. I seem to be spending more time googling on how to fake/mock objects and then debugging to make sure my fakes are correct than actual writing the test code. Is there an easier way in to test a controller? I've looked at the TestControllerBuilder from MvcContrib which helps with some of the issues but doesn't seem to do everything. Is there anything else available that will do the job and will let me concentrate on writing the tests rather than writing mocks? Thanks

    Read the article

  • C# Create Values in Registry Local Machine

    - by Shahmir Javaid
    This is not working for me: public bool createRegistry() { if (!registryExists()) { Microsoft.Win32.Registry.LocalMachine.CreateSubKey("Software\\xelo\\"); Microsoft.Win32.Registry.LocalMachine.OpenSubKey("Software\\xelo").SetValue("hostname", (string)hostname, Microsoft.Win32.RegistryValueKind.String); return true; } else { return updateRegistry(); } } The exception error is to do with Not Authorized to do this. Any Help would be apreaciated Exeption: System.UnauthorizedAccessException | "Cannot write to the registry key"

    Read the article

  • How do I read an attribute on a class at runtime?

    - by Zaff
    I am trying to create a generic method that will read an attribute on a class and return that value at runtime. How do would I do this? Note: DomainName attribute is of class DomainNameAttribute. [DomainName(“MyTable”)] Public class MyClass : DomianBase {} What I am trying to generate: //This should return “MyTable” String DomainNameValue = GetDomainName<MyClass>();

    Read the article

  • wcf message size causing permission issue

    - by Ferrell Carr
    silverlight 3.0 client wcf 3.0 VS.Net 2005 Web Site Win 2003 Server 50 column observable collection. return observable collection select top 975 * ... no problem return observable collection select * .... Issue On SL client after proxy.Get 50 col OC logon screen from win 2003 server pops up Mever makes it to the completed event.

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

  • Negate the null-coalescing operator

    - by jhunter
    I have a bunch of strings I need to use .Trim() on, but they can be null. It would be much more concise if I could do something like: string endString = startString !?? startString.Trim(); Basically return the part on the right if the part on the left is NOT null, otherwise just return the null value. I just ended up using the ternary operator, but is there anyway to use the null-coalescing operator for this purpose?

    Read the article

  • Python datetime to Unix timestamp

    - by Off Rhoden
    I have to create an "Expires" value 5 minutes in the future, but I have to supply it in UNIX Timestamp format. I have this so far, but it seems like a hack. def expires(): '''return a UNIX style timestamp representing 5 minutes from now''' epoch = datetime.datetime(1970, 1, 1) seconds_in_a_day = 60 * 60 * 24 five_minutes = datetime.timedelta(seconds=5*60) five_minutes_from_now = datetime.datetime.now() + five_minutes since_epoch = five_minutes_from_now - epoch return since_epoch.days * seconds_in_a_day + since_epoch.seconds Is there a module or function that does the timestamp conversion for me?

    Read the article

  • How to know the formatting of Excel Cell

    - by Sathish
    Is it possible to figure out the Format of Excel cell i know there is .NumberFormat but it returns the formatting but not the type... basically i need to know if it is custom then it should return custom and if it is currency it should return Currency or any other datatype Please help me

    Read the article

  • MVC Bootstrap: Autocomplete doesn't show properly

    - by kicked11
    I have a MVC website and it had a searchbox with autocomplete, now I changed the layout using bootstrap. But now the autocomplete isn't been shown correctly anymore. See the picture the suggestions are not shown right. the autocomplete goes through the text. I was fine before I used bootstrap. I am using a SQL server to get the data and this is js file (I'm not good at ajax, i took it from a tutorial I followed) $(function () { var ajaxFormSubmit = function () { var $form = $(this); var options = { url: $form.attr("action"), type: $form.attr("method"), data: $form.serialize() }; $.ajax(options).done(function (data) { var $target = $($form.attr("data-aptitude-target")); var $newHtml = $(data); $target.replaceWith($newHtml); $newHtml.show("slide", 200); }); return false; }; var submitAutocompleteForm = function (event, ui) { var $input = $(this); $input.val(ui.item.label); var $form = $input.parents("form:first"); $form.submit(); }; var createAutocomplete = function () { var $input = $(this); var options = { source: $input.attr("data-aptitude-autocomplete"), select: submitAutocompleteForm }; $input.autocomplete(options); }; $("form[data-aptituder-ajax='true']").submit(ajaxFormSubmit); $("input[data-aptitude-autocomplete]").each(createAutocomplete); }); this is the form in my view <form method="get" action="@Url.Action("Index")" data-aptitude-ajax="true" data-aptitude-target="#testList"> <input type="search" name="searchTerm" data-aptitude-autocomplete="@Url.Action("Autocomplete")" /> <input type="submit" value=Search /> And this is part of the controller of the view public ActionResult Autocomplete(string term) { var model = db.tests .Where(r => term == null || r.name.Contains(term)) .Select(r => new { label = r.name }); return Json(model, JsonRequestBehavior.AllowGet); } // // GET: /Test/ public ActionResult Index(string searchTerm = null) { var model = db.tests .Where(r => searchTerm == null || r.name.StartsWith(searchTerm)); if (Request.IsAjaxRequest()) { return PartialView("_Test", model); } return View(model); } I'm new to ajax as well as bootstrap 3. I got the searchfunction and autocomplete from a tutorial I followed. Anybody any idea on how to fix this, because it worked fine? Thanks in advance!

    Read the article

  • Generic linked list in c++

    - by itsaboy
    I have been struggling for too long a time now with a rather simple question about how to create a generic linked list in c++. The list should be able contain several types of structs, but each list will only contain one type of struct. The problem arises when I want to implement the getNode() function [see below], because then I have to specify which of the structs it should return. I have tried to substitute the structs with classes, where the getNode function returns a base class that is inherited by all the other classes, but it still does not do the trick, since the compiler does not allow the getNode function to return anything but the base class then. So here is some code snippet: typedef struct struct1 { int param1; (...) } struct1; typedef struct struct2 { double param1; (...) } struct2; typedef struct node { struct1 data; node* link; } node; class LinkedList { public: node *first; int nbrOfNodes; LinkedList(); void addNode(struct1); struct1 getNode(); bool isEmpty(); }; LinkedList::LinkedList() { first = NULL; nbrOfNodes = 0; } void LinkedList::addNode(struct1 newData) { if (nbrOfNodes == 0) { first = new node; first->data = newData; } else { node *it = first; for (int i = 0; i < nbrOfNodes; i++) { it = it->link; } node *newNode = new node; newNode->data = newData; it->link = newNode; } nbrOfNodes++; } bool LinkedList::isEmpty() { return !nbrOfNodes; } struct1 LinkedList::getNode() { param1 returnData = first->data; node* deleteNode = first; nbrOfNodes--; if (nbrOfNodes) first = deleteNode->link; delete deleteNode; return returnData; } So the question, put in one sentence, is as follows: How do I adjust the above linked list class so that it can also be used for struct2, without having to create a new almost identical list class for struct2 objects? As I said above, each instance of LinkedList will only deal with either struct1 or struct2. Grateful for hints or help

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Performing non-blocking requests? - Django

    - by RadiantHex
    Hi folks, I have been playing with other frameworks, such as NodeJS, lately. I love the possibility to return a response, and still being able to do further operations. e.g. def view(request): do_something() return HttpResponse() do_more_stuff() #not possible!!! Maybe Django already offers a way to perform operations after returning a request, if that is the case that would be great. Help would be very much appreciated! =D

    Read the article

  • Memory management with Objective-C Distributed Objects: my temporary instances live forever!

    - by jkp
    I'm playing with Objective-C Distributed Objects and I'm having some problems understanding how memory management works under the system. The example given below illustrates my problem: Protocol.h #import <Foundation/Foundation.h> @protocol DOServer - (byref id)createTarget; @end Server.m #import <Foundation/Foundation.h> #import "Protocol.h" @interface DOTarget : NSObject @end @interface DOServer : NSObject < DOServer > @end @implementation DOTarget - (id)init { if ((self = [super init])) { NSLog(@"Target created"); } return self; } - (void)dealloc { NSLog(@"Target destroyed"); [super dealloc]; } @end @implementation DOServer - (byref id)createTarget { return [[[DOTarget alloc] init] autorelease]; } @end int main() { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; DOServer *server = [[DOServer alloc] init]; NSConnection *connection = [[NSConnection new] autorelease]; [connection setRootObject:server]; if ([connection registerName:@"test-server"] == NO) { NSLog(@"Failed to vend server object"); } else [[NSRunLoop currentRunLoop] run]; [pool drain]; return 0; } Client.m #import <Foundation/Foundation.h> #import "Protocol.h" int main() { unsigned i = 0; for (; i < 3; i ++) { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; id server = [NSConnection rootProxyForConnectionWithRegisteredName:@"test-server" host:nil]; [server setProtocolForProxy:@protocol(DOServer)]; NSLog(@"Created target: %@", [server createTarget]); [[NSRunLoop currentRunLoop] runUntilDate:[NSDate dateWithTimeIntervalSinceNow:1.0]]; [pool drain]; } return 0; } The issue is that any remote objects created by the root proxy are not released when their proxy counterparts in the client go out of scope. According to the documentation: When an object’s remote proxy is deallocated, a message is sent back to the receiver to notify it that the local object is no longer shared over the connection. I would therefore expect that as each DOTarget goes out of scope (each time around the loop) it's remote counterpart would be dellocated, since there is no other reference to it being held on the remote side of the connection. In reality this does not happen: the temporary objects are only deallocate when the client application quits, or more accurately, when the connection is invalidated. I can force the temporary objects on the remote side to be deallocated by explicitly invalidating the NSConnection object I'm using each time around the loop and creating a new one but somehow this just feels wrong. Is this the correct behaviour from DO? Should all temporary objects live as long as the connection that created them? Are connections therefore to be treated as temporary objects which should be opened and closed with each series of requests against the server? Any insights would be appreciated.

    Read the article

  • jQuery selector not working in IE

    - by CurlyFro
    this method should return a unique array of text from rows with a specific td class. works in ffs and chrome but not in ie8 or safari. can you spot the problem? function getUniqueIds() { var tblLnks = new Array(); $('td.tblLnk').each(function() { tblLnks.push($(this).text().trim()); }); return tblLnks.unique(); }

    Read the article

  • How do I forward a request to a different url in python

    - by tax
    import SimpleHTTPServer import SocketServer class myHandler(SimpleHTTPServer.SimpleHTTPRequestHandler): def do_GET(self): print self.path if self.path == '/analog': return "http://someserver.com/analog" return SimpleHTTPServer.SimpleHTTPRequestHandler.do_GET(self) theport = 1234 Handler = myHandler pywebserver = SocketServer.TCPServer(("", theport), Handler) print "Python based web server. Serving at port", theport pywebserver.serve_forever()

    Read the article

< Previous Page | 432 433 434 435 436 437 438 439 440 441 442 443  | Next Page >