Search Results

Search found 13178 results on 528 pages for 'subsonic active record'.

Page 439/528 | < Previous Page | 435 436 437 438 439 440 441 442 443 444 445 446  | Next Page >

• Weblogic 10.3.0 : Loosing a stateless session bean in the bean pool

  - by KlasE

  Hi, We have a strange situation where we loose a Stateless SessionBean in a Bean Pool in Weblogic 10.3.0 Since we only have one bean in the pool, this effectively hangs all incoming calls. We do not want more than one instance in the pool because of application restrictions. In the Weblogic admin console, we can see that there are 1 instance in the bean pool, 0 beans in use and 1 waiting incoming request. The question is, what can have caused the system to not send the request to the one obviously free bean instance? This happens after several hours and over 100000 incoming requests, and the same scenario worked fine in the old weblogic 8 environment. We get the following stacktrace: "[ACTIVE] ExecuteThread: '5' for queue: 'weblogic.kernel.Default (self-tuning)'" waiting for lock java.util.concurrent.locks.AbstractQueuedSynchronizer$ConditionObject@b0d484 TIMED_WAITING sun.misc.Unsafe.park(Native Method) java.util.concurrent.locks.LockSupport.parkNanos(LockSupport.java:198) java.util.concurrent.locks.AbstractQueuedSynchronizer$ConditionObject.await(AbstractQueuedSynchronizer.java:2054) weblogic.ejb.container.pool.StatelessSessionPool.waitForBean(StatelessSessionPool.java:269) weblogic.ejb.container.pool.StatelessSessionPool.getBean(StatelessSessionPool.java:111) weblogic.ejb.container.manager.StatelessManager.preInvoke(StatelessManager.java:148) weblogic.ejb.container.internal.BaseRemoteObject.preInvoke(BaseRemoteObject.java:227) weblogic.ejb.container.internal.StatelessRemoteObject.preInvoke(StatelessRemoteObject.java:52) com.mycompany.beans.MessageLogFacace_n73y0z_EOImpl.isMyStuffValid(MessageLogFacace_n73y0z_EOImpl.java:261) com.mycompany.beans.MessageLogFacace_n73y0z_EOImpl_WLSkel.invoke(Unknown Source) weblogic.rmi.internal.BasicServerRef.invoke(BasicServerRef.java:589) weblogic.rmi.cluster.ClusterableServerRef.invoke(ClusterableServerRef.java:230) weblogic.rmi.internal.BasicServerRef$1.run(BasicServerRef.java:477) weblogic.security.acl.internal.AuthenticatedSubject.doAs(AuthenticatedSubject.java:363) weblogic.security.service.SecurityManager.runAs(Unknown Source) weblogic.rmi.internal.BasicServerRef.handleRequest(BasicServerRef.java:473) weblogic.rmi.internal.wls.WLSExecuteRequest.run(WLSExecuteRequest.java:118) weblogic.work.ExecuteThread.execute(ExecuteThread.java:201) weblogic.work.ExecuteThread.run(ExecuteThread.java:173) Any help would be very welcome. Regards Klas

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• How to delete duplicate records in MySQL by retaining those fields with data in the duplicate item b

  - by NJTechGuy

  I have few thousands of records with few 100 fields in a MySQL Table. Some records are duplicates and are marked as such. Now while I can simply delete the dupes, I want to retain any other possible valuable non-null data which is not present in the original version of the record. Hope I made sense. For instance : a b c d e f key dupe -------------------- 1 d c f k l 1 x 2 g h j 1 3 i h u u 2 4 u r t 2 x From the above sample table, the desired output is : a b c d e f key dupe -------------------- 2 g c h k j 1 3 i r h u u 2 If you look at it closely, the duplicate is determined by using the key (it is the same for 2 records, so the one that has an 'x' for dupe field is the one to be deleted by retaining some of the fields from the dupe (like c, e values for key 1). Please let me know if you need more info about this puzzling problem. Thanks a tonne! p.s : If it is not possible using MySQL, a PERL/Python script sample would be awesome! Thanks!

  Read the article

• SharePoint 2007 and SiteMinder

  - by pborovik

  Here is a question regarding some details how SiteMinder secures access to the SharePoint 2007. I've read a bunch of materials regarding this and have some picture for SharePoint 2010 FBA claims-based + SiteMinder security (can be wrong here, of course): SiteMinder is registered as a trusted identity provider for the SharePoint; It means (to my mind) that SharePoint has no need to go into all those user directories like AD, RDBMS or whatever to create a record for user being granted access to SharePoint - instead it consumes a claims-based id supplied by SiteMinder SiteMinder checks all requests to SharePoint resources and starts login sequence via SiteMinder if does not find required headers in the request (SMSESSION, etc.) SiteMinder creates a GenericIdentity with the user login name if headers are OK, so SharePoint recognizes the user as authenticated But in the case of SharePoint 2007 with FBA + SiteMinder, I cannot find an answer for questions like: Does SharePoint need to go to all those user directories like AD to know something about users (as SiteMinder is not in charge of providing user info like claims-based ids)? So, SharePoint admin should configure SharePoint FBA to talk to these sources? Let's say I'm talking to a Web Service of SharePoint protected by SiteMinder. Shall I make a Authentication.asmx-Login call to create a authentication ticket or this schema is somehow changed by the SiteMinder? If such call is needed, do I also need a SiteMinder authentication sequence? What prevents me from rewriting request headers (say, manually in Fiddler) before posting request to the SharePoint protected by SiteMinder to override its defence? Pity, but I do not have access to deployed SiteMinder + SharePoint, so need to investigate some question blindly. Thanks.

  Read the article

• when does factory girl create objects in db?

  - by Pavel K.

  i am trying to simulate a session using factory girl/shoulda (it worked with fixtures but i am having problems with using factories). i have following factories (user login and email both have 'unique' validations): Factory.define :user do |u| u.login 'quentin' u.email '[email protected]' end Factory.define :session_user, :class => Session do |u| u.association :user, :factory => :user u.session_id 'session_user' end and here's the test class MessagesControllerTest < ActionController::TestCase context "normal user" do setup do @request.session[:user_id]=Factory(:user).id @request.session[:session_id]=Factory(:session_user).session_id end should "be able to access new message creation" do get :new assert_response :success end end end but when i run "rake test:functionals", i get this test result 1) Error: test: normal user should be able to access new message creation. (MessagesControllerTest): ActiveRecord::RecordInvalid: Validation failed: Account name already exists!, Email already exists! which means that record already exists in db when i am referring to it in test setup. is there something i don't understand here? does factory girl create all factories in db on startup? rails 2.3.5/shoulda/factory girl

  Read the article

• Unable to get ncName and netBIOSName Properties

  - by Randz

  I've some code on the net regarding retrieval of NetBIOSName (Pre-windows 2000 domain name) of an Active Directory Domain. Here's my code sample: Me._rootDSE = New System.DirectoryServices.DirectoryEntry("GC://RootDSE", "", "") Dim results As System.DirectoryServices.SearchResultCollection = Nothing Dim ADSPath As String = "GC://CN=Partitions," + Me._rootDSE.Properties("configurationNamingContext").Value.ToString() Dim adse As System.DirectoryServices.DirectoryEntry = New System.DirectoryServices.DirectoryEntry(ADSPath, "", "") Dim searcher As System.DirectoryServices.DirectorySearcher searcher = New System.DirectoryServices.DirectorySearcher(adse) searcher.SearchScope = DirectoryServices.SearchScope.OneLevel searcher.Filter = "(&(objectClass=crossRef)(systemflags=3))" searcher.PropertiesToLoad.Add("netbiosname") searcher.PropertiesToLoad.Add("ncname") results = searcher.FindAll() If results.Count > 0 Then For Each sr As System.DirectoryServices.SearchResult In results Dim de As System.DirectoryServices.DirectoryEntry = sr.GetDirectoryEntry() 'netbiosname and ncname properties returns nothing System.Diagnostics.Trace.WriteLine(sr.GetDirectoryEntry().Properties("netbiosname").Value.ToString()) System.Diagnostics.Trace.WriteLine(sr.GetDirectoryEntry().Properties("ncname").Value.ToString()) Next End If When I am using the "(&(objectClass=crossRef)(systemFlags=3))" filter, I am not getting any result, but when I removed the systemFlags filter, I get some results. However, on the search results that I got, I still cannot access the values of ncName and NetBIOSName properties. I can get other properties like distinguishedName and CN of the search result properly. Any idea on what I might be doing wrong, or where to look further?

  Read the article

• Sudden issues reading uncompressed video using opencv

  - by JohnSavage

  I have been using a particular pipeline to process video using opencv to encode uncompressed video (fourcc = 0), and opencv python bindings to then open and work on these files. This has been working fine for me on OpenCV 2.3.1a on Ubuntu 11.10 until just a few days ago. For some reason it currently is only allowing me to read the first frame of a given file the first time I open that file. Further frames are not read, and once I touch the file once with my program, it then cannot even read the first frame. More detail: I created the uncompressed video files as follows: out_video.open(out_vid_name, 0, // FOURCC = 0 means record raw fps, Size(640, 480)) Again, these videos worked fine for me until about a week ago. Now, when I try to open one of these I get the following message (from what I think is ffmpeg): Processing video.avi Using network protocols without global network initialization. Please use avformat_network_init(), this will become mandatory later. [avi @ 0x29251e0] parser not found for codec rawvideo, packets or times may be invalid. It reads and displays the first frame fine, but then fails to read the next frame. Then, when I try to run my code on the same video, the capture still opens with the same message as above. However, it cannot even read the very first frame. Here is the code to open the capture: self.capture = cv2.VideoCapture(filename) if not self.capture.isOpened() print "Error: could not open capture" sys.exit() Again, this part is passed without any issue, but then the break happens at: success, rgb = self.capture.read() if not success: print "error: could not read frame" return False This part breaks at the second frame on the first run of the video file, and then on the first frame on subsequent runs. I really don't know where to even begin debugging this. Please help!

  Read the article

• How to create a view to manage associations between HABTM models? (Rails)

  - by Chris Hart

  Hello, I am using Ruby on Rails and need to create a view that allows the creation of records through a HABTM relationship to another model. Specifically, I have the following models: Customer and ServiceOverride, and a join table customers_serviceoverrides. Using the customer view for create/update, I need to be able to create, update and delete ServiceOverrides and manage the attributes of the associated model(s) from the same view. Visually I'd prefer to have something like a plus/minus sign to add/delete service overrides, and each serviceoverride record has two string entities which need to be displayed and editable as well. However, if I could just get the code (a kind of nested form, I'm assuming?) working, I could work out the UI aspects. The models are pretty simple: class ServiceOverride < ActiveRecord::Base has_and_belongs_to_many :customers end class Customer < ActiveRecord::Base has_and_belongs_to_many :serviceoverrides end The closest thing I've found explaining this online is on this blog but it doesn't really address what I'm trying to do (both manage the linkages to the other model, and edit attributes of that model. Any help is appreciated. Thanks in advance. Chris

  Read the article

• How to import data to SAP

  - by Mehmet AVSAR

  Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

  Read the article

• Spelling correction for data normalization in Java

  - by dareios

  I am looking for a Java library to do some initial spell checking / data normalization on user generated text content, imagine the interests entered in a Facebook profile. This text will be tokenized at some point (before or after spell correction, whatever works better) and some of it used as keys to search for (exact match). It would be nice to cut down misspellings and the like to produce more matches. It would be even better if the correction would perform well on tokens longer than just one word, e.g. "trinking coffee" would become "drinking coffee" and not "thinking coffee". I found the following Java libraries for doing spelling correction: JAZZY does not seem to be under active development. Also, the dictionary-distance based approach seems inadequate because of the use of non-standard language in social network profiles and multi-word tokens. APACHE LUCENE seems to have a statistical spell checker that should be much more suited. Question here would how to create a good dictionary? (We are not using Lucene otherwise, so there is no existing index.) Any suggestions are welcome!

  Read the article

• MS-Access: What could cause one form with a join query to load right and another not?

  - by Daniel Straight

  Form1 Form1 is bound to Table1. Table1 has an ID field. Form2 Form2 is bound to Table2 joined to Table1 on Table2.Table1_ID=Table1.ID Here is the SQL (generated by Access): SELECT Table2.*, Table1.[FirstFieldINeed], Table1.[SecondFieldINeed], Table1.[ThirdFieldINeed] FROM Table1 INNER JOIN Table2 ON Table1.ID = Table2.[Table1_ID]; Form2 is opened with this code in Form1: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form2", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form1", acSaveYes And when loaded runs: Me.[Table1_ID] = Me.OpenArgs When Form2 is loaded, fields bound to columns from Table1 show up correctly. Form3 Form3 is bound to Table3 joined to Table2 on Table3.Table2_ID=Table2.ID Here is the SQL (generated by Access): SELECT Table3.*, Table2.[FirstFieldINeed], Table2.[SecondFieldINeed] FROM Table2 INNER JOIN Table3 ON Table2.ID = Table3.[Table2_ID]; Form3 is opened with this code in Form2: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form3", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form2", acSaveYes And when loaded runs: Me.[Table2_ID] = Me.OpenArgs When Form3 is loaded, fields bound to columns from Table2 do not show up correctly. WHY? UPDATES I tried making the join query into a separate query and using that as my record source, but it made no difference at all. If I go to the query for Form3 and view it in datasheet view, I can see that the information that should be pulled into the form is there. It just isn't showing up on the form.

  Read the article

• In Seam what's the difference between injected EntityManager and getEntityManager from EntityHome

  - by Navi

  I am testing a Seam application using the needle test API. In my code I am using the getEntityManager() method from EntityHome. When I run the unit tests against an in memory database I get the following exception: java.lang.IllegalStateException: No application context active at org.jboss.seam.Component.forName(Component.java:1945) at org.jboss.seam.Component.getInstance(Component.java:2005) at org.jboss.seam.Component.getInstance(Component.java:1983) at org.jboss.seam.Component.getInstance(Component.java:1977) at org.jboss.seam.Component.getInstance(Component.java:1972) at org.jboss.seam.framework.Controller.getComponentInstance(Controller.java:272) at org.jboss.seam.framework.PersistenceController.getPersistenceContext(PersistenceController.java:20) at org.jboss.seam.framework.EntityHome.getEntityManager(EntityHome.java:177) etc .. I can resolve some of these errors by injecting the EntityManager with @In EntityManager entityManager; Unfortunately the persist method of EntityHome also calls the getEntityManager. This means a lot of mocks or rewriting the code somehow. Is there any workaround and why is this exception thrown anyway? I am using Seam 2.2.0 GA by the way. There is nothing special about the components. They are generated by seam-gen. The test is performed with in memory database - I followed the examples in http://jbosscc-needle.sourceforge.net/jbosscc-needle/1.0/db-util.html.

  Read the article

• delayed evaluation of code in subroutines - 5.8 vs. 5.10 and 5.12

  - by Brock

  This bit of code behaves differently under perl 5.8 than it does under perl 5.12: my $badcode = sub { 1 / 0 }; print "Made it past the bad code.\n"; [brock@chase tmp]$ /usr/bin/perl -v This is perl, v5.8.8 built for i486-linux-gnu-thread-multi [brock@chase tmp]$ /usr/bin/perl badcode.pl Illegal division by zero at badcode.pl line 1. [brock@chase tmp]$ /usr/local/bin/perl -v This is perl 5, version 12, subversion 0 (v5.12.0) built for i686-linux [brock@chase tmp]$ /usr/local/bin/perl badcode.pl Made it past the bad code. Under perl 5.10.1, it behaves as it does under 5.12: brock@laptop:/var/tmp$ perl -v This is perl, v5.10.1 (*) built for i486-linux-gnu-thread-multi brock@laptop:/var/tmp$ perl badcode.pl Made it past the bad code. I get the same results with a named subroutine, e.g. sub badcode { 1 / 0 } I don't see anything about this in the perl5100delta pod. Is this an undocumented change? A unintended side effect of some other change? (For the record, I think 5.10 and 5.12 are doing the Right Thing.)

  Read the article

• Mode specific key bindings

  - by rejeep

  Hey, I have a minor mode that also comes with a global mode. The mode have some key bindings and I want the user to have the posibility to specify what bindings should work for each mode. (my-minor-mode-bindings-for-mode 'some-mode '(key1 key2 ...)) (my-minor-mode-bindings-for-mode 'some-other-mode '(key3 key4 ...)) So I need some kind of mode/buffer-local key map. Buffer local is a bit problematic since the user can change the major mode. I have tried some solutions of which neither works any good. Bind all possible keys always and when the user types the key, check if the key should be active in that mode. Execute action if true, otherwise fall back. Like the previous case only that no keys are bound. Instead I use a pre command hook and check if the key pressed should do anything. For each buffer update (whatever that means), run a function that first clears the key map and then updates it with the bindings for that particular mode. I have tried these approaches and I found problems with all of them. Do you know of any good way to solve this? Thanks!

  Read the article

• NSBorderlessWindow not responding to CMD-W/CMD-M

  - by Sean

  I have an NSBorderlessWindow subclass of NSWindow with a transparent and non-opaque background (so it's non-rectangular in appearance). I've added my own buttons to function as the close and minimize buttons when I click them, but for some reason the window will not respond to CMD-W or CMD-M like a normal one does. I have my NSWindow subclass set to return YES to canBecomeKeyWindow and canBecomeMainWindow. My NIB still has all the standard menu items in it that are there when you create a new project - including the "Minimize" item in the Window menu with the default shortcut CMD-M defined. It's hooked up to send performMiniaturize: to the first responder. However it is not enabled when the app is run, so it seems like it must be asking the window if it can minimize and the window says no or something. (I'm still very new to OSX/Cocoa.) What am I missing? Also, and maybe this is related, my borderless window has a shadow enabled - but unlike a normal titled window, when I make my window the active/front window by clicking on it, the shadow doesn't change. Normally an OSX focused window has a slightly larger/darker shadow to make it stand out more but mine never changes the shadow. It's like I'm missing something to make the OS treat this window as a real/normal/main window or something and as a result I lose the shadow change and functioning CMD-W/CMD-M.

  Read the article

• Dynamic Google Maps API InfoWindow HTML Content

  - by Peter Hanneman

  I am working in Flash Builder 4 with Google Map's ActionScript API. I have created a map, loaded some custom markers onto it and added some MouseEvent listeners to each marker. The trouble comes when I load an InfoWindow panel. I want to dynamically set the htmlContent based off of information stored in a database. The trouble is that this information can change every couple of seconds and each marker has a unique data set so I can not statically set it at the time I actually create the markers. I have a method that will every minute or so load all of the records from my database into an Object variable. Everything I need to display in the htmlContent is contained in this object under a unique identifier. The basic crux of the problem is that there is no way for me to uniquely identify an info window, so I can not determine what information to pull into the panel. marker.addEventListener(MapMouseEvent.ROLL_OVER, function(e:MapMouseEvent):void { showInfoWindow(e.latLng) }, false, 0, false); That is my mouse event listener. The function I call, "showInfowindow" looks like this: private function showInfoWindow(latlng:LatLng):void { var options:InfoWindowOptions = new InfoWindowOptions({title: appData[*I NEED A UNIQUE ID HERE!!!*].type + " Summary", contentHTML: appData[*I NEED A UNIQUE ID HERE!!!*].info}); this.map.openInfoWindow(latlng, options); } I thought I was onto something by being able to pass a variable in my event listener declaration, but it simply hates having a dynamic variable passed through, it only returns the last value use. Example: marker.addEventListener(MapMouseEvent.ROLL_OVER, function(e:MapMouseEvent):void { showInfoWindow(e.latLng, record.unit_id) }, false, 0, false); That solution is painfully close to working. I iterate through a loop to create my markers when I try the above solution and roll over a marker I get information, but every marker's information reflects whatever information the last marker created had. I apologize for the long explaination but I just wanted to make my question as clear as possible. Does anyone have any ideas about how to patch up my almost-there-solution that I posted at the bottom or any from the ground up solutions? Thanks in advance, Peter Hanneman

  Read the article

• A Django form for entering a 0 to n email addresses

  - by Erik

  I have a Django application with some fairly common models in it: UserProfile and Organization. A UserProfile or an Organization can both have 0 to n emails, so I have an Email model that has a GenericForeignKey. UserProfile and Organization Models both have a GenericRelation called emails that points back to the Email model (summary code provided below). The question: what is the best way to provide an Organization form that allows a user to enter organization details including 0 to n email addresses? My Organization create view is a Django class-based view. I'm leading towards creating a dynamic form and an enabling it with Javascript to allow the user to add as many email addresses as necessary. I will render the form with django-crispy-forms. I've thought about doing this with a formset embedded within the form, but this seems like overkill for email addresses. Embedding a formset in a form delivered by a class-based view is cumbersome too. Note that the same issue occurs with the Organization fields phone_numbers and locations. emails.py: from django.db import models from parent_mixins import Parent_Mixin class Email(Parent_Mixin,models.Model): email_type = models.CharField(blank=True,max_length=100,null=True,default=None,verbose_name='Email Type') email = models.EmailField() class Meta: app_label = 'core' organizations.py: from emails import Email from locations import Location from phone_numbers import Phone_Number from django.contrib.contenttypes import generic from django.db import models class Organization(models.Model): active = models.BooleanField() duns_number = models.CharField(blank=True,default=None,null=True,max_length=9) # need to validate this emails = generic.GenericRelation(Email,content_type_field='parent_type',object_id_field='parent_id') legal_name = models.CharField(blank=True,default=None,null=True,max_length=200) locations = generic.GenericRelation(Location,content_type_field='parent_type',object_id_field='parent_id') name = models.CharField(blank=True,default=None,null=True,max_length=200) organization_group = models.CharField(blank=True,default=None,null=True,max_length=200) organization_type = models.CharField(blank=True,default=None,null=True,max_length=200) phone_numbers = generic.GenericRelation(Phone_Number,content_type_field='parent_type',object_id_field='parent_id') taxpayer_id_number = models.CharField(blank=True,default=None,null=True,max_length=9) # need to validate this class Meta: app_label = 'core' parent_mixins.py from django.contrib.contenttypes.models import ContentType from django.contrib.contenttypes import generic from django.db import models class Parent_Mixin(models.Model): parent_type = models.ForeignKey(ContentType,blank=True,null=True) parent_id = models.PositiveIntegerField(blank=True,null=True) parent = generic.GenericForeignKey('parent_type', 'parent_id') class Meta: abstract = True app_label = 'core'

  Read the article

• Passing a LINQ DataRow Reference in a GridView's ItemTemplate

  - by Bob Kaufman

  Given the following GridView: <asp:GridView runat="server" ID="GridView1" AutoGenerateColumns="false" DataKeyNames="UniqueID" OnSelectedIndexChanging="GridView1_SelectedIndexChanging" > <Columns> <asp:BoundField HeaderText="Remarks" DataField="Remarks" /> <asp:TemplateField HeaderText="Listing"> <ItemTemplate> <%# ShowListingTitle( ( ( System.Data.DataRowView ) ( Container.DataItem ) ).Row ) %> </ItemTemplate> </asp:TemplateField> <asp:BoundField HeaderText="Amount" DataField="Amount" DataFormatString="{0:C}" /> </Columns> </asp:GridView> which refers to the following code-behind method: protected String ShowListingTitle( DataRow row ) { Listing listing = ( Listing ) row; return NicelyFormattedString( listing.field1, listing.field2, ... ); } The cast from DataRow to Listing is failing (cannot convert from DataRow to Listing) I'm certain the problem lies in what I'm passing from within the ItemTemplate, which is simply not the right reference to the current record from the LINQ to SQL data set that I've created, which looks like this: private void PopulateGrid() { using ( MyDataContext context = new MyDataContext() ) { IQueryable < Listing > listings = from l in context.Listings where l.AccountID == myAccountID select l; GridView1.DataSource = listings; GridView1.DataBind(); } }

  Read the article

• Add Zend_Navigation to the View with old legacy bootstrap

  - by Grant Collins

  Hi, I've been struggling with Zend_Navigation all weekend, and now I have another problem, which I believe has been the cause of a lot of my issues. I am trying to add Zend_Navigation to a legacy 1.7.6 Zend Framework application, i've updated the Zend Library to 1.9.0 and updated the bootstrap to allow this library update. The problem is that I don't know how, and the examples show the new bootstrap method of how to add the Navigation object to the view, I've tried this: //initialise the application layouts with the MVC helpers $layout = Zend_Layout::startMvc(array('layoutPath' => '../application/layouts')); $view = $layout->getView(); $configNav = new Zend_Config_Xml('../application/config/navigation.xml', 'navigation'); $navigation = new Zend_Navigation($configNav); $view->navigation($navigation); $viewRenderer = new Zend_Controller_Action_Helper_ViewRenderer(); $viewRenderer->setView($view); This seems to run through fine, but when I go to use the breadcrumb view helper in my layout, it errors with: Strict Standards: Creating default object from empty value in C:\www\moobia\development\website\application\modules\employers\controllers\IndexController.php on line 27 This is caused by the following code in the init() function of my controller. $uri = $this->_request->getPathInfo(); $activeNav = $this->view->navigation()->findByUri($uri); <- this is null when called $activeNav->active = true; I believe it's because the Zend_Navigation object is not in the view. I would look at migrating the bootstrap to the current method, but at present I am running out of time for a release. Thanks, Grant

  Read the article

• Authlogic Current User Question - hiding admin links...

  - by bgadoci

  I think I am missing something while using the Authlogic gem w/ Rails. To set the stage I have multiple users and each user can create posts and comments. Upon the display of a post or comment I would like to give the user who created them the option to edit or destroy. I am successfully using the following code to hide and show elements based on if a user is logged in or not but can't seem to find out how to only show these links to the actual user who created them...not any user that is logged in. <% if current_user %> <%= link_to 'Edit', edit_question_path(question) %> | <%= link_to 'Destroy', question, :confirm => 'Are you sure?', :method => :delete %> <% else %> <p>nothing to see here</p> <% end %> Here is the def of current_user located in the application controller in case I need to change something here. class ApplicationController < ActionController::Base helper :all # include all helpers, all the time protect_from_forgery # See ActionController::RequestForgeryProtection for details# helper_method :current_user private def current_user_session return @current_user_session if defined?(@current_user_session) @current_user_session = UserSession.find end def current_user return @current_user if defined?(@current_user) @current_user = current_user_session && current_user_session.record end end

  Read the article

• MSN Messenger API

  - by MarceloRamires

  back when I was not working with programming (using skills from courses and school) I started developing a simple program that is supposed to get the Artwork of the album to which the song you're currently listening in iTunes to and set it as you Display Picture in MSN Messenger (everything had to be open at the same time). I was so excited about it, made it as nicely as I could back then (now I consider it a design and usability complete fail), and it surprisingly worked. Now, a couple of versions ahead (MSN from 8.5 to 9.0, iTunes from 8 to 9, and windows from Vista to 7) I am getting some incompatibility issues. Where I work, I use Windows 7, Windows Live Messenger 2009 and iTunes 9 - it works just just like before, but at home I have the same exact setup, but something weird happens: When I open the program (having my itunes AND msn open) it doesn't use the active MSN instance, instead it opens a new one, and doesn't work even on this opened one. I've tried it with a couple of libraries: Interop.Messenger.dll - workis like described above Interop.MessengerAPI.dll - works like described above Interop.MessengerPrivate.dll - never worked MSNMessenger.dll - the one I used before - doesn't work anymore at all What could I do ? Info: Visual Studio 2008, .NET 3.5, C#, WinForms application. I'll watch this question and add any information if requested

  Read the article

• Retrieve COM ProgID from exe without registering it

  - by mangelo

  Background: I would like to extract the COM data from a VB6 application so I can register it correctly (according to Microsoft best practice) the application. I am using WiX 3.0 and heat.exe will not extract the data (known issue with heat) and I do not have ready access to the associated TLB file. The VB6 application does not have compatibility turned on so it regenerates the COM GUIDs every build (They want to have the application be able to run side by side with an older version.) I created a C# application that will collect the TypeLib, interface and CoClass information from the VB6 application without registering it and create a wxs file for candle to use. My company has several other older applications like this and I would like to make it a more generic solution. The Issues: 1.Is there a way to collect the 'true' ProgID (programmer intended one) from the application with out the project or TLB file and without registering it? 2.Is there a way to find out the intended Threading Model from a DLL without registering it? (I intend that it can handle all COM active items, might as well be complete) Thank you.

  Read the article

• SQL (mySQL) update some value in all records processed by a select

  - by jdmuys

  I am using mySQL from their C API, but that shouldn't be relevant. My code must process records from a table that match some criteria, and then update the said records to flag them as processed. The lines in the table are modified/inserted/deleted by another process I don't control. I am afraid in the following, the UPDATE might flag some records erroneously since the set of records matching might have changed between step 1 and step 3. SELECT * FROM myTable WHERE <CONDITION>; # step 1 <iterate over the selected set of lines. This may take some time.> # step 2 UPDATE myTable SET processed=1 WHERE <CONDITION> # step 3 What's the smart way to ensure that the UPDATE updates all the lines processed, and only them? A transaction doesn't seem to fit the bill as it doesn't provide isolation of that sort: a recently modified record not in the originally selected set might still be targeted by the UPDATE statement. For the same reason, SELECT ... FOR UPDATE doesn't seem to help, though it sounds promising :-) The only way I can see is to use a temporary table to memorize the set of rows to be processed, doing something like: CREATE TEMPORARY TABLE workOrder (jobId INT(11)); INSERT INTO workOrder SELECT myID as jobId FROM myTable WHERE <CONDITION>; SELECT * FROM myTable WHERE myID IN (SELECT * FROM workOrder); <iterate over the selected set of lines. This may take some time.> UPDATE myTable SET processed=1 WHERE myID IN (SELECT * FROM workOrder); DROP TABLE workOrder; But this seems wasteful and not very efficient. Is there anything smarter? Many thanks from a SQL newbie.

  Read the article

• LPX-00607 for ora:contains in java but not sqlplus

  - by Windle

  Hey all, I am trying to doing some sql querys out of Oracle 11g and am having issues using ora:contains. I am using spring's jdbc impl and my code generates the sql statement: select * from view_name where column_a = ? and column_b = ? and existsNode(xmltype(clob_column), 'record/name [ora:contains(text(), "name1") 0]', 'xmlns:ora="http://xmlns.oralce.com/xdb"') = 1 I have removed the actual view / column names obviously, but when I copy that into sqlplus and substitute in random values, the select executes properly. When I try to run it in my DAO code I get this stack trace: org.springframework.jdbc.UncatergorizedSQLException: PreparedStatementCallback; uncatergorizedSQLException for SQL [the big select above]; SQL state [99999]; error code [31011]; ORA-31011: XML parsing failed. ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' ;nested exception is java.sql.SQLException: ORA-31011: XML parsing failed ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' (continues on like this for awhile....) I think it is worth mentioning that I am using maven and it is possible I am missing some dependency that is required for this. Sorry the post is so long, but I wanted to err on the side of too much info. Thanks for taking the time to read this at least =) -Windle

  Read the article

• Frameworks to manage dates (effective date and expiry dates)

  - by user214626

  Hello, We have an object that can has an effective date and expiry date.(Ex. i want to maintain the price of a commodity for a time period) Business Rules - Effective date is always a valid date (a datestamp) but, expiry date can be null to indicate that the object is active throughout. Also, both effective and expiry date can be set to some valid dates. Are there any frameworks that manage objects such that the objects are consistent,i.e there are no overlaps of the validity periods ? Ex. class XBOX { double price; Date effectiveDate; Date expiryDate; } XBOX x1 = new XBOX(400$, '2007-01-01','2008-12-31' ); XBOX x2 = new XBOX(200$, '2009-01-01',null ); Assume that we get a new rate from '2010-01-01' and a new XBOX object has to be created (to persist). Is there a framework/pattern that can do the following, so that the XBOX is consistent. x2.setExpiryDate('2009-12-31') XBOX x3 = new XBOX(150$, '2010-01-01',null ); Thanks in advance.

  Read the article

< Previous Page | 435 436 437 438 439 440 441 442 443 444 445 446  | Next Page >